Control. csarnt -/- Cre, f/f

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Control. csarnt -/- Cre, f/f"

Transcription

1 ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen chow Supplemental Figure. Generation of knockout mice. (A) reeding of f/f (denoted as f/f) mice with αmh-mm (denoted as re) mice to generate MM/ f/f (denoted as re, f/f) mice. () Protocol for oral administration of tamoxifen in different experimental groups. ardiac function was assessed at and 4 weeks after the completion of tamoxifen treatment. Arrows refer to the time when echocardiography was performed. () Mean body weight and food intake in controls, αmh- MM (represented as re) and f/f (represented as f/f) and αmh-mm/ f/f (represented as cre, f/f) mice treated with normal and tamoxifen chow (n=7- independent experiments). Data are presented as mean ± SEM. P <. versus normal chow.

2 mrna levels.4 -/- cs -/ mrna levels (relative expression) 4 -/- cs -/- Tamoxifen chow Normal chow Adipose rain Kidney Liver Lung Spleen GAPDH Supplemental Figure. expression in the heart and other organs of control and cs -/- mice. (A) mrna levels (as determined by RT-PR) of cardiac samples from control and cs -/- mice after tamoxifen administration at different time points (n=6 independent experiments). () mrna levels in different organs of control and cs -/- mice (n=6 independent experiments). () Western blot analysis of in different organs of control and cs -/- mice 4 weeks after tamoxifen treatment. Data are presented as mean ± SEM. P <..

3 Normal chow Tamoxifen chow αmh-mm, f/f αmh-mm f/f M-mode %EF f/f %FS re re, f/f re re, f/f f/f D LVID-d (mm) 4 Tamoxifen Normal chow E IVS-d Tamoxifen Normal chow f/f Tamoxifen re re, f/f re re, f/f f/f Normal chow Tamoxifen Normal chow Supplemental Figure. ardiac function in three sets of control animals by echocardiographic assessment. (A) representative M-mode images from indicated mice at weeks. EF (), FS (), LVID-d (D), and interventricular septal thickness at enddiastole (IVS-d) (E) (n=- independent experiments). Data are presented as mean ± SEM.

4 Heart weight/tibia length (mg/mm) Lung weight/tibia length (mg/mm) cs -/- cs -/- cs -/- Tibia length (mm) Supplemental Figure 4. Morphologic changes of control ( f/f littermates) and cs -/- mice 4 weeks after tamoxifen treatment. (A) Ratio of heart weight to tibia length (n= independent experiments). () Ratio of lung weight to tibia length (n= independent experiments). () Tibia length (n= independent experiments). Data are presented as mean ± SEM. P <..

5 NP mrna NP mrna A cs -/- -/- -/- cs -/- Supplemental Figure. mrna levels of (A) atrial natriuretic peptide (ANP) and () brain natriuretic peptide (NP) in the hearts of control and cs -/- mice at 4 weeks after tamoxifen administration (n=6 independent experiments). Data are presented as mean ± SEM. P <..

6 4 TAG (mg/dl) control cs-/- expression Tubulin TAG content (nmol/µg protein) Supplemental Figure 6. Serum triacylglycerol (TAG) level with knockdown. (A) Serum TAG levels in cs -/- hearts (n=7 independent experiments). () Western blot analysis of expression in NRM treated with and control for 48 hours ( n= independent experiments). () TAG levels in NRM treated with control or for 48 hours (n=6 independent experiments). Data are presented as mean ± SEM. P <..

7 A Glucose oxidation (nmol/g dry wt/min) Glucose uptake (cpm/µg protein) cs -/- mrna levels D EAR mph/min/mg protein.4 HKII cs-/- Glut Glut4 Supplemental Figure 7. Assessment of myocardial glucose metabolism in vivo and in vitro. (A) Glucose oxidation measured in working hearts (n=6 independent experiments). () mrna levels of HKII, Glut and Glut4 determined by qrt-pr on cardiac muscle samples of control and cs -/- mice (n=-6 mice per genotype). () Glucose uptake as measured by 4 - labeled glucose in NRM after treatment with control and (n=6 independent experiments). (D) Extracellular acidification rate (EAR) measured with the XF4 Extracellular Flux Analyzer in NRM transfected with control or (n= 6 independent experiments). Data are shown as mean ± SEM. P <. vs control.

