Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control

Size: px
Start display at page:

Download "Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control"

Transcription

1 Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular Genetics

2 HT GHRH Somato- Pituitary statin Introduction IGF-1 [GH] General growth Liver Pancreas [IGF-1] [Ins] WAT Muscle [Glc]

3 Introduction IGF-1 Igf-1 gene in mice is located on chromosome 10 (~ 87,8 87,9 Mb) P1 P2 Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Class I transcripts C1 Ea C1 Eb Expression of auto and paracrine acting IGF-1 Class II transcripts C2 Ea C2 Eb Expression of endocrine acting IGF-1

4 Introduction Cre-LoxP and Adipose Tissue specific KO of IGF-1 Requirements for adipose tissue specific IGF-1 KO: Cre : recombinase that cuts and merges DNA at specific sequences LoxP: sequence driven cutting targets of Cre ap2: Promotor specific for gene expression in Adipose Tissue (AT) cre CRE LoxP igf1 LoxP

5 Introduction Cre-LoxP and Adipose Tissue specific KO of IGF-1 Requirements for adipose tissue specific IGF-1 KO: Cre : recombinase that cuts and merges DNA at specific sequences LoxP: sequence driven cutting targets of Cre ap2: Promotor specific for gene expression in Adipose Tissue (AT) LoxP igf1 LoxP CRE cre

6 Introduction Cre-LoxP and Adipose Tissue specific KO of IGF-1 Requirements for adipose tissue specific IGF-1 KO: Cre : recombinase that cuts and merges DNA at specific sequences LoxP: sequence driven cutting targets of Cre ap2: Promotor specific for gene expression in Adipose Tissue (AT) WAT CRE CRE ap2 cre ap2 cre

7 Results on B6N Body weight B6N wt vs. ap2 driven adipose tissue specific IGF-1 KO (AT-IGF1-KO) on SMD and HFD males females In AT-IGF1-KO mice no significant reduction of BW, LM, FM compared to wt.

8 Results on B6 Males Glucose tolerance males * Females females Insulin tolerance males females Males Females Males Females * AT-IGF1-KO females: Glucose clearance is delayed on HFD. AT-IGF1-KO males: No significant difference in insulin tolerance on HFD.

9 Results on B6N ap2cre generates only partial KO in adipose tissues Relative transcript amount 2 (-ΔΔct) 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 wt AT-IGF1-KO Igf-1 Inguinal adipose tissue Igf-1 Gonadal adipose tissue * 0,9 * Ea Eb Ea C1 Eb n= 12 n= 10 Relative transcript amount 2 (-ΔΔct) 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 Ea Eb Ea Eb C2 C1 C2 Auto- paracrine Endocrine Auto- paracine Endocrine Autocrine Igf-1 in adipose tissue reduced in AT-IGF1-KO

10 Results on B6N wt IGF-1 Serum protein Relative transcript amount 2 (-ΔΔct) IGF-1 [ng/ml] AT-IGF1-KO 1,2 1 Igf-1 expression in liver * < 0,1 wt n= 12 KO n= ,8 0,6 0,4 0,2 0 n= 56 n= 24 Autocrine Igf-1 in AT reduced in AT-IGF1-KO Liver Igf-1 expression elevated in AT-IGF1-KO Serum IGF-1 unaltered 0 Ea Eb Ea Eb C1 auto-paracrine C2 endocrine

11 Results on B6N wt AT-IGF1-KO

12 AT-IGF1-KO in Berlin Fatmouse Imbed line Berlin Fat Mouse Inbred Line 860 (BFMI860) Higher body weight, body fat+ and lean mass compared to B6 general higher fat mass lean mass marginally increased 1 in spite of high fatness not deficient in blood glucose control 2;3 but high blood levels of insulin and high blood levels of IGF-1 BFMI * * BFMI B6 1: Wagener, Asja et al.; Physiol Genomics 27: , : Hantschel, Claudia et al.; Obesity Facts 4: : Schäfer, Nadine et al.; Growth Factors 29(6): , 2011 Hypothesis: Higher effect of AT-IGF1-KO on BFMI due to higher fat mass

