ESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
|
|
|
- Phebe Walters
- 6 years ago
- Views:
Transcription
1 ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 ( ) BMI (kg/m²).62 ( ) fsting glucose (mmol/l) 5.22 ( ) post-chllenge glucose (12 min, mmol/l) 6.44 ( ) fsting insulin (pmol/l) 66 (5-1) post-chllenge insulin (12 min, pmol/l) 416 ( ) pncretic ft (MRI-ssessed, %) 7.47 (5.4-1.) insulin sensitivity index (ritrry units) 9.66 ( ) insulinogenic index (ritrry units) ( ) AUC C-peptid -/Insulin - (ritrry units) ( )
2 ESM Tle 2. Culture medi nd protein lysis uffer composition nd supplements (finl concentrtions) CMRL-166 D-Glucose L-glutmine HEPES 5 mmol/l 2 mmol/l 1 mmol/l FCS (Serv) 1 (v/v) % RPMI164 HEPES 1 mmol/l N-pyruvte 1 mmol/l L-glutmine 2 mmol/l FCS 1 (v/v) % MEM/Hm s mixture F12 FCS 2 (v/v) % Chicken Emryo Extrct (Ser Lortories) 1 (v/v) % L-glutmine 2 mmol/l Penicillin 1 IU/ml Fungizone.5 mg/ml Streptomycin.1 mg/ml DMEM/Hm s mixture F12 Pntothente 17 mmol/l Biotin 1 mmol/l L-glutmine 2 mmol/l Insulin.1 mmol/l Apotrnsferrin 2 mg/ml FCS 5 (v/v) % Penicillin 1 IU/ml Streptomycin.1 mg/ml Fungizone.5 mg/ml -isoutyl-1-methyl-xnthine.5 mmol/l Cortisol 1 µmol/l Troglitzone 1 µmol/l Indomethcin 5 µmol/l RIPA uffer Tris/HCl (ph 7.5) 25 mmol/l NCl mmol/l EDTA 2 mmol/l NF 1 mmol/l N VO 4 1 mmol/l Glycerol 1 (v/v) % Nonidet-P4 1 (v/v) % SDS.1 (v/v) % C24H9NO4.1 (v/v) % Protese Inhiitor Cocktil (Sigm-Aldrich, #P84) 1 (v/v) %
3 ESM Tle. Antiodies Antiody Dilution Method Supplier APC-Anti-CD1, (WM59, 5 µg/ml) FITC-Anti-CD14 (M5E2, 1 µg/ml) 1:1 FACS BioLegend, London, GB 1:1 FACS BioLegend, London, GB Anti-insulin 1:1 Immunohistologicl stining Anti-glucgon 1:6 Immunohistologicl stining Snt Cruz Biotechnology Dlls, Texs, USA Anti-somtosttin 1: Immunohistologicl stining Dko Glostrup, Denmrk Anti-diponectin 1:8 Immunohistologicl stining Cell Signling Technology; Dnvers, MA,USA Anti-CD68 1: Immunohistologicl stining Cell Signling Technology; Alex-Fluor488 got nti-rit IgG Anti-p65NFkppB 1:1 1:1 1:4 Immunostining Thermo Fisher Scientific (Invitrogen) Wlthm, MA, USA Western Blotting; Immunostining Cell Signling Technology P-Thr18/Tyr185-JNK 1:1 Western Blotting Cell Signling Technology Anti-P-Ser56-NFkB 1:1 Western Blotting Cell Signling Technology Anti-JNK 1:1 Western Blotting Cell Signling Technology Anti-GAPDH 1:1 Western Blotting Cell Signling Technology Anti-Tuulin 1:1 Western Blotting Cell Signling Technology ECL Rit IgG, HRPlinked whole A from donkey 1:2 Western Blotting GE Helthcre; Munich, Germny