8 A PPARα PPAR-α mrna levels... Relative intensity... Tubulin Supplemental Figure 8. Expression of PPARα in NRM treated with control and for 48 hours. (A) PPARα mrna levels were determined by qrt-pr and 8S ribosomal was used as a internal control (n=6 independent experiments). () PPARα protein levels analyzed by Western blot (n=6 independent experiments). Data are presented as mean ± SEM. P <..

9 GAPDH.4 IgG Fold enrichment Fold enrichment. IgG.. 8S β-actin WD ELMO UGP Supplemental Figure 9. Effective knockdown of in HEK9 cells and Positive and negative controls for hip studies. (A) Western blot of HEK9 cells treated with control or and blotted with antibody. () Negative controls for the hip studies. The amplified regions do not contain any predicted HRE sites, and therefore is not regulated by (n=). () Positive controls for the hip studies (n=). These genes have been shown to be regulated by as described in the Methods section. WD, obalamin Synthetase W Domain-ontaining Protein ; ELMO, Engulfment And ell Motility ; UGP, UDP-Glucose Pyrophosphorylase. Data are represented as fold enrichment over IgG samples and are shown as mean ± SEM. P <. vs control. N= independent experiments for and.

10 mrna HIFα mrna : : HIFα HIFα mrna D AHR mrna : HIFα : AHR Supplemental Figure. Effective reduction in the mrna levels of (A) and its partners, HIFα (), HIFα (), and AHR (D) using approach in NRM (n=6 independent experiments). Data are shown as mean ± SEM. P <. vs control.

11 PPARα mrna levels (Fold hnge) N.S. N.S. DMSO TSA Relative Expression.... ITPR DMSO TSA JAG Relative Expression... DMSO TSA ITPR JAG Supplemental Figure. Regulation of PPARα promoter by is not mediated by HDAS. (A) PPARα mrna levels in NRM treated with HDA inhibitor, trichostatin A (TSA) and in the presence and absence of. Positive control for TSA treatment in NRMs treated with control- () or - (). The expression of these genes is shown to be increased with HDA inhibition (irc Res. ;97:-8). ITPR=inositol,4,-trisphosphate receptor, type ; JAG=jagged. P <. vs control. N=6 independent experiments for all of the panels.

12 HDA HDA Tubulin Fold Enrichment over IgG control- - HDA HDA4 Tubulin acetylated-h acetylated H4 D Fold Enrichment over IgG acetylated-h control- - acetylated H4 Protein Expression (Fold hange) E.4. Fold Enrichment over IgG control- control- - acetylated-h - HDA HDA HDA HDA 4 acetylated H4 Supplemental Figure. HDA levels and histone acetylation are not altered by. (A) HDA, HDA, HDA, and HDA4 protein levels in NRM treated with control or. A Summary bar graph is shown in Panel. hip studies assessing the Levels of acetylated histone H and H4 on the PPARα promoter (), and on the promoter of two known target genes, OW domain containing protein (WD, D), and UDP-glucose pyrophosphorylase- (UGP, E) in HepG cells treated with control or. Data are presented as fold enrichment over IgG. P <. vs control. N= independent experiments for panel -E.

13 . Relative expression.. control db/db Supplemental Figure. PPARα mrna levels in the hearts of control and db/db mice. Data are presented as mean ± SEM. P <.. n=6 independent experiments per group.

14 cs -/- UP UP Tubulin Protein expression control cs+/- -/- UP UP Supplemental Figure 4. UP and UP protein levels in the heart of cs -/- mice. A summary bar graph of the results is provided below the Western blot gels. Data are presented as mean ± SEM. P <. versus normal chow.