13 BW in [g] Results on BFMI Body weight, males n= Age [days] wt 4,5 4,0 3,5 3,0 2,5 2,0 1,5 1,0 0,5 0,0 n=3 KO Organ weights, males * Age 20 weeks * Trends similar to B6N, reduced organ weights in BFMI-KO, except for liver

14 [ng/ml] Results on BFMI Igf-1 relative expression, males, 20 weeks 0,6 0,5 0,4 0,3 0,2 0,1 0 Inguinal adipose tissue Ea Eb C1 Auto- paracrine Ea Eb C2 Endocrine 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 wt n=7 n=3 KO Gonadal adipose tissue Ea Eb C1 Auto- paracrine Ea Eb C2 Endocrine 1 0,8 0,6 0,4 0,2 0 Liver Ea Eb C1 Auto- paracrine Ea Eb C2 Endocrine Serum IGF-1, males, 20 weeks No significant differences in Igf-1 expression or IGF-1 serum levels between KO and wt on BFMI background.

15 Results on BFMI wt n=20 n=4 KO Time [min] Time [min]

16 Discussion/ Outlook Results AT-IGF1-KO KO of IGF1 occurs partialy in AT IGF1 produced in adipose tissue likely contributes to the regulation of glucose homeostasis Effects in the first place on HFD and in fat mice compared to SMD More animals and adipose tissue wide KO are needed to confirm the effects A safe KO in the adipose tissue with another Cre mouse will be generated

17 Acknowledgemends Thanks to GRK1208 and DFG for funding The mice being sacrificed for my researches

18 Acknowledgemends Thanks to the whole Group of Professor Brockmann

19 Thank you for your attention

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

Examples of questions for Cellular Immunology/Cellular Biology and Immunology Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

CHAPTER 50 Endocrine Systems. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

CHAPTER 50 Endocrine Systems. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. CHAPTER 50 Endocrine Systems Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Endocrine system All the endocrine glands and other organs with hormonesecreting

More information

Hypothalamic & Pituitary Hormones

Hypothalamic & Pituitary Hormones 1 Hypothalamic & Pituitary Hormones Pharmacologic Applications: Drugs that mimic or block the effects of hypothalamic or pituitary hormones have the following applications: 1. Replacement therapy for hormone

More information

Living Control Mechanisms

Living Control Mechanisms Living Control Mechanisms Dr Kate Earp MBChB MRCP Specialty Registrar Chemical Pathology & Metabolic Medicine kate.earp@sth.nhs.uk 15/10/2015 Contents Aims & objectives Homeostasis Cell communication Introduction

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons

High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen

More information

Preface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena?

Preface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena? Preface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena? Types of Studies Principles of Measurement and Observation

More information

Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D.

Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. I. Growth Hormone (somatotropin): Growth hormone (GH) is a 191 amino acid single chain polypeptide (MW 22,000 daltons). Growth

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

A 10.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo. DNA polymerase (Stratagene) and cloned into pcr Blunt II-TOPO vector

A 10.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo. DNA polymerase (Stratagene) and cloned into pcr Blunt II-TOPO vector Supplemental Method: Generation of a conditional GHR knockout mice. A 1.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo DNA polymerase (Stratagene) and cloned into pcr Blunt

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Features of the Metabolic Syndrome in the Berlin Fat Mouse as a Model for Human Obesity

Features of the Metabolic Syndrome in the Berlin Fat Mouse as a Model for Human Obesity Original Article Published online: July 26, 2011 DOI: 10.1159/000330819 Features of the Metabolic Syndrome in the Berlin Fat Mouse as a Model for Human Obesity Claudia Hantschel a Asja Wagener a Christina

More information

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D. The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C

More information

Growth IGF Analyte Information

Growth IGF Analyte Information Growth IGF-1 Analyte Information - 1 - IGF-1 Introduction Insulin-like growth factor 1 (IGF-1, IGF-I) is a single chain polypeptide containing 70 amino acids and three disulfide bridges. It is structurally

More information

Cell to Cell Communication

Cell to Cell Communication Review #1 08 Review using OPAL figures Review using class web PDF Preview of test #1 Cell to Cell Communication 1 Communication Strategies endocrine neurocrine paracrine autocrine Endocrine System Overview