4 ESM Tle 4. Humn nd mouse primers nd proes for PCR mplifiction Homo spiens Gene Forwrd primer sequence Reverse primer sequence Proe ADIPOQ 5-GGTGAGAAGGGTGAGAAAGGA- 5-TTTCACCGATGTCTCCCTTAG- 85 BCL2 5-AGTACCTGAACCGGCACCT- 5-GCCGTACAGTTCCACAAAGG- 75 GCG 5-TCTGTTCTACAGCACACTACCAGA- 5-AGCTGCCTTGTACCAGCATT- 5 CCL2 5-CTGCTCATAGCAGCCACCTT- 5-GCACTGAGATCTTCCTATTGGTG- 62 CXCL8 5-AGACAGCAGAGCACACAAGC- 5-AGGAAGGCTGCCAAGAGAG- 72 HGF 5-GCATGTCCTCCTGCATCTC- 5-TTCTTCTTTTCCTTTGTCCCTCT- 2 IL1B 5-CTGTCCTGCGTGTTGAAAGA- 5-TTGGGTAATTTTTGGGATCTACA- 78 IL6 5-AGCTATGAACTCCTTCTCCACAA- 5-GGTACTGGGGCAGGGAAG- 68 INS 5-AGGCTTCTTCTACACACCCAAG- 5-CACAATGCCACGCTTCTG- 27 IRS2 5-TGACTTCTTGTCCCACCACTT- 5-CATCCTGGTGATAAAGCCAGA- 49 PDX1 5-AAGCTCACGCGTGGAAAG- 5-GCCGTGAGATGTACTTGTTGAA- 78 RPS1 5-CCCCACTTGGTTGAAGTTGA- 5-ACACCATGTGAATCTCTCAGGA- 68 SLC2A2 5-TGGTTTTCACTGCTGTCTCTG- 5-CATTCCAATTAGAAAGAGAGAACGTC- 8 SST 5-ACCCCAGACTCCGTCAGTTT- 5-ACAGCAGCTCTGCCAAGAAG- 8 TNF 5-CAGCCTCTTCTCCTTCCTGAT- 5-GCCAGAGGGCTGATTAGAGA- 29 TGFβ1 5-GCAGCACGTGGAGCTGTA- 5-CAGCCGGTTGCTGAGGTA- 72 TGFβ 5-GCTGGAGGAGATGCATGG- 5-TTAGGGCAGACAGCCAGTTC- 69 VEGF-A 5-CTACCTCCACCATGCCAAGT- 5-CCATGAACTTCACCACTTCGT- 6 Mus musculus Gene Forwrd primer sequence Reverse primer sequence Proe Il1 5-AGTTGACGGACCCCAAAAG- 5-TTTGAAGCTGGATGCTCTCAT- 26 Il6 5-GATGGATGCTACCAAACTGGAT- 5-CCAGGTAGCTATGGTACTCCAGA- 6 Rps1 5-TGCTCCCACCTAATTGGAAA- 5-CTTGTGCACACAACAGCATTT- 11
5 Men pncretic densitiy (HU, CT-derived) Low ft content in histology High ft content in histology ESM Figure 1. Histologicl ft content is reflected y CTestimted ft content of the entire pncres. Pncretic density s n estimte of ft content ws ssessed from preopertive unenhnced computed tomogrphy studies. Here, lower HU (Hounsfield units) indicte higher ft content. Histologicl strtifiction of smples in low (n = 11) nd high ft content (n = ) ws done y resercher unwre of results from CT imging. Two-tiled unpired t-test showed significntly lower pncretic density (p =.26), indicting higher ft content, in ptients with histologiclly high ft content. Presented re individul density vlues, the dimond lot indictes group mens nd 95% CIs.
6 Ptient 1 Ptient 2 Ptient Ptient 4 Ptient 5 Ptient 6 Ptient 7 Ptient 8 Ptient 9 Ptient 7 Ptient 8 Ptient 9 ESM Figure 2. Adipocytes infiltrtion nd islets with high vriility in their percentge of glucgon-positive cells in humn pncretic resections. () Insulin nd () glucgon stining in sections of humn pncretic resections from () six nd () three different prticipnts, performed s indicted in the Methods. () Note the mssive infiltrtion of dipocytes throughout the pncretic prenchym. () For ech pncretic resection, pictures from islets locted within the sme tissue slice were recorded. Scle r: () 1 µm; () 1 µm.
