Electronic supplementary material (ESM) MATERIALS AND METHODS. Study subjects.

Size: px
Start display at page:

Download "Electronic supplementary material (ESM) MATERIALS AND METHODS. Study subjects."

Transcription

1 Electronic supplementary material (ESM) MATERIALS AND METHODS Study subjects. Twelve obese patients with type 2 diabetes carefully matched to ten healthy, lean and ten obese, non-diabetic volunteers participated in the study (Table 1). Patients with type 2 diabetes were treated either by diet alone (n=1) or diet in combination with metformin (n=7), insulin (n=1), metformin and insulin (n=2), or rosiglitazone and sulfonylurea (n=1). Oral antidiabetics were withdrawn one week prior to the study together with antihypertensive and lipid lowering drugs. Long-acting insulin was withdrawn one day before and rapid acting insulin the night before the study. The patients with type 2 diabetes were GAD65 antibody negative and without signs of diabetic retinopathy, nephropathy, neuropathy or macrovascular complications. All women were postmenopausal. The lean and obese controls had normal glucose tolerance (by 120 min OGTT with 75 g glucose) and no family history of diabetes, and none were treated with drugs known to affect glucose metabolism. All participants were sedentary, and had normal results on screening blood tests of hepatic and renal function. Informed consent was obtained from all subjects before participation. The study was approved by the Local Ethics Committee and was performed in accordance with the Helsinki Declaration. Study design. The participants were instructed to refrain from strenuous physical activity for a period of 48-h before the experiment. After an overnight fast the lean and obese controls underwent a euglycaemic-hyperinsulinaemic clamp, whereas the patients with type 2 diabetes were clamped twice. The diabetic patients were randomized to start with either a euglycaemic or an isoglycaemic-hyperinsulinaemic clamp, which were separated by 4-6 weeks. They were instructed to eat the same meal on the evening before each study day. Three of twelve patients with type 2 diabetes could not participate in the second clamp, leaving paired data of nine patients. A 2-h basal tracer equilibration period was followed by infusion of insulin at a rate of 40 mu m -2 min -1 for 4 hours. A primed-constant 3-3 H-glucose infusion was used throughout the 6-h study, and 3-3 H-glucose was

2 added to the glucose infusates to maintain plasma specific activity constant at baseline levels during the 4-h clamp period as described [1-3]. In patients with type 2 diabetes, plasma glucose was allowed to decline to 5.5 mmol/l during the euglycaemic clamp before glucose infusion was initiated, whereas during the isoglycaemic clamp, glucose infusion was started simultaneously with insulin infusion in order to clamp plasma glucose at their prevailing levels of fasting hyperglycaemia. Total glucose disposal rates (GDR) was calculated using Steele s non-steady-state-equations adapted for labelled glucose infusates [4]. Distribution volume of glucose was taken as 200 ml/kg body weight and pool fraction as The studies were combined with indirect calorimetry using a TrueOne 2400 Metabolic Measurement System for continuous gas exchange measurements (ParvoMedics, Sandy, UT, USA) with the ventilated hood technique to determine the respiratory exchange ratio (RER) and rates of glucose and lipid oxidation during the 30-min basal and insulin-stimulated steady-state periods as described [5,6]. Protein oxidation rates were estimated from urinary urea nitrogen excretion and corrected for changes in pool size as described [7]. Rates of nonoxidative glucose metabolism (NOGM) were calculated as the difference between GDR and glucose oxidation. Fat mass and fat free mass (FFM) were determined by impedance (Tanita TBF-300 GS, Tanita Corporation, Illinois, USA). Plasma glucose and lactate and serum insulin, C-peptide, cholesterols, triglycerides and NEFA were measured as described previously [8]. Muscle biopsies, homogenate and lysate preparation. Muscle biopsies were obtained from the vastus lateralis muscle before and after the 4-h insulin infusion period using a modified Bergström needle with suction under local anaesthesia (lidocaine). Muscle samples were immediately blotted free of blood, fat and connective tissue and frozen in liquid nitrogen within s. Homogenates and lysates were prepared from 70 mg (w.w.) muscle that was freeze-dried, and dissected free of visible fat, blood and connective [9]. Total homogenate and lysate protein content was analysed by the bicinchoninic acid method (Pierce Chem. Comp. IL, USA). Antibodies The following primary antibodies were used for Western blotting in the present study: Anti-Akt2 (#2967), anti-akt2 (#3063), anti-pakt Ser473 (#9271), anti-pakt Thr308 (#9275), anti-pgsk-3 Ser21/Ser9 (#9331), and anti-pgsk-3 Ser21(#9316) (Cell Signaling Technology, Beverly, MA, USA). The insulin