15 x re, f/f PPARα -/- re, f/+, PPARα +/- x re, f/f re, f/f, PPARα +/- x re, f/f, PPARα +/- re, f/f, PPARα -/- cs -/- PPARα -/- PPARα -/- cs -/- 44 bp: re 4 bp: WT PPARα bp: f/f bp: WT DAPI 6 bp: PPARα -/- 4 bp: WT Overlay Supplemental Figure. reeding scheme for generation of cs -/- /PPARα -/- double knockout mice. (A) Interbreeding plan of PPARα -/- and re, f/f Knockout mice. () Double knockout mice were selected by genotyping as indicated. () Tissue sections were stained for PPARα (green), (red), and DAPI (nuclei in blue) in hearts from control, c -/- and cs -/- /PPARα -/- double knockout mice. The experiment was repeated three times.

16 ANP mrna cs -/- cs -/- NP mrna PPARα -/- cs -/- cs -/- PPARα -/- Supplemental Figure 6. mrna levels of (A) atrial natriuretic peptide (ANP) and () brain natriuretic peptide (NP) in the hearts of control, cs -/- and cs -/- /PPARα -/- double knockout mice 4 weeks after tamoxifen (n=-7 independent experiments). Data are presented as means ± SEM. P <. vs control.

17 Supplemental Table parameter week (Tomaxifen) Week (Tomxifen) Week ( N how) group cs -/- cs -/- PPARα -/- cs -/- cs -/- PPARα -/- cs -/- cs -/- PPARα -/- n IVS-d, mm.7 ±..69 ±.6.7 ±..79 ±.7.6 ±..67 ±.4.77 ±.6.84 ±..87 ±. LVPW-d,.6 ±..9 ±..64 ±..8 ±.. ±.4.6 ±..6 ±..67 ±..64 ±.4 mm LVID-d, mm.86 ±..78 ± ± ±. 4.8 ±.8 4. ±.8.8 ±. 4.6 ±.4.99 ±.6 %FS 6.9 ±..9 9 ± ±. ± ±.94. ±.7. ±.4. ± ±.7.. %EF.6 ± ±.87.9 ± ± ± ±.6 6. ±. 4. ±.6.4 ±.6 O, ml/min.7 ±.8 9. ± ± ± ±.4.76 ±.48. ±.. ±. 6.7 ± 6. HR, min 44 ± ± ± ± ± ±. 489 ±. 4 ±. 47 ±. Echocardiographic assessment of control, cs -/- and cs -/- PPARα -/- double knockout mice performed, and weeks after tamoxifen treatment and followed with one week normal chow. End-diastolic interventricular septum thickness (IVS-d); End-diastolic posterior wall thickness (LVPW-d); left ventricular diastolic internal diameter (LVID-d); fractional shorting (%FS); Ejection fraction (%EF); cardiac output (O) and heart rate (HR) were assessed. Animal number used in each group was indicated. Data are presented as mean ± SEM. P <. vs control.

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP Glucose vs.

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplemental Figure I

Supplemental Figure I Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Pyruvate Alanine 0.15 *** ** ***

Pyruvate Alanine 0.15 *** ** *** SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure

More information

Supplementary Material

Supplementary Material Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

End stage renal disease (ESRD) is the irreversible deterioration of renal function

End stage renal disease (ESRD) is the irreversible deterioration of renal function 28 Journal of the association of physicians of india JANUARY 2014 VOL. 62 Original Article Echocardiographic Assessment of Cardiac Dysfunction in Patients of End Stage Renal Disease on Haemodialysis Mukesh

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Gilles HANTON, BVSc, DVM, DABT, ERT GH Toxconsulting Brussels, Belgium

Gilles HANTON, BVSc, DVM, DABT, ERT GH Toxconsulting Brussels, Belgium Gilles HANTON, BVSc, DVM, DABT, ERT GH Toxconsulting Brussels, Belgium What is echocardiography (EC) Ultrasounds (US) are emitted by a transducer Reflection of US on tissues depends on their physical properties

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

* This work was supported, in whole or in part, by National Institutes of Health Grants HL076684, HL62984 (to N. L. W.), and ES (to S. H.