More information

The Beauty of the Skin

The Beauty of the Skin The Beauty of the Skin Rose-Anne Romano, Ph.D Assistant Professor Department of Oral Biology School of Dental Medicine State University of New York at Buffalo The Big Question How do approximately 50 trillion

More information

PKCδ regulates hepatic insulin sensitivity and hepatosteatosis in mice and humans

PKCδ regulates hepatic insulin sensitivity and hepatosteatosis in mice and humans Research article PKCδ regulates hepatic insulin sensitivity and hepatosteatosis in mice and humans Olivier Bezy, 1 Thien T. Tran, 1 Jussi Pihlajamäki, 2 Ryo Suzuki, 1 Brice Emanuelli, 1 Jonathan Winnay,

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

BIOL 2458 A&P II CHAPTER 18 SI Both the system and the endocrine system affect all body cells.

BIOL 2458 A&P II CHAPTER 18 SI Both the system and the endocrine system affect all body cells. BIOL 2458 A&P II CHAPTER 18 SI 1 1. Both the system and the endocrine system affect all body cells. 2. Affect on target cells by the system is slow. Affect on target cells by the system is fast. INTERCELLULAR

More information

BIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female

BIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female BIOM2010 (till mid sem) Endocrinology Endocrine system Endocrine gland : a that acts by directly into the which then to other parts of the body to act on (cells, tissues, organs) : found at e.g. anterior

More information

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )

More information

Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated

Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated thermogenesis Qingzhang Zhu,, James C. Barrow, Anutosh Chakraborty J Clin Invest. 2016;126(11):4273-4288. https://doi.org/10.1172/jci85510.

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

NOTES 11.5: ENDOCRINE SYSTEM. Pages

NOTES 11.5: ENDOCRINE SYSTEM. Pages NOTES 11.5: ENDOCRINE SYSTEM Pages 1031-1042 ENDOCRINE SYSTEM Communication system that controls metabolism, growth, and development with hormones Maintains homeostasis Hormones: chemical messengers released

More information

The somatopause. What stops our growth and diminishes GH secretion?

The somatopause. What stops our growth and diminishes GH secretion? The somatopause What stops our growth and diminishes GH secretion? What extends or stops statural growth? Statural growth is extended if the early growth rate is slowed underfed adolescents grow for a

More information

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

Endocrine System. Regulating Blood Sugar. Thursday, December 14, 17

Endocrine System. Regulating Blood Sugar. Thursday, December 14, 17 Endocrine System Regulating Blood Sugar Stress results in nervous and hormonal responses. The adrenal glands are located above each kidney. Involved in stress response. Stress Upsets Homeostasis Stress

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled Are adult pancreatic beta cells formed by self-duplication or stem cell differentiation? Introduction Researchers have long been interested in how tissues produce and maintain the correct number of cells

More information

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Effects of perinatal exposure to BPA on obesity and metabolic disease later in life

Effects of perinatal exposure to BPA on obesity and metabolic disease later in life Effects of perinatal exposure to BPA on obesity and metabolic disease later in life Beverly S. Rubin, PhD, Tufts University School of Medicine, Boston MA 02111 Institute of Medicine Roundtable: The Interplay

More information

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

Cell to Cell Communication

Cell to Cell Communication Review #1 15 Review using OPAL figures Review using class web PDF Preview of test #1 Cell to Cell Communication 1 Communication Strategies endocrine neurocrine paracrine autocrine Endocrine System Overview

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre

More information

Alteration of JNK-1 Signaling in Skeletal Muscle Fails to Affect Glucose Homeostasis and Obesity-Associated Insulin Resistance in Mice

Alteration of JNK-1 Signaling in Skeletal Muscle Fails to Affect Glucose Homeostasis and Obesity-Associated Insulin Resistance in Mice Alteration of JNK-1 Signaling in Skeletal Muscle Fails to Affect Glucose Homeostasis and Obesity-Associated Insulin Resistance in Mice Martin Pal 1., Claudia M. Wunderlich 1., Gabriele Spohn 1, Hella S.

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

(1) The graph shows how the percentages of obese men and women in the UK changed between 1994 and 2004.