3 receptor (IR) monoclonal CT3 antibody was raised against the COOH-terminal of the IRβ-subunit and was a gift from Dr. Ken Siddle (Cambridge University, Cambridge, UK). GS was detected as a single band at ~90 kda using a polyclonal GS antibody (kindly provided by Prof. Oluf Pedersen, Steno Diabetes Center, Denmark) [1,3,10]. For detection of GS site 3a+3b (Ser640 and Ser644) phosphorylation antibodies were raised against the peptide RYPRPA(Sx)VPP(Sx)PSLSR (residues of human GS), where Sx denote a phosphorylated or non-phosphorylated serine residue, as described [1]. The antibody toward site 2+2a (Ser7 and Ser10) was raised against the peptide PLSRSL(Sx)MS(Sx)LPGLED (residues 1-16 of rat GS) and the antibody toward site 1b (Ser710) was raised against the peptide CSGSKRNSpVDTATS ( residues of human GS as described [1,3]. The specificity of these antibodies has previously been investigated [1,3]. IRS-1 associated PI3-kinase activity IRS-1 associated PI3-kinase activity was measured on immunoprecipitates of IRS-1 from 300 µg of muscle lysate using an IRS-1 antibody raised against the COOHterminus of IRS-1 provided by Dr. K. Siddle (Cambridge University, UK). The kinase reaction ran for 15 min at 30 C with L-α-Phosphatidylinositol as substrate (Sigma-Aldrich, Broendby, Denmark) and [ - 33 P]- ATP as tracer (Perkin Elmer, Skovlunde, Denmark). After the reaction was terminated the organic phases were separated with methanol-chloroform and subjected to thin layer chromatography using TLC silica gel (Merck, Nottingham, UK). The TLC plates were analyzed for activity using a Storm 850 PhosphoImager (Molecular Dynamics). Isoform-specific Akt activity Akt2 activity was measured in immune-precipitates of Akt2 from 300 µg lysate protein using an anti-akt2 antibody (#AF23151, R&D Systems, Minneapolis, MN) and Akt1 activity was measured in 255 µg of the supernatant from the initial Akt2 immuno-precipitate. After an overnight IP at 4 C the IP was washed once in the IP-buffer (50 mm NaCl, 1% Triton X-100, 50 mm NaF, 5 mm Napyrophosphate, 20 mm Tris-base (ph 7.5), 500 μm PMSF, 2 mm DTT, 4 μg/ml Leupeptin, 50 μg/ml Soybean Trypsin inhibitor, 6 mm Benzamidine and 250 mm Sucrose), once in 480 mm Hepes (ph 7.0) and 240 mm NaCl, and twice in 240 mm Hepes (ph 7.0) and 120 mm NaCl. The kinase reaction ran for 30 min. at 30 C in a total of 30 µl containing 50 mm Tris-HCl (ph 7.4), 1 mm DTT, 5 mm MgCl 2, 90 µm substrate