7 Adipo ADIPOQ mrna ( Ct x 1) c hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) ESM Figure. Cultured humn pncretic dipocytes express diponectin. () Pre-dipocytes nd () dipocytes were isolted, differentited nd cultured s descried in the Methods. Lipid droplets detected y Oil Red O stining ccumulted in differentited dipocytes ut not in predipocytes. (c) Adipocytes were cultured for 24h in the presence of humn serum lumin (hsa), humn fetuin-a (hfet) nd plmitte (Plm) s indicted. Cellulr ADIPOQ (Adiponectin) mrna levels were quntified y RT/qPCR nd results re expressed s Ct reltive to RPS1. Dt re expressed s men ± SEM of three independent experiments.
8 Pre-dipo CCL2 mrna ( Ct) Pre-dipo CXCL8 mrna ( Ct) Pre-dipo IL6 mrna ( Ct) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) CLI (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) CLI (µmol/l) c hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) CLI (µmol/l) ESM Figure 4. Plmitte/fetuin-A-induced cytokine expression in humn pncretic predipocytes is medited y TLR4. Pncretic predipocytes were cultured for 24 h in the presence of hsa, hfet, plmitte nd TLR4 inhiitor CLI-95 s indicted nd descried in the Methods. (-c) Fold chnge of IL6, CXCL8 (IL-8) nd CCL2 (MCP- 1) expression (trget gene mrna level reltive to RPS1 mrna level). Results re presented s men ± SEM of three independent experiments. hsa (humn serum lumin); hfet (humn fetuin- A); Plm (plmitte); CLI (CLI-95; TLR4 inhiitor);,, significnt to respective condition without CLI-95.
9 Pre-dipo HGF mrna ( Ct x 1) Adipo HGF mrna ( Ct x 1) Pre-dipo VEGF mrna ( Ct x 1) Adipo VEGF mrna ( Ct x 1) Pre-dipo TGFB mrna ( Ct x 1) Adipo TGFB mrna ( Ct x 1) Pre-dipo TGFB1 mrna ( Ct x 1) Adipo TGFB1 mrna ( Ct x 1) e hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) f hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) c g hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) d h hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) ESM Fig. 5. Effects of fetuin-a, plmitte nd co-culture with humn islets on pncretic pre-dipocyte nd dipocyte mrna levels. Isolted humn (-d) predipocytes nd (e-h) dipocytes were cultured for 24 h in the presence of test sustnces only (lck rs) or in co-culture with islets (htched rs) s indicted nd descried in the Methods. Gene expression (trget gene mrna level reltive to RPS1 mrna level) is presented s men ± SEM of three to seven independent experiments. hsa (humn serum lumin); hfet (humn fetuin-a); Plm (plmitte).
10 islet VEGF mrna (ΔCt x 1) islet HGF mrna (ΔCt x 1) islet TGFB1 mrna (ΔCt x 1) islet TGFB mrna (ΔCt x 1) islet BCL2 mrna (ΔCt x 1) islet SLC2A2 mrna (ΔCt x 1) islet CCL2 mrna (ΔCt x 1) islet CXCL8 mrna (ΔCt x 1) islet TNF mrna (ΔCt x 1) islet IL-6 mrna (ΔCt x 1) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) f hsa (mg/ml) Plm (µmol/l) hfet (mg/ml) * hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) g hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) * c hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) h ** hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) * ** d i e hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) j hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) ESM Fig. 6. Effects of fetuin-a nd plmitte on gene expression in humn islets. Isolted humn islets were cultured for 24 h in the presence of test sustnces s indicted nd descried in the Methods. Expression (trget gene mrna level reltive RPS1 mrna level) results re presented s men ± SEM of six to ten independent experiments. hsa (humn serum lumin); hfet (humn fetuin-a); Plm (plmitte). Note high mrna levels of VEGF nd TGFB in humn islets. *significnt to hsa, significnt to Plm.