(1) The graph shows how the percentages of obese men and women in the UK changed between 1994 and 2004. Q1. Obesity is a factor that affects Coronary Heart Disease (CHD). (a) What is meant by obesity?...... (b) The graph shows how the percentages of obese men and women in the UK changed between 1994 and

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Adipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA

Adipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA Adipose tissue: Roles and function in diabetes and beyond August 2015; SAGLB.DIA.15.07.0398 Acknowledgement The following slides intend to summarise the key points presented during the Banting Medal for

More information

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice. Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological

More information

Clinical Guideline POSITION STATEMENT ON THE INVESTIGATION AND TREATMENT OF GROWTH HORMONE DEFICIENCY IN TRANSITION

Clinical Guideline POSITION STATEMENT ON THE INVESTIGATION AND TREATMENT OF GROWTH HORMONE DEFICIENCY IN TRANSITION Clinical Guideline POSITION STATEMENT ON THE INVESTIGATION AND TREATMENT OF GROWTH HORMONE DEFICIENCY IN TRANSITION Date of First Issue 01/04/2015 Approved 28/01/2016 Current Issue Date 28/01/2016 Review

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Endocrine Pharmacology

Endocrine Pharmacology Endocrine Pharmacology 17-2-2013 DRUGS AFFECTING THE ENDOCRINE SYSTEM The endocrine system is the system of glands, each of which secretes a type of hormone directly into the bloodstream to regulate the

More information

Humatrope*, Norditropin*, Genotropin, Nutropin, Nutropin AQ, Omnitrope, Saizen

Humatrope*, Norditropin*, Genotropin, Nutropin, Nutropin AQ, Omnitrope, Saizen Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.30.11 Subject: Growth Hormone Adult Page: 1 of 6 Last Review Date: December 8, 2017 Growth Hormone Adult

More information

Critical role for peptide YY in protein-mediated satiation and bodyweight

Critical role for peptide YY in protein-mediated satiation and bodyweight Cell Metabolism, Volume 4 Supplemental data Critical role for peptide YY in protein-mediated satiation and bodyweight regulation Rachel L. Batterham, Helen Heffron, Saloni Kapoor, Joanna E. Chivers, Keval

More information

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction

Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Human Physiology 6.6- Hormones, Homeostasis, and Reproduction Essential idea: Hormones are used when signals need to be widely distributed. Application: William Harvey s investigation of sexual reproduction

More information

Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model

Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model Susan M. Smith Nutrition Research Institute University of North Carolina at Chapel Hill C57Bl/6J Teklad 8626 Mouse Model of PAE Our

More information

Testosterone and other male hormones seem to be related to aggressive behavior in some species

Testosterone and other male hormones seem to be related to aggressive behavior in some species Testosterone and Male Aggression Testosterone and other male hormones seem to be related to aggressive behavior in some species In the fish species Oreochromis mossambicus, elevated levels have been found

More information

Humatrope*, Norditropin*, Genotropin, Nutropin, Nutropin AQ, Omnitrope, Saizen

Humatrope*, Norditropin*, Genotropin, Nutropin, Nutropin AQ, Omnitrope, Saizen Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.08.11 Subject: Growth Hormone Adult Page: 1 of 6 Last Review Date: September 15, 2016 Growth Hormone

More information

Generating Mouse Models of Pancreatic Cancer

Generating Mouse Models of Pancreatic Cancer Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives

More information

Control of energy metabolism on reproduction: a mechanism maintained during evolution

Control of energy metabolism on reproduction: a mechanism maintained during evolution Control of energy metabolism on reproduction: a mechanism maintained during evolution Sara Della Torre Lab. A. Maggi Center of Excellence in Neurodegenerative Diseases (CEND) Department of Pharmacological

More information

General Principles of Endocrine Physiology

General Principles of Endocrine Physiology General Principles of Endocrine Physiology By Dr. Isabel S.S. Hwang Department of Physiology Faculty of Medicine University of Hong Kong The major human endocrine glands Endocrine glands and hormones

More information

Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes

Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference

More information

Hypothalamus & Pituitary Gland

Hypothalamus & Pituitary Gland Hypothalamus & Pituitary Gland Hypothalamus and Pituitary Gland The hypothalamus and pituitary gland form a unit that exerts control over the function of several endocrine glands (thyroid, adrenals, and