4 peptid (#12-340, Millipore, Denmark), 200 µm ATP and 2.2 µci [ - 33 P]-ATP as tracer (Perkin Elmer, Skovlunde, Denmark). The reaction was stopped by addition of 10 µl 1% phosphoric acid and 20 µl was spotted onto P81 filter paper, which was washed and analyzed in a Storm 850 PhosphoImager (Molecular Dynamics, Struers Kebo lab, Denmark) and by using liquid scintillation (Tri-Carb 2000, Perkin Elmer, Denmark). Tyrosine phosphorylation of the insulin receptor The IR was immunoprecipitated from 300 µg lysate protein with 3 µg specific antibody (#sc-711, Santa Cruz Biotech., CA, USA) as described above for Akt immuneprecipitation. All of the immunoprecipitates were loaded onto a gel and blotted for tyrosine phosphorylation with the 4G10 antibody (#05-321, Millipore, Denmark). References 1. Højlund K, Staehr P, Hansen BF, Green KA, Hardie DG, Richter EA, Beck-Nielsen H, Wojtaszewski JF (2003) Increased phosphorylation of skeletal muscle glycogen synthase at NH2- terminal sites during physiological hyperinsulinemia in type 2 diabetes. Diabetes 52: Højlund K, Frystyk J, Levin K, Flyvbjerg A, Wojtaszewski JF, Beck-Nielsen H (2006) Reduced plasma adiponectin concentrations may contribute to impaired insulin activation of glycogen synthase in skeletal muscle of patients with type 2 diabetes. Diabetologia 49: Højlund K, Birk JB, Klein DK, Levin K, Rose AJ, Hansen BF, Nielsen JN, Beck-Nielsen H, Wojtaszewski JF (2009) Dysregulation of glycogen synthase COOH- and NH2-terminal phosphorylation by insulin in obesity and type 2 diabetes mellitus. J Clin Endocrinol Metab 94: Hother-Nielsen O, Henriksen JE, Holst JJ, Beck-Nielsen H (1996) Effects of insulin on glucose turnover rates in vivo: isotope dilution versus constant specific activity technique. Metabolism 45: Bassett DR Jr, Howley ET, Thompson DL, King GA, Strath SJ, McLaughlin JE, Parr BB (2001)Validity of inspiratory and expiratory methods of measuring gas exchange with a computerized system. J Appl Physiol 91:

5 6. Frayn KN (1983) Calculation of substrate oxidation rates in vivo from gaseous exchange. J Appl Physiol 55: Tappy L, Owen OE, Boden G (1988) Effect of hyperinsulinemia on urea pool size and substrate oxidation rates. Diabetes 37: Jørgensen GM, Vind B, Nybo M, Rasmussen LM, Højlund K (2009) Acute hyperinsulinemia decreases plasma osteoprotegerin with diminished effect in type 2 diabetes and obesity. Eur J Endocrinol 161: Birk JB, Wojtaszewski JF (2006) Predominant alpha2/beta2/gamma3 AMPK activation during exercise in human skeletal muscle. J Physiol 577: Glintborg D, Højlund K, Andersen NR, Hansen BF, Beck-Nielsen H, Wojtaszewski JF (2008) Impaired insulin activation and dephosphorylation of glycogen synthase in skeletal muscle of women with polycystic ovary syndrome is reversed by pioglitazone treatment. J Clin Endocrinol Metab 93:

^Ia^^^etO^Ogla Springer-Verlag 1994

^Ia^^^etO^Ogla Springer-Verlag 1994 Diabetologia (1994) 37: 217-221 ^Ia^^^etO^Ogla Springer-Verlag 1994 For debate Pathogenesis of Type 2 (non-insulin-dependent) diabetes mellitus: the role of skeletal muscle glucose uptake and hepatic glucose

More information

The rabbit femoral artery was prepared and each arterial ring was permeabilized

The rabbit femoral artery was prepared and each arterial ring was permeabilized Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized

More information

Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences

Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences Supplemental Data Dual stable-isotope experiment Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences across the forearm, adjusted for forearm blood flow (FBF) (1).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Enhanced insulin signaling in human skeletal muscle and adipose tissue following gastric bypass surgery

Enhanced insulin signaling in human skeletal muscle and adipose tissue following gastric bypass surgery Am J Physiol Regul Integr Comp Physiol 309: R510 R524, 2015. First published June 10, 2015; doi:10.1152/ajpregu.00228.2014. Enhanced insulin signaling in human skeletal muscle and adipose tissue following