* This work was supported, in whole or in part, by National Institutes of Health Grants HL076684, HL62984 (to N. L. W.), and ES (to S. H. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 31, pp. 27836 27847, August 5, 2011 Printed in the U.S.A. Histone Deacetylase 9 Is a Negative Regulator of Adipogenic Differentiation * S Received for

More information

Aortic Root Dilatation as a Marker of Subclinical Left Ventricular Diastolic Dysfunction in Patients with Cardiovascular Risk Factors

Aortic Root Dilatation as a Marker of Subclinical Left Ventricular Diastolic Dysfunction in Patients with Cardiovascular Risk Factors The Journal of International Medical Research 2011; 39: 64 70 Aortic Root Dilatation as a Marker of Subclinical Left Ventricular Diastolic Dysfunction in Patients with Cardiovascular Risk Factors H MASUGATA,

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Copyright 2011, 2007 by Mosby, Inc., an affiliate of Elsevier Inc. Normal Cardiac Anatomy

Copyright 2011, 2007 by Mosby, Inc., an affiliate of Elsevier Inc. Normal Cardiac Anatomy Mosby,, an affiliate of Elsevier Normal Cardiac Anatomy Impaired cardiac pumping Results in vasoconstriction & fluid retention Characterized by ventricular dysfunction, reduced exercise tolerance, diminished

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

Training adaptation of the heart according to the static-dynamic components of sports and seasonal changes in the athletes heart

Training adaptation of the heart according to the static-dynamic components of sports and seasonal changes in the athletes heart Training adaptation of the heart according to the static-dynamic components of sports and seasonal changes in the athletes heart Abstract of the PhD Thesis Eszter Csajági MD Doctoral School of Sport Sciences

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Krediet slide di 18

Krediet slide di 18 1 di 18 Assessment of fluid status in PD patients Raymond T. Krediet, Amsterdam, Netherlands Chairs:Walther H. Boer, Utrecht, The Netherlands F. Fevzi Ersoy, Antalya, Turkey Prof. Raymond T. Krediet DDivision

More information

Transcriptional and Epigenetic Mechanisms of Addiction

Transcriptional and Epigenetic Mechanisms of Addiction Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Jong-Won Ha*, Jeong-Ah Ahn, Jae-Yun Moon, Hye-Sun Suh, Seok-Min Kang, Se-Joong Rim, Yangsoo Jang, Namsik Chung, Won-Heum Shim, Seung-Yun Cho

Jong-Won Ha*, Jeong-Ah Ahn, Jae-Yun Moon, Hye-Sun Suh, Seok-Min Kang, Se-Joong Rim, Yangsoo Jang, Namsik Chung, Won-Heum Shim, Seung-Yun Cho Eur J Echocardiography (2006) 7, 16e21 CLINICAL/ORIGINAL PAPERS Triphasic mitral inflow velocity with mid-diastolic flow: The presence of mid-diastolic mitral annular velocity indicates advanced diastolic

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,

More information

SUPPLEMENTAL DATA. Lumen area ( m 2 )

SUPPLEMENTAL DATA. Lumen area ( m 2 ) Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Age-related changes in cardiovascular system. Dr. Rehab Gwada

Age-related changes in cardiovascular system. Dr. Rehab Gwada Age-related changes in cardiovascular system Dr. Rehab Gwada Objectives explain the main structural and functional changes in cardiovascular system associated with normal aging Introduction aging results

More information

Interventricular Septum Thickness Predicts Future Systolic Hypertension in Young Healthy Pilots

Interventricular Septum Thickness Predicts Future Systolic Hypertension in Young Healthy Pilots 15 Original Article Hypertens Res Vol.31 (2008) No.1 p.15-20 Interventricular Septum Thickness Predicts Future Systolic Hypertension in Young Healthy Pilots Chagai GROSSMAN 1), Alon GROSSMAN 2), Nira KOREN-MORAG

More information

Medical Management of Acutely Decompensated Heart Failure. William T. Abraham, MD Director, Division of Cardiovascular Medicine