More information

Collin College. BIOL Anatomy & Physiology WEEK 3. The Endocrine System. Adrenal Glands : medulla

Collin College. BIOL Anatomy & Physiology WEEK 3. The Endocrine System. Adrenal Glands : medulla Collin College BIOL. 2402 Anatomy & Physiology WEEK 3 The Endocrine System 1 Adrenal Glands : medulla Contains Chromaffin cells which are modified postganglionic sympathetic neurons They are activated

More information

Module J ENDOCRINE SYSTEM. Learning Outcome

Module J ENDOCRINE SYSTEM. Learning Outcome Module J ENDOCRINE SYSTEM Topic from HAPS Guidelines General functions of the endocrine system Chemical classification of hormones & mechanism of hormone actions at receptors. Control of hormone secretion

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

4/23/2018. Endocrine System: Overview. Endocrine System: Overview

4/23/2018. Endocrine System: Overview. Endocrine System: Overview Endocrine System: Overview With nervous system, coordinates and integrates activity of body cells Influences metabolic activities via hormones transported in blood Response slower but longer lasting than

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

MPB333:Molecular Endocrinology of Obesity and Diabetes

MPB333:Molecular Endocrinology of Obesity and Diabetes MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Endocrine System. Chapter 20. Endocrine Glands and Hormones. The Endocrine System. Endocrine glands

Endocrine System. Chapter 20. Endocrine Glands and Hormones. The Endocrine System. Endocrine glands Chapter 20 Endocrine System Endocrine Glands and Hormones The endocrine system consists of glands and tissues that secrete hormones Hormones are chemicals that affect other glands or tissues, many times

More information

Chemical Regulation. Chapter 26. Testosterone and Male Aggression: Is There a Link? THE NATURE OF CHEMICAL REGULATION

Chemical Regulation. Chapter 26. Testosterone and Male Aggression: Is There a Link? THE NATURE OF CHEMICAL REGULATION Chapter 6 Chemical Regulation PowerPoint Lectures for Biology: Concepts and Connections, Fifth Edition Campbell, Reece, Taylor, and Simon Testosterone and Male Aggression: Is There a Link? Among male animals,

More information

BIOLOGY - CLUTCH CH.45 - ENDOCRINE SYSTEM.

BIOLOGY - CLUTCH CH.45 - ENDOCRINE SYSTEM. !! www.clutchprep.com Chemical signals allow cells to communicate with each other Pheromones chemical signals released to the environment to communicate with other organisms Autocrine signaling self-signaling,

More information

The Endocrine System

The Endocrine System Collin County Community College BIOL. 2402 Anatomy & Physiology WEEK 3 The Endocrine System 1 Adrenal Glands : medulla Contains Chromaffin cells which are modified postganglionic sympathetic neurons They

More information

Chapter 16: Endocrine System 1

Chapter 16: Endocrine System 1 Ch 16 Endocrine System Bi 233 Endocrine system Endocrine System: Overview Body s second great controlling system Influences metabolic activities of cells by means of hormones Slow signaling Endocrine glands

More information

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 RESEARCH ARTICLE The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 Mikael Bjursell 1 *, Xiufeng Xu 1, Therése Admyre 1,

More information

/30/17 Ch 8: Muscular System 1. Table of Contents # Date Title Page # 03/13/17 Ch 10: Somatic and Special Senses 53

/30/17 Ch 8: Muscular System 1. Table of Contents # Date Title Page # 03/13/17 Ch 10: Somatic and Special Senses 53 Table of Contents # Date Title Page # 1. 01/30/17 Ch 8: Muscular System 1 2. 3. 4. 5. 6. 7. 02/14/17 Ch 9: Nervous System 12 03/13/17 Ch 10: Somatic and Special Senses 53 03/27/17 Ch 11: Endocrine System

More information

Hormones. Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6

Hormones. Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6 Hormones Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6 Tel. 030-8385-6920 (Sekret.) 030-8385-6922 (direkt) e-mail: vhaucke@chemie.fu-berlin.de http://userpage.chemie.fu-berlin.de/biochemie/aghaucke/teaching.html

More information