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

Western Immunoblotting Preparation of Samples:

Western Immunoblotting Preparation of Samples: Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

AMPK Phosphorylation Assay Kit

AMPK Phosphorylation Assay Kit AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad

More information

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:

More information

Supplementary material: Materials and suppliers

Supplementary material: Materials and suppliers Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and

More information

The Journal of Physiology

The Journal of Physiology J Physiol 593.8 (215) pp 253 269 253 Human muscle fibre type-specific regulation of AMPK and downstream targets by exercise Dorte E. Kristensen 1,PeterH.Albers 1,2, Clara Prats 3,4, Otto Baba 5,JesperB.Birk

More information

Polycystic ovary syndrome (PCOS) is a common

Polycystic ovary syndrome (PCOS) is a common ORIGINAL ARTICLE Impaired Insulin-Stimulated Phosphorylation of Akt and AS160 in Skeletal Muscle of Women With Polycystic Ovary Syndrome Is Reversed by Pioglitazone Treatment Kurt Højlund, 1 Dorte Glintborg,

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Lipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein

Lipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

AMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil

AMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil AMPK Assay Require: Acetone Sigma (1L, $18.30) A4206 Aluminum foil Ammonium sulfate Fisher BP212R-1 AMP Sigma A1752 ATP Sigma A6144 (alt. use A7699) Beta-mercaptoethanol Sigma M6250 (alt. use M7154) Bio-Rad

More information

NEW METHODS FOR ASSESSING SUBSTRATE UTILIZATION IN HORSES DURING EXERCISE

NEW METHODS FOR ASSESSING SUBSTRATE UTILIZATION IN HORSES DURING EXERCISE R. J. Geor 73 NEW METHODS FOR ASSESSING SUBSTRATE UTILIZATION IN HORSES DURING EXERCISE RAYMOND J. GEOR The Ohio State University, Columbus, Ohio There are two major goals in designing diets and feeding

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Glycogen synthase kinase (GSK) 3 is expressed in

Glycogen synthase kinase (GSK) 3 is expressed in Regulation of Glycogen Synthase Kinase-3 in Human Skeletal Muscle Effects of Food Intake and Bicycle Exercise Jørgen F.P. Wojtazsewski, Pernille Nielsen, Bente Kiens, and Erik A. Richter Studies of skeletal

More information

A Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms. Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh

A Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms. Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh A Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh Abstract Phosphoinositide 3-kinases (PI 3-kinase) consist of a family

More information

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia

More information

Delays in insulin signaling towards glucose disposal in human skeletal muscle

Delays in insulin signaling towards glucose disposal in human skeletal muscle 645 Delays in insulin signaling towards glucose disposal in human skeletal muscle T Grimmsmann, K Levin 1, M M Meyer, H Beck-Nielsen 1 and H H Klein Medizinische Klinik 1, Medizinische Universität zu Lübeck,

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

ASSAY OF SPHINGOMYELINASE ACTIVITY

ASSAY OF SPHINGOMYELINASE ACTIVITY ASSAY OF SPHINGOMYELINASE ACTIVITY Protocol for Protein Extraction Stock Solution 1. Leupeptin/hydrochloride (FW 463.0,

More information

28 Regulation of Fasting and Post-

28 Regulation of Fasting and Post- 28 Regulation of Fasting and Post- Prandial Glucose Metabolism Keywords: Type 2 Diabetes, endogenous glucose production, splanchnic glucose uptake, gluconeo-genesis, glycogenolysis, glucose effectiveness.