11 Islet IRS2 mrna ( Ct x 1) Islet IRS2 mrna ( Ct x 1) Islet PDX1 mrna ( Ct x 1) Islet PDX1 mrna ( Ct x 1) Islet SST mrna ( Ct x 1) Islet SST mrna ( Ct x 1) Islet GCG mrna ( Ct x 1) Islet GCG mrna ( Ct x 1) Islet INS mrna ( Ct x 1) Islet INS mrna ( Ct x 1) 4 f c d hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) g h i hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) e 8 j hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) hsa (mg/ml) hfet (mg/ml) Plm (µmol/l) ESM Figure 7. Fetuin-A does not induce dedifferentition of humn islets. Humn islets were cultured for 24 h in the sence (white rs) nd presence (htched rs) of (-e) pre-dipocytes (n=5-7) nd (f-j) dipocytes (n=) s descried in the Methods. Reltive islet mrna levels re expressed s men ± SEM. hsa (humn serum lumin); hfet (humn fetuin-a); Plm (plmitte).
Supplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
Supplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
TNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
Supplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
Effect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
Supplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
SUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
Supplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
Supplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
Adipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
Protein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
SUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
Supplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
SUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
SUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
SUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
Supplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
CheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
SUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
SUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
MERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
SUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
SUPPLEMENTARY INFORMATION
1 SUPPLEMENARY INFORMAION 13 supplementry figures, 2 supplementry tles, nd supplementry note he leukocyte integrin ntgonist Del-1 inhiits IL-17 medited inflmmtory one loss Mehmet A. Eskn 1,2, Rvi Jotwni
Chronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
Type II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
SUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
SUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Protein kinase Cδ regulates nuclear export of FOXO1 through phosphorylation of the chaperone ζ
Dietologi (215) 58:2819 2831 DOI 1.17/s125-15-44-z ARTICLE Protein kinse Cδ regultes nucler export of through phosphoryltion of the chperone Felici Gerst 1,2 & Griele Kiser 1,2 & Mdhur Pnse 1 & Tin Srtorius
Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
![TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]](/thumbs/89/99233308.jpg "TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]")
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
SUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
Primers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
Enhanced Chemopreventive Effect by Combining Quercetin and Green tea in Prostate Cancer
Enhnced Chemopreventive Effect y Comining Quercetin nd Green te in Prostte Cncer Piwen Wng, MD, PhD Assistnt Professor, Division of Cncer Reserch nd Trining Chrles R. Drew University of Medicine nd Science
Transduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
A. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
SUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
Supporting Information
Supporting Informtion Yun et l. 1.173/pns.1523236113 SI Mterils nd Methods Humn Sujects. All prticipnts in our study were recruited from the Center for Reproductive Medicine, Shndong Provincil Hospitl
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
![NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]](/thumbs/92/110177253.jpg "NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]")
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
Supplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
SUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
SUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
SUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
Electronic Supplementary Information for:
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 214 Electronic Supplementry Informtion for: Gold nnoprticles functionlized with cresyl violet nd porphyrin
% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
Supplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
SYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
Single-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model
Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel
For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Diabetes mellitus secondary to pancreatic diseases (type 3c): The effect of smoking on the exocrine endocrine interactions of the pancreas
764062DVR0010.1177/1479164118764062Dibetes & Vsculr Disese ReserchŚliwińsk-Mossoń et l. reserch-rticle2018 Originl Article Dibetes mellitus secondry to pncretic diseses (type 3c): The effect of smoking
SUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
SUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
Checks on inadvertently modified BAS-funseeking scale from BIS-BAS. Modified scale excluded 2 of the original 4 items: bisbas10, bisbas20.
PATH 20 24 Wve 3. Checks on indvertently modified BAS-funseeking scle from BIS-BAS Modified scle excluded 2 of the originl 4 items: bisbs0, bisbs20. Check correltions mong BAS-fun items in 20-24 yer olds
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Effect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Early deficits in insulin secretion, beta cell mass and islet blood perfusion precede onset of autoimmune type 1 diabetes in BioBreeding rats
Dietologi (218) 61:896 95 https://doi.org/1.17/s125-17-4512-z ARTICLE Erly deficits in insulin secretion, et cell mss nd islet lood perfusion precede onset of utoimmune type 1 dietes in BioBreeding rts
Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes. October 2015; SAGLB.DIA
Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes October 2015; SAGLB.DIA.15.10.0821 Acknowledgement The content of this slide deck summarizes the key points
SUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB: