Electronic supplementary material (ESM) MATERIALS AND METHODS. Study subjects.
|
|
- Bartholomew Robertson
- 6 years ago
- Views:
Transcription
1 Electronic supplementary material (ESM) MATERIALS AND METHODS Study subjects. Twelve obese patients with type 2 diabetes carefully matched to ten healthy, lean and ten obese, non-diabetic volunteers participated in the study (Table 1). Patients with type 2 diabetes were treated either by diet alone (n=1) or diet in combination with metformin (n=7), insulin (n=1), metformin and insulin (n=2), or rosiglitazone and sulfonylurea (n=1). Oral antidiabetics were withdrawn one week prior to the study together with antihypertensive and lipid lowering drugs. Long-acting insulin was withdrawn one day before and rapid acting insulin the night before the study. The patients with type 2 diabetes were GAD65 antibody negative and without signs of diabetic retinopathy, nephropathy, neuropathy or macrovascular complications. All women were postmenopausal. The lean and obese controls had normal glucose tolerance (by 120 min OGTT with 75 g glucose) and no family history of diabetes, and none were treated with drugs known to affect glucose metabolism. All participants were sedentary, and had normal results on screening blood tests of hepatic and renal function. Informed consent was obtained from all subjects before participation. The study was approved by the Local Ethics Committee and was performed in accordance with the Helsinki Declaration. Study design. The participants were instructed to refrain from strenuous physical activity for a period of 48-h before the experiment. After an overnight fast the lean and obese controls underwent a euglycaemic-hyperinsulinaemic clamp, whereas the patients with type 2 diabetes were clamped twice. The diabetic patients were randomized to start with either a euglycaemic or an isoglycaemic-hyperinsulinaemic clamp, which were separated by 4-6 weeks. They were instructed to eat the same meal on the evening before each study day. Three of twelve patients with type 2 diabetes could not participate in the second clamp, leaving paired data of nine patients. A 2-h basal tracer equilibration period was followed by infusion of insulin at a rate of 40 mu m -2 min -1 for 4 hours. A primed-constant 3-3 H-glucose infusion was used throughout the 6-h study, and 3-3 H-glucose was
2 added to the glucose infusates to maintain plasma specific activity constant at baseline levels during the 4-h clamp period as described [1-3]. In patients with type 2 diabetes, plasma glucose was allowed to decline to 5.5 mmol/l during the euglycaemic clamp before glucose infusion was initiated, whereas during the isoglycaemic clamp, glucose infusion was started simultaneously with insulin infusion in order to clamp plasma glucose at their prevailing levels of fasting hyperglycaemia. Total glucose disposal rates (GDR) was calculated using Steele s non-steady-state-equations adapted for labelled glucose infusates [4]. Distribution volume of glucose was taken as 200 ml/kg body weight and pool fraction as The studies were combined with indirect calorimetry using a TrueOne 2400 Metabolic Measurement System for continuous gas exchange measurements (ParvoMedics, Sandy, UT, USA) with the ventilated hood technique to determine the respiratory exchange ratio (RER) and rates of glucose and lipid oxidation during the 30-min basal and insulin-stimulated steady-state periods as described [5,6]. Protein oxidation rates were estimated from urinary urea nitrogen excretion and corrected for changes in pool size as described [7]. Rates of nonoxidative glucose metabolism (NOGM) were calculated as the difference between GDR and glucose oxidation. Fat mass and fat free mass (FFM) were determined by impedance (Tanita TBF-300 GS, Tanita Corporation, Illinois, USA). Plasma glucose and lactate and serum insulin, C-peptide, cholesterols, triglycerides and NEFA were measured as described previously [8]. Muscle biopsies, homogenate and lysate preparation. Muscle biopsies were obtained from the vastus lateralis muscle before and after the 4-h insulin infusion period using a modified Bergström needle with suction under local anaesthesia (lidocaine). Muscle samples were immediately blotted free of blood, fat and connective tissue and frozen in liquid nitrogen within s. Homogenates and lysates were prepared from 70 mg (w.w.) muscle that was freeze-dried, and dissected free of visible fat, blood and connective [9]. Total homogenate and lysate protein content was analysed by the bicinchoninic acid method (Pierce Chem. Comp. IL, USA). Antibodies The following primary antibodies were used for Western blotting in the present study: Anti-Akt2 (#2967), anti-akt2 (#3063), anti-pakt Ser473 (#9271), anti-pakt Thr308 (#9275), anti-pgsk-3 Ser21/Ser9 (#9331), and anti-pgsk-3 Ser21(#9316) (Cell Signaling Technology, Beverly, MA, USA). The insulin
3 receptor (IR) monoclonal CT3 antibody was raised against the COOH-terminal of the IRβ-subunit and was a gift from Dr. Ken Siddle (Cambridge University, Cambridge, UK). GS was detected as a single band at ~90 kda using a polyclonal GS antibody (kindly provided by Prof. Oluf Pedersen, Steno Diabetes Center, Denmark) [1,3,10]. For detection of GS site 3a+3b (Ser640 and Ser644) phosphorylation antibodies were raised against the peptide RYPRPA(Sx)VPP(Sx)PSLSR (residues of human GS), where Sx denote a phosphorylated or non-phosphorylated serine residue, as described [1]. The antibody toward site 2+2a (Ser7 and Ser10) was raised against the peptide PLSRSL(Sx)MS(Sx)LPGLED (residues 1-16 of rat GS) and the antibody toward site 1b (Ser710) was raised against the peptide CSGSKRNSpVDTATS ( residues of human GS as described [1,3]. The specificity of these antibodies has previously been investigated [1,3]. IRS-1 associated PI3-kinase activity IRS-1 associated PI3-kinase activity was measured on immunoprecipitates of IRS-1 from 300 µg of muscle lysate using an IRS-1 antibody raised against the COOHterminus of IRS-1 provided by Dr. K. Siddle (Cambridge University, UK). The kinase reaction ran for 15 min at 30 C with L-α-Phosphatidylinositol as substrate (Sigma-Aldrich, Broendby, Denmark) and [ - 33 P]- ATP as tracer (Perkin Elmer, Skovlunde, Denmark). After the reaction was terminated the organic phases were separated with methanol-chloroform and subjected to thin layer chromatography using TLC silica gel (Merck, Nottingham, UK). The TLC plates were analyzed for activity using a Storm 850 PhosphoImager (Molecular Dynamics). Isoform-specific Akt activity Akt2 activity was measured in immune-precipitates of Akt2 from 300 µg lysate protein using an anti-akt2 antibody (#AF23151, R&D Systems, Minneapolis, MN) and Akt1 activity was measured in 255 µg of the supernatant from the initial Akt2 immuno-precipitate. After an overnight IP at 4 C the IP was washed once in the IP-buffer (50 mm NaCl, 1% Triton X-100, 50 mm NaF, 5 mm Napyrophosphate, 20 mm Tris-base (ph 7.5), 500 μm PMSF, 2 mm DTT, 4 μg/ml Leupeptin, 50 μg/ml Soybean Trypsin inhibitor, 6 mm Benzamidine and 250 mm Sucrose), once in 480 mm Hepes (ph 7.0) and 240 mm NaCl, and twice in 240 mm Hepes (ph 7.0) and 120 mm NaCl. The kinase reaction ran for 30 min. at 30 C in a total of 30 µl containing 50 mm Tris-HCl (ph 7.4), 1 mm DTT, 5 mm MgCl 2, 90 µm substrate
4 peptid (#12-340, Millipore, Denmark), 200 µm ATP and 2.2 µci [ - 33 P]-ATP as tracer (Perkin Elmer, Skovlunde, Denmark). The reaction was stopped by addition of 10 µl 1% phosphoric acid and 20 µl was spotted onto P81 filter paper, which was washed and analyzed in a Storm 850 PhosphoImager (Molecular Dynamics, Struers Kebo lab, Denmark) and by using liquid scintillation (Tri-Carb 2000, Perkin Elmer, Denmark). Tyrosine phosphorylation of the insulin receptor The IR was immunoprecipitated from 300 µg lysate protein with 3 µg specific antibody (#sc-711, Santa Cruz Biotech., CA, USA) as described above for Akt immuneprecipitation. All of the immunoprecipitates were loaded onto a gel and blotted for tyrosine phosphorylation with the 4G10 antibody (#05-321, Millipore, Denmark). References 1. Højlund K, Staehr P, Hansen BF, Green KA, Hardie DG, Richter EA, Beck-Nielsen H, Wojtaszewski JF (2003) Increased phosphorylation of skeletal muscle glycogen synthase at NH2- terminal sites during physiological hyperinsulinemia in type 2 diabetes. Diabetes 52: Højlund K, Frystyk J, Levin K, Flyvbjerg A, Wojtaszewski JF, Beck-Nielsen H (2006) Reduced plasma adiponectin concentrations may contribute to impaired insulin activation of glycogen synthase in skeletal muscle of patients with type 2 diabetes. Diabetologia 49: Højlund K, Birk JB, Klein DK, Levin K, Rose AJ, Hansen BF, Nielsen JN, Beck-Nielsen H, Wojtaszewski JF (2009) Dysregulation of glycogen synthase COOH- and NH2-terminal phosphorylation by insulin in obesity and type 2 diabetes mellitus. J Clin Endocrinol Metab 94: Hother-Nielsen O, Henriksen JE, Holst JJ, Beck-Nielsen H (1996) Effects of insulin on glucose turnover rates in vivo: isotope dilution versus constant specific activity technique. Metabolism 45: Bassett DR Jr, Howley ET, Thompson DL, King GA, Strath SJ, McLaughlin JE, Parr BB (2001)Validity of inspiratory and expiratory methods of measuring gas exchange with a computerized system. J Appl Physiol 91:
5 6. Frayn KN (1983) Calculation of substrate oxidation rates in vivo from gaseous exchange. J Appl Physiol 55: Tappy L, Owen OE, Boden G (1988) Effect of hyperinsulinemia on urea pool size and substrate oxidation rates. Diabetes 37: Jørgensen GM, Vind B, Nybo M, Rasmussen LM, Højlund K (2009) Acute hyperinsulinemia decreases plasma osteoprotegerin with diminished effect in type 2 diabetes and obesity. Eur J Endocrinol 161: Birk JB, Wojtaszewski JF (2006) Predominant alpha2/beta2/gamma3 AMPK activation during exercise in human skeletal muscle. J Physiol 577: Glintborg D, Højlund K, Andersen NR, Hansen BF, Beck-Nielsen H, Wojtaszewski JF (2008) Impaired insulin activation and dephosphorylation of glycogen synthase in skeletal muscle of women with polycystic ovary syndrome is reversed by pioglitazone treatment. J Clin Endocrinol Metab 93:
^Ia^^^etO^Ogla Springer-Verlag 1994
Diabetologia (1994) 37: 217-221 ^Ia^^^etO^Ogla Springer-Verlag 1994 For debate Pathogenesis of Type 2 (non-insulin-dependent) diabetes mellitus: the role of skeletal muscle glucose uptake and hepatic glucose
More informationThe rabbit femoral artery was prepared and each arterial ring was permeabilized
Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized
More informationSkeletal muscle metabolism was studied by measuring arterio-venous concentration differences
Supplemental Data Dual stable-isotope experiment Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences across the forearm, adjusted for forearm blood flow (FBF) (1).
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationEnhanced insulin signaling in human skeletal muscle and adipose tissue following gastric bypass surgery
Am J Physiol Regul Integr Comp Physiol 309: R510 R524, 2015. First published June 10, 2015; doi:10.1152/ajpregu.00228.2014. Enhanced insulin signaling in human skeletal muscle and adipose tissue following
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationWestern Immunoblotting Preparation of Samples:
Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationAMPK Phosphorylation Assay Kit
AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad
More informationChromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
More informationSupplementary material: Materials and suppliers
Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
More informationThe Journal of Physiology
J Physiol 593.8 (215) pp 253 269 253 Human muscle fibre type-specific regulation of AMPK and downstream targets by exercise Dorte E. Kristensen 1,PeterH.Albers 1,2, Clara Prats 3,4, Otto Baba 5,JesperB.Birk
More informationPolycystic ovary syndrome (PCOS) is a common
ORIGINAL ARTICLE Impaired Insulin-Stimulated Phosphorylation of Akt and AS160 in Skeletal Muscle of Women With Polycystic Ovary Syndrome Is Reversed by Pioglitazone Treatment Kurt Højlund, 1 Dorte Glintborg,
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationLipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein
Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationAMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil
AMPK Assay Require: Acetone Sigma (1L, $18.30) A4206 Aluminum foil Ammonium sulfate Fisher BP212R-1 AMP Sigma A1752 ATP Sigma A6144 (alt. use A7699) Beta-mercaptoethanol Sigma M6250 (alt. use M7154) Bio-Rad
More informationNEW METHODS FOR ASSESSING SUBSTRATE UTILIZATION IN HORSES DURING EXERCISE
R. J. Geor 73 NEW METHODS FOR ASSESSING SUBSTRATE UTILIZATION IN HORSES DURING EXERCISE RAYMOND J. GEOR The Ohio State University, Columbus, Ohio There are two major goals in designing diets and feeding
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationGlycogen synthase kinase (GSK) 3 is expressed in
Regulation of Glycogen Synthase Kinase-3 in Human Skeletal Muscle Effects of Food Intake and Bicycle Exercise Jørgen F.P. Wojtazsewski, Pernille Nielsen, Bente Kiens, and Erik A. Richter Studies of skeletal
More informationA Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms. Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh
A Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh Abstract Phosphoinositide 3-kinases (PI 3-kinase) consist of a family
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationDelays in insulin signaling towards glucose disposal in human skeletal muscle
645 Delays in insulin signaling towards glucose disposal in human skeletal muscle T Grimmsmann, K Levin 1, M M Meyer, H Beck-Nielsen 1 and H H Klein Medizinische Klinik 1, Medizinische Universität zu Lübeck,
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationASSAY OF SPHINGOMYELINASE ACTIVITY
ASSAY OF SPHINGOMYELINASE ACTIVITY Protocol for Protein Extraction Stock Solution 1. Leupeptin/hydrochloride (FW 463.0,
More information28 Regulation of Fasting and Post-
28 Regulation of Fasting and Post- Prandial Glucose Metabolism Keywords: Type 2 Diabetes, endogenous glucose production, splanchnic glucose uptake, gluconeo-genesis, glycogenolysis, glucose effectiveness.
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationMetformin improves atypical protein kinase C activation by insulin and phosphatidylinositol-3,4,5-(po 4 ) 3 in muscle of diabetic subjects
Diabetologia (2006) 49: 375 382 DOI 10.1007/s00125-005-0112-4 ARTICLE V. Luna. L. Casauban. M. P. Sajan. J. Gomez-Daspet. J. L. Powe. A. Miura. J. Rivas. M. L. Standaert. R. V. Farese Metformin improves
More informationInsulin resistance in skeletal muscle is a hallmark
Insulin Signal Transduction in Skeletal Muscle From Glucose-Intolerant Relatives With Type 2 Diabetes Heidi Storgaard, 1 Xiao Mei Song, 2 Christine B. Jensen, 1 Sten Madsbad, 1 Marie Björnholm, 2 Allan
More informationStudent Number: THE UNIVERSITY OF MANITOBA April 16, 2007, 9:00 AM -12:00 PM Page 1 (of 4) Biochemistry II Laboratory Section Final Examination
Name: Student Number: THE UNIVERSITY OF MANITOBA April 16, 2007, 9:00 AM -12:00 PM Page 1 (of 4) Biochemistry II Laboratory Section Final Examination MBIO / CHEM.2370 Examiner: Dr. A. Scoot 1. Answer ALL
More informationSupplementary Figure 1. Method development.
Supplementary Figure 1 Method development. Titration experiments to determine standard antibody:lysate concentration. Lysates (~2 mg of total proteins) were prepared from cells expressing FLAG- tagged
More informationImproved Insulin Sensitivity After Exercise: Focus on Insulin Signaling
nature publishing group Physical activity and cardiovascular risk Improved Insulin Sensitivity After Exercise: Focus on Insulin Signaling Christian Frøsig 1 and Erik A. Richter 1 After a single bout of
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationStudent Number: To form the polar phase when adsorption chromatography was used.
Name: Student Number: April 14, 2001, 1:30 AM - 4:30 PM Page 1 (of 4) Biochemistry II Lab Section Final Examination Examiner: Dr. A. Scoot 1. Answer ALL questions in the space provided.. 2. The last page
More informationIncreased GLUT-4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise
Increased GLUT-4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise POLLY A. HANSEN, LORRAINE A. NOLTE, MAY M. CHEN, AND JOHN O. HOLLOSZY Department of Medicine,
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationsupplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
More informationRole of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
More informationIntroduction REVIEW. A. Natali. E. Ferrannini
Diabetologia (26) 49: 434 441 DOI.7/s125-6-141-7 REVIEW A. Natali. E. Ferrannini Effects of metformin and thiazolidinediones on suppression of hepatic glucose production and stimulation of glucose uptake
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationDecreased Non-Insulin Dependent Glucose Clearance Contributes to the Rise in FPG in the Non-Diabetic Range.
Diabetes Care Publish Ahead of Print, published online November 13, 2007 Decreased Non-Insulin Dependent Glucose Clearance Contributes to the Rise in FPG in the Non-Diabetic Range. Rucha Jani, M.D., Marjorie
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSupplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
More informationImproved Stability of the LANCE Ultra Signal in Kinase Assays
Improved Stability of the LANCE Ultra Signal in Kinase Assays LANCE Ultra is a high throughput screening (HTS) technology platform optimized for homogeneous time-resolved fluorescence resonance energy
More informationOptimizing the Exercise Drug to Oppose Glucose Intolerance/T2D
University of Massachusetts Medical School escholarship@umms UMass Center for Clinical and Translational Science Research Retreat 2014 UMass Center for Clinical and Translational Science Research Retreat
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationEXPERIMENT 13: Isolation and Characterization of Erythrocyte
EXPERIMENT 13: Isolation and Characterization of Erythrocyte Day 1: Isolation of Erythrocyte Steps 1 through 6 of the Switzer & Garrity protocol (pages 220-221) have been performed by the TA. We will be
More informationSUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
More informationAMPK activity and isoform protein expression are similar in muscle of obese subjects with and without type 2 diabetes
Am J Physiol Endocrinol Metab 286: E239 E244, 2004. First published October 7, 2003; 10.1152/ajpendo.00326.2003. AMPK activity and isoform protein expression are similar in muscle of obese subjects with
More informationThe Journal of Physiology
J Physiol 9. () pp 7 Acute and physiological insulin induce distinct phosphorylation signatures on TBCD and TBCD proteins in human skeletal muscle Jonas T. Treebak, Christian Pehmøller, Jonas M. Kristensen,
More informationAGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine
AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5
More informationOn Line Data Supplement
On Line Data Supplement Chemicals and Other Materials [γ- 32 P]ATP, L-[ 35 S]methionine, L-[ 3 H]leucine, m 7 GTP-Sepharose, glutathione- Sepharose 4B and ECL reagents were purchased from Amersham Pharmacia
More informationThe development of a detection method discriminating for
1 2 3 The development of a detection method discriminating for mannosylerythritol lipids and acylglycerols Simon Van Kerrebroeck 1, *, Hannes Petit, Joeri Beauprez 1, Inge N.A. Van Bogaert 1, Wim Soetaert
More informationSIGNAL TRANSDUCTION. Diabetes Volume 65, May Diabetes 2016;65: DOI: /db
Diabetes Volume 65, May 2016 1219 Rasmus Kjøbsted, 1 Andreas J.T. Pedersen, 2 Janne R. Hingst, 1 Rugivan Sabaratnam, 2,3 Jesper B. Birk, 1 Jonas M. Kristensen, 2,3 Kurt Højlund, 2,3 and Jørgen F.P. Wojtaszewski
More informationSelectScreen Biochemical Kinase Profiling Service
Page 1 of 11 ASSAY THEORY 2 ADAPTA ASSAY CONDITIONS 3 ADAPTA ASSAY CONTROLS 4 ADAPTA DATA ANALYSIS 5 KINASE-SPECIFIC ASSAY CONDITIONS 6 CAMK1 (CaMK1) 6 CDK7/cyclin H/MNAT1 6 CDK9/cyclin T1 6 CHUK (IKK
More informationA high-fructose diet induces changes in pp185 phosphorylation in muscle and liver of rats
Fructose Brazilian diet Journal induces of Medical changes and in Biological rat pp185 Research () 33: 1421-1427 ISSN -879X Short Communication 1421 A high-fructose diet induces changes in pp185 phosphorylation
More informationMinute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)
Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein
More informationBILAYER CHANNEL RECONSTITUTION
(1) 1% Agar Salt Bridge 1.0 g Agar 3.75g KCl in 100ml distilled water, store at 4 o C. BILAYER CHANNEL RECONSTITUTION (2) Cs solution: (Cesium Methanesulfonate) 1) 50 mm Cs + solution 0.209 MOPS, 10mM
More informationEffects of a Single Exercise Bout on Insulin Sensitivity in Black and White Individuals
University of Massachusetts Amherst From the SelectedWorks of Stuart R. Chipkin 2010 Effects of a Single Exercise Bout on Insulin Sensitivity in Black and White Individuals Rebecca E. Hasson, University
More informationDiabetes Publish Ahead of Print, published online April 16, 2008
Diabetes Publish Ahead of Print, published online April 16, 2008 Deuterated water and gluconeogenesis The Plasma C5 Glucose/ 2 H 2 O Ratio Does Not Provide an Accurate Assessment of Gluconeogenesis during
More informationMEK1 Assay Kit 1 Catalog # Lot # 16875
MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium
More informationItem Catalog Number Manufacturer 1,4-Dithioerythritol (1 g) D9680 Sigma-Aldrich
SOP: Nuclei isolation from fresh mouse tissues and DNaseI treatment Date modified: 01/12/2011 Modified by: E. Giste/ T. Canfield (UW) The following protocol describes the isolation of nuclei and subsequent
More informationSTUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS
STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department
More informationSynthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Data Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic
More informationInsulin/IGF-1 and TNF-α stimulate phosphorylation of IRS-1 at inhibitory Ser 307 via distinct pathways
Insulin/IGF-1 and TNF-α stimulate phosphorylation of IRS-1 at inhibitory Ser 307 via distinct pathways Liangyou Rui, 1 Vincent Aguirre, 1 Jason K. Kim, 2 Gerald I. Shulman, 2 Anna Lee, 3 Anne Corbould,
More informationAbout the Kits...2 Description 2 Components 3 Storage 3. Factors That Influence Factor Xa Activity... 4
Novagen User Protocol TB205 Rev. C 0107 1 of 9 Factor Xa Kits Table of Contents About the Kits...2 Description 2 Components 3 Storage 3 Factors That Influence Factor Xa Activity... 4 Factor Xa Cleavage...5
More informationLifestyle-related diseases like type 2 diabetes are. GLUT4 and Glycogen Synthase Are Key Players in Bed Rest Induced Insulin Resistance
ORIGINAL ARTICLE GLUT4 and Glycogen Synthase Are Key Players in Bed Rest Induced Insulin Resistance Rasmus S. Biensø, 1,2,3 Stine Ringholm, 1,2,3 Kristian Kiilerich, 1,2,3 Niels-Jacob Aachmann-Andersen,
More informationMeasurement of PDH Endogenous Activity Relative to the Fully- States
Measurement of PDH Endogenous Activity Relative to the Fully- and Dephosphorylated Phosphorylated States Table of contents PDH Protocol #1 Measurement of PDH Endogenous Activity 1. Introduction 3 2. Regulation
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationHigh Protein Diets in Weight Reduction
High Protein Diets in Weight Reduction Effects on fat mass, muscle mass and risk factors of the metabolic syndrome Donald K. Layman and Layne E. Norton Department of Food Science & Human Nutrition University
More informationNote: During 30 minute incubation; proceed thru appropriate sections below (e.g. sections II, III and V).
LEGEND MAX β Amyloid x 40 LEGEND MAX β Amyloid x 40 ELISA Kit Components and Protocol Kit Components Capture Antibody Coated Plate 1 stripwell plate 1 40 Standard (2) 20μg vial 5X Wash Buffer 125mL Standard
More informationSupplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).
Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationTotal Phosphatidic Acid Assay Kit
Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor
More informationDiabetologia 9 Springer-Verlag 1995
Diabetologia (1995) 38:699-704 Diabetologia 9 Springer-Verlag 1995 Peripheral and hepatic insulin sensitivity in subjects with impaired glucose tolerance T. S. Berrish ~' 2, C. S. Hetherington 1' 3, K.
More informationSupplemental Data. Septin-Mediated Uniform Bracing. of Phospholipid Membranes. Supplemental Experimental Procedures. Preparation of giant liposomes
Supplemental Data Septin-Mediated Uniform Bracing of Phospholipid Membranes Yohko Tanaka-Takiguchi, Makato Kinoshita, and Kingo Takiguchi Supplemental Experimental Procedures Preparation of giant liposomes
More information<Supplemental information>
The Structural Basis of Endosomal Anchoring of KIF16B Kinesin Nichole R. Blatner, Michael I. Wilson, Cai Lei, Wanjin Hong, Diana Murray, Roger L. Williams, and Wonhwa Cho Protein
More informationSupplementary Material for
Supplementary Material for Parathyroid Hormone Signaling through Low-density-lipoprotein-related Protein 6 Mei Wan, Chaozhe Yang, Jun Li, Xiangwei Wu, Hongling Yuan, Hairong Ma, Xi He, Shuyi Nie, Chenbei
More informationWork-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:
Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample
More informationWeek 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD
Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector
More informationThe effect of metformin on blood pressure and metabolism in nondiabetic hypertensive patients
Journal of Internal Medicine 1997; 242: 407 412 The effect of metformin on blood pressure and metabolism in nondiabetic hypertensive patients O. SNORGAARD a, L. KØBER b & J. CARLSEN c From the a Department
More informationGLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration
GLP 1 agonists Winning the Losing Battle Dr Bernard SAMIA KCS Congress: Impact through collaboration CONTACT: Tel. +254 735 833 803 Email: kcardiacs@gmail.com Web: www.kenyacardiacs.org Disclosures I have
More informationDecreased Non Insulin-Dependent Glucose Clearance Contributes to the Rise in Fasting Plasma Glucose in the Nondiabetic Range
Pathophysiology/Complications O R I G I N A L A R T I C L E Decreased Non Insulin-Dependent Glucose Clearance Contributes to the Rise in Fasting Plasma Glucose in the Nondiabetic Range RUCHA JANI, MD MARJORIE
More informationElectronic Supplementary Material to the article entitled Altered pattern of the
Electronic Supplementary Material to the article entitled Altered pattern of the incretin effect as assessed by modelling in individuals with glucose tolerance ranging from normal to diabetic Integrated
More informationModifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
More informationElisabeth Huff Lonergan, PhD Steven M. Lonergan, PhD Mark J. Anderson, PhD
Elisabeth Huff Lonergan, PhD Steven M. Lonergan, PhD Mark J. Anderson, PhD The complexity of tenderness. Differences in tenderness due to postmortem aging is difficult to predict and manage Structure is
More information