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University 1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;

More information

Metformin improves atypical protein kinase C activation by insulin and phosphatidylinositol-3,4,5-(po 4 ) 3 in muscle of diabetic subjects

Metformin improves atypical protein kinase C activation by insulin and phosphatidylinositol-3,4,5-(po 4 ) 3 in muscle of diabetic subjects Diabetologia (2006) 49: 375 382 DOI 10.1007/s00125-005-0112-4 ARTICLE V. Luna. L. Casauban. M. P. Sajan. J. Gomez-Daspet. J. L. Powe. A. Miura. J. Rivas. M. L. Standaert. R. V. Farese Metformin improves

More information

Insulin resistance in skeletal muscle is a hallmark

Insulin resistance in skeletal muscle is a hallmark Insulin Signal Transduction in Skeletal Muscle From Glucose-Intolerant Relatives With Type 2 Diabetes Heidi Storgaard, 1 Xiao Mei Song, 2 Christine B. Jensen, 1 Sten Madsbad, 1 Marie Björnholm, 2 Allan

More information

Student Number: THE UNIVERSITY OF MANITOBA April 16, 2007, 9:00 AM -12:00 PM Page 1 (of 4) Biochemistry II Laboratory Section Final Examination

Student Number: THE UNIVERSITY OF MANITOBA April 16, 2007, 9:00 AM -12:00 PM Page 1 (of 4) Biochemistry II Laboratory Section Final Examination Name: Student Number: THE UNIVERSITY OF MANITOBA April 16, 2007, 9:00 AM -12:00 PM Page 1 (of 4) Biochemistry II Laboratory Section Final Examination MBIO / CHEM.2370 Examiner: Dr. A. Scoot 1. Answer ALL

More information

Supplementary Figure 1. Method development.

Supplementary Figure 1. Method development. Supplementary Figure 1 Method development. Titration experiments to determine standard antibody:lysate concentration. Lysates (~2 mg of total proteins) were prepared from cells expressing FLAG- tagged

More information

Improved Insulin Sensitivity After Exercise: Focus on Insulin Signaling

Improved Insulin Sensitivity After Exercise: Focus on Insulin Signaling nature publishing group Physical activity and cardiovascular risk Improved Insulin Sensitivity After Exercise: Focus on Insulin Signaling Christian Frøsig 1 and Erik A. Richter 1 After a single bout of

More information

AMPK. Tomáš Kučera.

AMPK. Tomáš Kučera. AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol

More information

Student Number: To form the polar phase when adsorption chromatography was used.

Student Number: To form the polar phase when adsorption chromatography was used. Name: Student Number: April 14, 2001, 1:30 AM - 4:30 PM Page 1 (of 4) Biochemistry II Lab Section Final Examination Examiner: Dr. A. Scoot 1. Answer ALL questions in the space provided.. 2. The last page

More information

Increased GLUT-4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise

Increased GLUT-4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise Increased GLUT-4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise POLLY A. HANSEN, LORRAINE A. NOLTE, MAY M. CHEN, AND JOHN O. HOLLOSZY Department of Medicine,

More information

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

supplementary information

supplementary information Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated

More information

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating

More information

Introduction REVIEW. A. Natali. E. Ferrannini

Introduction REVIEW. A. Natali. E. Ferrannini Diabetologia (26) 49: 434 441 DOI.7/s125-6-141-7 REVIEW A. Natali. E. Ferrannini Effects of metformin and thiazolidinediones on suppression of hepatic glucose production and stimulation of glucose uptake

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

Decreased Non-Insulin Dependent Glucose Clearance Contributes to the Rise in FPG in the Non-Diabetic Range.

Decreased Non-Insulin Dependent Glucose Clearance Contributes to the Rise in FPG in the Non-Diabetic Range. Diabetes Care Publish Ahead of Print, published online November 13, 2007 Decreased Non-Insulin Dependent Glucose Clearance Contributes to the Rise in FPG in the Non-Diabetic Range. Rucha Jani, M.D., Marjorie

More information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,

More information

Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants

Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific

More information

Improved Stability of the LANCE Ultra Signal in Kinase Assays

Improved Stability of the LANCE Ultra Signal in Kinase Assays Improved Stability of the LANCE Ultra Signal in Kinase Assays LANCE Ultra is a high throughput screening (HTS) technology platform optimized for homogeneous time-resolved fluorescence resonance energy