Medical Management of Acutely Decompensated Heart Failure. William T. Abraham, MD Director, Division of Cardiovascular Medicine Medical Management of Acutely Decompensated Heart Failure William T. Abraham, MD Director, Division of Cardiovascular Medicine Orlando, Florida October 7-9, 2011 Goals of Acute Heart Failure Therapy Alleviate

More information

Succinate causes pathological cardiomyocyte hypertrophy through GPR91 activation

Succinate causes pathological cardiomyocyte hypertrophy through GPR91 activation Aguiar et al. Cell Communication and Signaling (2014) 12:78 DOI 10.1186/s12964-014-0078-2 RESEARCH Open Access Succinate causes pathological cardiomyocyte hypertrophy through GPR91 activation Carla J Aguiar

More information

L ecocardiografia nello Scompenso Cardiaco Acuto e cronico: vecchi dogmi e nuovi trends.

L ecocardiografia nello Scompenso Cardiaco Acuto e cronico: vecchi dogmi e nuovi trends. V SESSIONE SCOMPENSO CARDIACO 2015 Genova, 13-14 Novembre 2015 L ecocardiografia nello Scompenso Cardiaco Acuto e cronico: vecchi dogmi e nuovi trends. Gian Paolo Bezante, MD, FACC UOC Clinica di Malattie

More information

Introduction. Materials and Methods. Andrea C. Vollmar, DVM

Introduction. Materials and Methods. Andrea C. Vollmar, DVM Use of Echocardiography in the Diagnosis of Dilated Cardiomyopathy in Irish Wolfhounds The purpose of this study was to compare the echocardiographic features of Irish wolfhounds with clinically inapparent

More information

Vevo 2100 System Cardio Measurements. Dieter Fuchs, PhD FUJIFILM VisualSonics, Inc.

Vevo 2100 System Cardio Measurements. Dieter Fuchs, PhD FUJIFILM VisualSonics, Inc. Vevo 2100 System Cardio Measurements Dieter Fuchs, PhD FUJIFILM VisualSonics, Inc. dfuchs@visualsonics.com Instructions This document is a guideline on how to assess cardiac function in rodents imaged

More information

Supplementary Information

Supplementary Information Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph

More information

Atrial dyssynchrony syndrome: An overlooked cause of heart failure with normal ejection fraction

Atrial dyssynchrony syndrome: An overlooked cause of heart failure with normal ejection fraction Atrial dyssynchrony syndrome: An overlooked cause of heart failure with normal ejection fraction JC Eicher, G Laurent, O Barthez, A Mathé, G Bertaux, JE Wolf Heart Failure Treatment Unit, Rhythmology and

More information

Sudden Death (SD) and hypertrophic cardiomyopathy (HCM) Attempt of risk stratification

Sudden Death (SD) and hypertrophic cardiomyopathy (HCM) Attempt of risk stratification Sudden Death (SD) and hypertrophic cardiomyopathy (HCM) Attempt of risk stratification 84th Annual Scientific Meeting of the Aerospace Medical Association May 12-16, 2013 Sheraton Chicago Hotel & Towers,

More information

HFpEF: How to optimise management

HFpEF: How to optimise management HFpEF: How to optimise management Burkert Pieske M.D. Berlin, Germany Department of Internal Medicine and Cardiology, Campus Virchow Klinikum, Charité University Medicine Berlin, and Department of Internal

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

5 -GGTAAAGCAGGTCTAGGTGGCTGACAGTCT-3. Cre-transgene allele was detected. by PCR using the primers; 5 -ACATGTTCAGGGATCGCCAG-3 and

5 -GGTAAAGCAGGTCTAGGTGGCTGACAGTCT-3. Cre-transgene allele was detected. by PCR using the primers; 5 -ACATGTTCAGGGATCGCCAG-3 and Supplemental Information Methods PCR primers for mice genotyping The Gab1 flox allele can be distinguished from the wild type Gab1 allele by PCR on genomic DNAs extracted from tails, using the primer pair