More information

Optimizing the Exercise Drug to Oppose Glucose Intolerance/T2D

Optimizing the Exercise Drug to Oppose Glucose Intolerance/T2D University of Massachusetts Medical School escholarship@umms UMass Center for Clinical and Translational Science Research Retreat 2014 UMass Center for Clinical and Translational Science Research Retreat

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

EXPERIMENT 13: Isolation and Characterization of Erythrocyte

EXPERIMENT 13: Isolation and Characterization of Erythrocyte EXPERIMENT 13: Isolation and Characterization of Erythrocyte Day 1: Isolation of Erythrocyte Steps 1 through 6 of the Switzer & Garrity protocol (pages 220-221) have been performed by the TA. We will be

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

AMPK activity and isoform protein expression are similar in muscle of obese subjects with and without type 2 diabetes

AMPK activity and isoform protein expression are similar in muscle of obese subjects with and without type 2 diabetes Am J Physiol Endocrinol Metab 286: E239 E244, 2004. First published October 7, 2003; 10.1152/ajpendo.00326.2003. AMPK activity and isoform protein expression are similar in muscle of obese subjects with

More information

The Journal of Physiology

The Journal of Physiology J Physiol 9. () pp 7 Acute and physiological insulin induce distinct phosphorylation signatures on TBCD and TBCD proteins in human skeletal muscle Jonas T. Treebak, Christian Pehmøller, Jonas M. Kristensen,

More information

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5

More information

On Line Data Supplement

On Line Data Supplement On Line Data Supplement Chemicals and Other Materials [γ- 32 P]ATP, L-[ 35 S]methionine, L-[ 3 H]leucine, m 7 GTP-Sepharose, glutathione- Sepharose 4B and ECL reagents were purchased from Amersham Pharmacia

More information

The development of a detection method discriminating for

The development of a detection method discriminating for 1 2 3 The development of a detection method discriminating for mannosylerythritol lipids and acylglycerols Simon Van Kerrebroeck 1, *, Hannes Petit, Joeri Beauprez 1, Inge N.A. Van Bogaert 1, Wim Soetaert

More information

SIGNAL TRANSDUCTION. Diabetes Volume 65, May Diabetes 2016;65: DOI: /db

SIGNAL TRANSDUCTION. Diabetes Volume 65, May Diabetes 2016;65: DOI: /db Diabetes Volume 65, May 2016 1219 Rasmus Kjøbsted, 1 Andreas J.T. Pedersen, 2 Janne R. Hingst, 1 Rugivan Sabaratnam, 2,3 Jesper B. Birk, 1 Jonas M. Kristensen, 2,3 Kurt Højlund, 2,3 and Jørgen F.P. Wojtaszewski

More information

SelectScreen Biochemical Kinase Profiling Service

SelectScreen Biochemical Kinase Profiling Service Page 1 of 11 ASSAY THEORY 2 ADAPTA ASSAY CONDITIONS 3 ADAPTA ASSAY CONTROLS 4 ADAPTA DATA ANALYSIS 5 KINASE-SPECIFIC ASSAY CONDITIONS 6 CAMK1 (CaMK1) 6 CDK7/cyclin H/MNAT1 6 CDK9/cyclin T1 6 CHUK (IKK

More information

A high-fructose diet induces changes in pp185 phosphorylation in muscle and liver of rats

A high-fructose diet induces changes in pp185 phosphorylation in muscle and liver of rats Fructose Brazilian diet Journal induces of Medical changes and in Biological rat pp185 Research () 33: 1421-1427 ISSN -879X Short Communication 1421 A high-fructose diet induces changes in pp185 phosphorylation

More information

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5) Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein

More information

BILAYER CHANNEL RECONSTITUTION

BILAYER CHANNEL RECONSTITUTION (1) 1% Agar Salt Bridge 1.0 g Agar 3.75g KCl in 100ml distilled water, store at 4 o C. BILAYER CHANNEL RECONSTITUTION (2) Cs solution: (Cesium Methanesulfonate) 1) 50 mm Cs + solution 0.209 MOPS, 10mM

More information

Effects of a Single Exercise Bout on Insulin Sensitivity in Black and White Individuals

Effects of a Single Exercise Bout on Insulin Sensitivity in Black and White Individuals University of Massachusetts Amherst From the SelectedWorks of Stuart R. Chipkin 2010 Effects of a Single Exercise Bout on Insulin Sensitivity in Black and White Individuals Rebecca E. Hasson, University

More information

Diabetes Publish Ahead of Print, published online April 16, 2008

Diabetes Publish Ahead of Print, published online April 16, 2008 Diabetes Publish Ahead of Print, published online April 16, 2008 Deuterated water and gluconeogenesis The Plasma C5 Glucose/ 2 H 2 O Ratio Does Not Provide an Accurate Assessment of Gluconeogenesis during

More information

MEK1 Assay Kit 1 Catalog # Lot # 16875

MEK1 Assay Kit 1 Catalog # Lot # 16875 MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium

More information

Item Catalog Number Manufacturer 1,4-Dithioerythritol (1 g) D9680 Sigma-Aldrich

Item Catalog Number Manufacturer 1,4-Dithioerythritol (1 g) D9680 Sigma-Aldrich SOP: Nuclei isolation from fresh mouse tissues and DNaseI treatment Date modified: 01/12/2011 Modified by: E. Giste/ T. Canfield (UW) The following protocol describes the isolation of nuclei and subsequent

More information

STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS

STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department

More information

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Data Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic

More information

Insulin/IGF-1 and TNF-α stimulate phosphorylation of IRS-1 at inhibitory Ser 307 via distinct pathways

Insulin/IGF-1 and TNF-α stimulate phosphorylation of IRS-1 at inhibitory Ser 307 via distinct pathways Insulin/IGF-1 and TNF-α stimulate phosphorylation of IRS-1 at inhibitory Ser 307 via distinct pathways Liangyou Rui, 1 Vincent Aguirre, 1 Jason K. Kim, 2 Gerald I. Shulman, 2 Anna Lee, 3 Anne Corbould,

More information

About the Kits...2 Description 2 Components 3 Storage 3. Factors That Influence Factor Xa Activity... 4

About the Kits...2 Description 2 Components 3 Storage 3. Factors That Influence Factor Xa Activity... 4 Novagen User Protocol TB205 Rev. C 0107 1 of 9 Factor Xa Kits Table of Contents About the Kits...2 Description 2 Components 3 Storage 3 Factors That Influence Factor Xa Activity... 4 Factor Xa Cleavage...5

More information

Lifestyle-related diseases like type 2 diabetes are. GLUT4 and Glycogen Synthase Are Key Players in Bed Rest Induced Insulin Resistance

Lifestyle-related diseases like type 2 diabetes are. GLUT4 and Glycogen Synthase Are Key Players in Bed Rest Induced Insulin Resistance ORIGINAL ARTICLE GLUT4 and Glycogen Synthase Are Key Players in Bed Rest Induced Insulin Resistance Rasmus S. Biensø, 1,2,3 Stine Ringholm, 1,2,3 Kristian Kiilerich, 1,2,3 Niels-Jacob Aachmann-Andersen,

More information

Measurement of PDH Endogenous Activity Relative to the Fully- States

Measurement of PDH Endogenous Activity Relative to the Fully- States Measurement of PDH Endogenous Activity Relative to the Fully- and Dephosphorylated Phosphorylated States Table of contents PDH Protocol #1 Measurement of PDH Endogenous Activity 1. Introduction 3 2. Regulation

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

High Protein Diets in Weight Reduction

High Protein Diets in Weight Reduction High Protein Diets in Weight Reduction Effects on fat mass, muscle mass and risk factors of the metabolic syndrome Donald K. Layman and Layne E. Norton Department of Food Science & Human Nutrition University

More information

Note: During 30 minute incubation; proceed thru appropriate sections below (e.g. sections II, III and V).

Note: During 30 minute incubation; proceed thru appropriate sections below (e.g. sections II, III and V). LEGEND MAX β Amyloid x 40 LEGEND MAX β Amyloid x 40 ELISA Kit Components and Protocol Kit Components Capture Antibody Coated Plate 1 stripwell plate 1 40 Standard (2) 20μg vial 5X Wash Buffer 125mL Standard

More information

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

Total Phosphatidic Acid Assay Kit

Total Phosphatidic Acid Assay Kit Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor

More information

Diabetologia 9 Springer-Verlag 1995

Diabetologia 9 Springer-Verlag 1995 Diabetologia (1995) 38:699-704 Diabetologia 9 Springer-Verlag 1995 Peripheral and hepatic insulin sensitivity in subjects with impaired glucose tolerance T. S. Berrish ~' 2, C. S. Hetherington 1' 3, K.

More information

Supplemental Data. Septin-Mediated Uniform Bracing. of Phospholipid Membranes. Supplemental Experimental Procedures. Preparation of giant liposomes

Supplemental Data. Septin-Mediated Uniform Bracing. of Phospholipid Membranes. Supplemental Experimental Procedures. Preparation of giant liposomes Supplemental Data Septin-Mediated Uniform Bracing of Phospholipid Membranes Yohko Tanaka-Takiguchi, Makato Kinoshita, and Kingo Takiguchi Supplemental Experimental Procedures Preparation of giant liposomes

More information

<Supplemental information>

<Supplemental information> The Structural Basis of Endosomal Anchoring of KIF16B Kinesin Nichole R. Blatner, Michael I. Wilson, Cai Lei, Wanjin Hong, Diana Murray, Roger L. Williams, and Wonhwa Cho Protein

More information

Supplementary Material for

Supplementary Material for Supplementary Material for Parathyroid Hormone Signaling through Low-density-lipoprotein-related Protein 6 Mei Wan, Chaozhe Yang, Jun Li, Xiangwei Wu, Hongling Yuan, Hairong Ma, Xi He, Shuyi Nie, Chenbei

More information

Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:

Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample

More information

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector

More information

The effect of metformin on blood pressure and metabolism in nondiabetic hypertensive patients

The effect of metformin on blood pressure and metabolism in nondiabetic hypertensive patients Journal of Internal Medicine 1997; 242: 407 412 The effect of metformin on blood pressure and metabolism in nondiabetic hypertensive patients O. SNORGAARD a, L. KØBER b & J. CARLSEN c From the a Department

More information

GLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration

GLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration GLP 1 agonists Winning the Losing Battle Dr Bernard SAMIA KCS Congress: Impact through collaboration CONTACT: Tel. +254 735 833 803 Email: kcardiacs@gmail.com Web: www.kenyacardiacs.org Disclosures I have

More information

Decreased Non Insulin-Dependent Glucose Clearance Contributes to the Rise in Fasting Plasma Glucose in the Nondiabetic Range

Decreased Non Insulin-Dependent Glucose Clearance Contributes to the Rise in Fasting Plasma Glucose in the Nondiabetic Range Pathophysiology/Complications O R I G I N A L A R T I C L E Decreased Non Insulin-Dependent Glucose Clearance Contributes to the Rise in Fasting Plasma Glucose in the Nondiabetic Range RUCHA JANI, MD MARJORIE

More information

Electronic Supplementary Material to the article entitled Altered pattern of the

Electronic Supplementary Material to the article entitled Altered pattern of the Electronic Supplementary Material to the article entitled Altered pattern of the incretin effect as assessed by modelling in individuals with glucose tolerance ranging from normal to diabetic Integrated

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

Elisabeth Huff Lonergan, PhD Steven M. Lonergan, PhD Mark J. Anderson, PhD

Elisabeth Huff Lonergan, PhD Steven M. Lonergan, PhD Mark J. Anderson, PhD Elisabeth Huff Lonergan, PhD Steven M. Lonergan, PhD Mark J. Anderson, PhD The complexity of tenderness. Differences in tenderness due to postmortem aging is difficult to predict and manage Structure is

More information