More information

HDAC4 controls histone methylation in response to elevated cardiac load

HDAC4 controls histone methylation in response to elevated cardiac load Research article HDAC4 controls histone methylation in response to elevated cardiac load Mathias Hohl, 1 Michael Wagner, 1 Jan-Christian Reil, 1 Sarah-Anne Müller, 1 Marcus Tauchnitz, 1 Angela M. Zimmer,

More information

Activated mtorc1 promotes long-term cone survival in retinitis pigmentosa mice

Activated mtorc1 promotes long-term cone survival in retinitis pigmentosa mice The Journal of Clinical Investigation Activated mtorc1 promotes long-term cone survival in retinitis pigmentosa mice Aditya Venkatesh, 1 Shan Ma, 1,2 Yun Z. Le, 3 Michael N. Hall, 4 Markus A. Rüegg, 4

More information

Ref 1. Ref 2. Ref 3. Ref 4. See graph

Ref 1. Ref 2. Ref 3. Ref 4. See graph Ref 1 Ref 2 Ref 3 1. Ages 6-23 y/o 2. Significant LVM differences by gender 3. For males 95 th percentiles: a. LVM/BSA = 103 b. LVM/height = 100 4. For females 95 th percentiles: a. LVM/BSA = 84 b. LVM/height

More information

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

ABSTARCT...1 FREQUENTLY USED ABBREVIATIONS...2 INTRODUCTION...3. Overview...3. Systolic and diastolic heart failure...4

ABSTARCT...1 FREQUENTLY USED ABBREVIATIONS...2 INTRODUCTION...3. Overview...3. Systolic and diastolic heart failure...4 TABLE OF CONTENTS ABSTARCT...1 FREQUENTLY USED ABBREVIATIONS...2 INTRODUCTION...3 Overview...3 Systolic and diastolic heart failure...4 Prevalence and incidence of heart failure...4 Prognosis...5 Etiology

More information

The Cardiovascular System Part I: Heart Outline of class lecture After studying part I of this chapter you should be able to:

The Cardiovascular System Part I: Heart Outline of class lecture After studying part I of this chapter you should be able to: The Cardiovascular System Part I: Heart Outline of class lecture After studying part I of this chapter you should be able to: 1. Describe the functions of the heart 2. Describe the location of the heart,

More information

Fluid Resuscitation in Critically Ill Patients with Acute Kidney Injury (AKI)

Fluid Resuscitation in Critically Ill Patients with Acute Kidney Injury (AKI) Fluid Resuscitation in Critically Ill Patients with Acute Kidney Injury (AKI) Robert W. Schrier, MD University of Colorado School of Medicine Denver, Colorado USA Prevalence of acute renal failure in Intensive

More information

Cardiotoxicity of doxorubicin is mediated through mitochondrial iron accumulation

Cardiotoxicity of doxorubicin is mediated through mitochondrial iron accumulation Research article Cardiotoxicity of doxorubicin is mediated through mitochondrial iron accumulation Yoshihiko Ichikawa, 1 Mohsen Ghanefar, 1 Marina Bayeva, 1 Rongxue Wu, 1 Arineh Khechaduri, 1 Sathyamangla

More information

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

More information

MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice

MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice Research article MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice Thomas E. Callis, 1,2 Kumar Pandya, 3 Hee Young Seok, 1,2 Ru-Hang Tang, 1,2,4 Mariko Tatsuguchi, 1,2 Zhan-Peng

More information

QUIZ 1. Tuesday, March 2, 2004

QUIZ 1. Tuesday, March 2, 2004 Harvard-MIT Division of Health Sciences and Technology HST.542J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments

More information

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Research article c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Shenghao Jin, Huiwu Zhao, Yan Yi, Yuji Nakata, Anna Kalota, and Alan M.

More information

MASSACHUSETTS INSTITUTE OF TECHNOLOGY

MASSACHUSETTS INSTITUTE OF TECHNOLOGY Harvard-MIT Division of Health Sciences and Technology HST.542J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations Title VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body Authors Hideaki Yamamoto 1, Tappei Takada 1 *, Yoshihide Yamanashi 1, Masatsune Ogura 2, Yusuke Masuo

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information