The Journal of Physiology

Transcription

1 J Physiol (218) pp Restortion of metolic helth y decresed consumption of rnched-chin mino cids Nicole E. Cummings 1,2,3, Elizeth M. Willims 1,2,IldikoKsz 4, Elizeth N. Konon 1,2, Michel D. Schid 1,2,5, Brin A. Schmidt 1,2,ChetnPoudel 1,2,DwnS.Shermn 1,2, Deyng Yu 1,2,6, Sestin I. Arriol Apelo 1,2,7, Sr E. Cottrell 1,2,8, Griell Geiger 1,2, Mcy E. Brnes 1,2, Jclyn A. Wisinski 1,2,RchelJ.Fenske 1,2,5,KristinA.Mtkowskyj 2,9,1, Michelle E. Kimple 1,2,3,5,11, Croline M. Alexnder 4, Mtthew J. Merrins 1,2,12 nd Dudley W. Lmming 1,2,3,5,6,9 The Journl of Physiology 1 Deprtment of Medicine, University of Wisconsin-Mdison, Mdison, WI, USA 2 Willim S. Middleton Memoril Veterns Hospitl, Mdison, WI, USA 3 Endocrinology nd Reproductive Physiology Grdute Trining Progrm, University of Wisconsin-Mdison, Mdison, WI, USA 4 McArdle Lortory for Cncer Reserch, University of Wisconsin-Mdison, Mdison, WI, USA 5 Interdisciplinry Grdute Progrm in Nutritionl Sciences, University of Wisconsin-Mdison, Mdison, WI, USA 6 Moleculr nd Environmentl Toxicology Progrm, University of Wisconsin-Mdison, Mdison, WI, USA 7 Deprtment of Diry Science, University of Wisconsin-Mdison, Mdison, WI, USA 8 Rurl nd Urn Scholrs in Community Helth Progrm, University of Wisconsin-Mdison, Mdison, WI, USA 9 University of Wisconsin Crone Cncer Center, Mdison, WI, USA 1 Deprtment of Pthology nd Lortory Medicine, University of Wisconsin-Mdison, Mdison, WI, USA 11 Deprtment of Cell nd Regenertive Biology, University of Wisconsin-Mdison, Mdison, WI, USA 12 Deprtment of Biomoleculr Chemistry, University of Wisconsin-Mdison, Mdison, WI, USA Edited y: Kim Brrett & Bettin Mittendorfer Key points We recently found tht feeding helthy mice diet with reduced levels of rnched-chin mino cids (BCAAs), which re ssocited with insulin resistnce in oth humns nd rodents, modestly improves glucose tolernce nd slows ft mss gin. In the present study, we show tht reduced BCAA diet promotes rpid ft mss loss without clorie restriction in oese mice. Selective reduction of dietry BCAAs lso restores glucose tolernce nd insulin sensitivity to oese mice, even s they continue to consume high-ft, high-sugr diet. A low BCAA diet trnsiently induces FGF21 (firolst growth fctor 21) nd increses energy expenditure. We suggest tht dietry protein qulity (i.e. the precise mcronutrient composition of dietry protein) my impct the effectiveness of weight loss diets. Astrct Oesity nd dietes re incresing prolems round the world, nd lthough even moderte weight loss cn improve metolic helth, reduced clorie diets re notoriously difficult to sustin. Brnched-chin mino cids (BCAAs; leucine, isoleucine nd vline) re elevted in the lood of oese, insulin-resistnt humns nd rodents. We recently demonstrted tht specificlly reducing dietry levels of BCAAs hs eneficil effects on the metolic helth of young, growing mice, improving glucose tolernce nd modestly slowing ft mss gin. In the present study, we exmine the hypothesis tht reducing dietry BCAAs will promote weight loss, reduce diposity, nd improve lood glucose control in diet-induced oese mice with pre-existing metolic syndrome. We find tht specificlly reducing dietry BCAAs rpidly reverses diet-induced oesity nd improves glucoregultory control in diet-induced oese mice. Most drmticlly, mice eting n otherwise unhelthy high-clorie, high-sugr Western diet with reduced levels of BCAAs lost C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society DOI: /JP27575

2 624 N. E. Cummings nd others J Physiol weight nd ft mss rpidly until regining norml weight. Importntly, this normliztion of weight ws medited not y cloric restriction or incresed ctivity, ut y incresed energy expenditure, nd ws ccompnied y trnsient induction of the energy lnce regulting hormone FGF21 (firolst growth fctor 21). Consumption of Western diet reduced in BCAAs ws lso ccompnied y drmtic improvement in glucose tolernce nd insulin resistnce. Our results link dietry BCAAs with the regultion of metolic helth nd energy lnce in oese nimls, nd suggest tht specificlly reducing dietry BCAAs my represent highly trnsltle option for the tretment of oesity nd insulin resistnce. (Received 4 August 217; ccepted fter revision 2 Novemer 217) Corresponding uthor D. W. Lmming: University of Wisconsin-Mdison, 25 Overlook Terrce, VAH C3127 Reserch 151, Mdison, WI 5375, USA. Emil: dlmming@medicine.wisc.edu Introduction Over the lst four decdes, the prevlence of oesity hs incresed drmticlly. In the USA, more thn two in three dults re now considered to e overweight or oese (Flegl et l. 212). A similr proportion of mles in the Europen Union re likewise fflicted (Jnd et l. 213). Oesity is ssocited with n incresed risk of mny diseses, most notly type 2 dietes, which is lso incresing round the world. Although weight loss is highly effective mens of improving metolic helth, reduced clorie diets re notoriously difficult to sustin. Altering the mcronutrient composition of the diet while keeping the totl numer of clories constnt is n intriguing lterntive tht my e more sustinle (Fontn & Prtridge, 215). Severl recent studies hve found tht high protein consumption is correlted with insulin resistnce, dietes, nd incresed mortlity in oth mice nd humns (Lgiou et l. 27; Sluijs et l. 21; Solon-Biet et l. 214). Conversely, low protein (LP) diets re ssocited with metolic helth nd incresed survivl (Levine et l. 214; Solon-Biet et l. 214; Simpson et l. 217), nd recent rndomized controlled tril found tht LP diet promotes lenness nd decreses fsting lood glucose in humns (Fontn et l. 216). An LP diet lso promotes metolic helth in rodents, reducing the ccumultion of white dipose tissue (WAT) nd incresing glucose tolernce nd insulin sensitivity in nimls fed norml diet, s well s improving glucose homeostsis in mice fed high-ft diet (Leger et l. 214; Solon-Biet et l. 215; Fontn et l. 216; Mid et l. 216). We hypothesized tht the eneficil effects of LP diet might e driven y reduced consumption of specific essentil mino cids. We focused on the rnched-chin mino cids (BCAAs; leucine, isoleucine nd vline) s lood levels of BCAAs correlte with insulin-resistnt oesity nd dietes in humns nd rodents (Felig et l. 1969; Newgrd et l. 29; Btch et l. 213; Lynch & Adms, 214; Connelly et l. 217). BCAA levels lso correlte well with outcomes in weight loss regimens (Shh et l. 212), nd re reduced in oth mice nd humns consuming LP diets (Solon-Biet et l. 214; Fontn et l. 216). We determined tht specificlly reducing dietry BCAAs y two-thirds recpitultes mny eneficil effects of LP diet, promoting lenness nd glucose tolernce in metoliclly norml C57BL/6J mice (Fontn et l. 216). Reducing dietry BCAAs from young ge lso slows the ccumultion of viscerl dipose tissue in Zuckerftty rts nd preserves insulin sensitivity (White et l. 216). These results led us to hypothesize tht specificlly reducing dietry BCAAs might not only preserve the metolic helth of young nimls, ut lso might e n effective strtegy to restore metolic helth to nimls with pre-existing diet-induced metolic dysfunction. Herein, we test if specificlly reducing dietry BCAAs cn restore metolic helth to C57BL/6J mice preconditioned with high-clorie, high-ft, high-sugr Western diet (), well chrcterized model of diet-induced oesity (DIO) nd erly type 2 dietes (Winzell & Ahren, 24; Newerry et l. 26; Peterson et l. 211; Willims et l. 214). We find tht specificlly reducing dietry BCAAs is sufficient to promote weight normliztion without cloric restriction in less thn 4 weeks, primrily s result of drmtic reduction in ft mss, nd improves metolic helth. Reduction of dietry BCAAs in the context of n otherwise trnsiently induces the energy lnce regulting hormone FGF21 (firolst growth fctor 21) nd induces sustined increse in energy expenditure. Our results suggest tht specificlly reducing dietry BCAAs, or tretment with phrmceuticls tht mimic this effect, could e n effective nd trnsltle intervention for promoting weight normliztion, control of lood glucose, nd overll metolic helth. Methods Ethicl pprovl nd nimls All procedures conformed with institutionl guidelines nd were pproved y the Institutionl Animl Cre nd C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

3 J Physiol A low BCAA diet restores metolic helth 625 Use Committee of the Willim S. Middleton Memoril Veterns Hospitl (Mdison, WI, USA). Animls were killed using methods consistent with the recommendtions of the Pnel on Euthnsi of the Americn Veterinry Medicl Assocition. The reserch complies with the policies of The Journl of Physiology (Grundy, 215). Animls nd diets Mle C57BL/6J mice were purchsed from The Jckson Lortory (Br Hror, ME, USA) t 5 weeks of ge, nd preconditioned with (TD.88137; Envigo, Mdison, WI, USA) strting t 6 weeks of ge for 12 weeks; chow control mice were fed Purin 51 (Purin Mills, Richmond, IN, USA). Mice were then switched to mino cid defined diets or supplemented with dditionl BCAAs; ll diets were otined from Envigo nd diet descriptions, compositions nd item numers re provided in Tles 1 3. Mice were housed in SPF mouse fcility under 12:12 h light/drk cycle with free ccess to food nd wter, except where noted in the procedures elow. Animls were group housed in sttic microisoltor cges, except when temporrily housed in Oxymx/CLAMS metolic chmer system (Columus Instruments, Columus, OH, USA). Group sizes re provided s pproprite. The rndomiztion of oese, fed mice ws performed t the cge level to ensure tht ll groups hd pproximtely the sme initil strting weight. Procedures Glucose tolernce tests were performed y fsting the mice overnight for 16 h nd then injecting glucose (1 g kg 1 ) I.P. (Arriol Apelo et l. 216; Fontn et l. 216). Insulin tolernce tests were performed y fsting mice for 4 h strting t lights on nd then injecting insulin (.75 U kg 1 ) I.P. Glucose mesurements were tken using Byer Contour lood glucose meter (Byer, Leverkusen, Germny) nd test strips. Blood for fsting insulin nd FGF21 ws otined following n overnight fst; insulin (Crystl Chem, Elk Grove Villge, IL, USA) nd FGF21 (R&D Systems, Minnepolis, MN, USA) levels were determined y n enzyme-linked immunosorent ssy. Mouse ody composition ws determined using n EchoMRI 3-in-1 Body Composition Anlyser (EchoMRI, Houston, TX, USA). For ssy of multiple metolic prmeters [O 2, CO 2, food consumption, respirtory exchnge rtio (RER), energy expenditure] nd ctivity trcking, mice were cclimted to housing in Oxymx/CLAMS metolic chmer system (Columus Instruments) for 24 h nd dt from continuous 24 h period ws then recorded nd nlysed. Triglycerides were mesured y Triglyceride Colorimetric Assy Kit (Cymn Chemicl Compny, Ann Aror, MI, USA) in liver collected fter fsting for 16 h. Other tissues for moleculr nlysis were flsh-frozen in liquid nitrogen or fixed nd prepred s descried elow. Histology Smples of rown dipose tissue (BAT), WAT, liver nd skin were isolted following deth. Adipose ws fixed in 4% prformldehyde overnight, nd then sectioned nd hemtoxylin nd eosin (H&E) stined y the University of Wisconsin Crone Cncer Center (UWCCC) Experimentl Pthology Lortory. Liver ws emedded in OCT, nd then cryosectioned nd Oil-Red-O stined y the UWCCC Experimentl Pthology Lortory. Liver, BAT nd WAT sections were imged using n EVOS microscope (Thermo Fisher Scientific Inc., Wlthm, MA, USA) s descried previously (Linnemnn et l. 215). Skin ws isolted from the elly nd ck of mice, prformldehyde-fixed (4%) overnight, nd then prffin-emedded for evlution (Kszet l. 214). Scle rs were inserted utomticlly or mnully y the investigtor. For quntifiction of lipid droplet size, six independent fields were otined for ech tissue from ech mouse nd quntified using ImgeJ (NIH, Bethesd, MD, USA). Quntittive PCR Liver or dipose RNA ws extrcted with Triregent (Sigm, St Louis, MO, USA). Then, 1 μg of RNA ws used to generte cdna (Superscript III; Invitrogen, Crlsd, CA, USA). Oligo dt primers nd primers for rel-time PCR were otined from Integrted DNA Technologies (IDT, Corlville, IA, USA). Rections were run on n StepOne Plus mchine (Applied Biosystems, Foster City, CA, USA) with Syr Green PCR Mster Mix (Invitrogen). Actin ws used to normlize the results from gene-specific rections. The primer sequences used for quntittive PCR re s descried previously (Hgiwr et l. 212; Fontn et l. 216) or were designed using the IDT quntittive PCR design tool nd were: Acc1: F: AAGGCTATGTGAAGGATG, R: CTGTCTGAAGAGGTTAGG; Acl: F: GCCAGCGGGAG CACATC, R: CTTTGCAGGTGCCACTTCATC; Act: F: ACCTTCTACAATGAGCTGCG, R: CTGGATGGCTACG TACATGG; Bmp8: F: TCAACACAACCCTCCACATCA, R: AGATCGGAGCGTCTGAAGATC; Dgt1: F: TGGT GTGTGGTGATGCTGATC, R: GCCAGGCGCTTCTCAA; Dgt2: F: AGTGGCAATGCTATCATCATCAT, R: TCTTC TGGACCCATCGGCCCCAGGA; Fsn: F: CCCCTCTG TTAATTGGCTCC, R: TTGTGGAAGTGCAGGTTAGG; Fgf21: F: CAAATCCTGGGTGTCAAAGC, R: CATGGGC TTCAGACTGGTAC; Gpt: F: CAACACCATCCCCGA CATC, R: GTGACCTTCGATTATGCGATCA; Pprg: F: C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

4 626 N. E. Cummings nd others J Physiol Tle 1. Diet composition of diets used to investigte the effect of reduced levels of dietry BCAAs in the context of norml clorie diet Amino cid defined diets Control AA ExLow AA ExLow BCAA Western () + BCAA Tekld diet numer TD TD TD TD TD Colour Red Ornge Blue Tn Green Formul (g kg 1 ) L-Alnine L-Arginine L-Asprgine L-Asprtic cid L-Cysteine L-Glutmic cid L-Glutmine Glycine L-Histidine HCl, monohydrte L-Isoleucine L-Leucine L-Lysine HCl L-Methionine L-Phenyllnine L-Proline L-Serine L-Threonine L-Tryptophn L-Tyrosine L-Vline DL-Methionine Csein Sucrose Corn strch Mltodextrin Anhydrous milkft Cholesterol Corn oil Olive oil Cellulose Minerl mix, AIN-93M-MX (9449) Minerl mix, AIN-76 (17915) Clcium cronte 4 4 Clcium phosphte C(H 2 PO 4 ) 2 H 2 O Vitmin mix, Tekld (46) TBHQ, nti-oxidnt Ethoxyquin, nti-oxidnt.4.4 Food colouring % kcl from: Protein (sed on N 6.25) Crohydrtes vft kcl g Amino cid defined diets with the specified formultions were otined from Envigo. These diets were used in the experiment outlined in Fig. 1A ndusedtootintheresultsshowninfigs1 3. GTACTGCCGTTTTCACAAGTG, R: TCTTTCAGGTCG TGTTCACAG; Scd1: F: CTGACCTGAAAGCCGAGAAG, R: AGAAGGTGCTAACGAACAGG; Srep1c: F: GGAGC CATGGATTGCACATT, R: GGCCCGGGAAGTCACTGT. Immunolotting Tissue smples were lysed in cold RIPA uffer supplemented with phosphtse nd protese inhiitor cocktil tlets. Tissues were lysed s descried previously C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

5 J Physiol A low BCAA diet restores metolic helth 627 (Br et l. 216) using FstPrep 24 (MP Biomedicls, Snt An, CA, USA) with ed-eting tues ( ) nd cermic eds ( ) from Mo-Bio Lortories (Sn Diego, CA, USA) nd then centrifuged. Protein concentrtion ws determined y Brdford (Pierce Biotechnology, Rockford, IL, USA). Next, 2 μg of protein ws seprted y SDS-PAGE on 1% resolving gels (Life Technologies, Grnd Islnd, NY, USA). Antiody for HSP9 (#4874) ws purchsed from Cell Signling Technology (Beverly, MA, USA). Antiody for UCP1 (1983) ws purchsed from Acm (Cmridge, MA, USA). Imging ws performed using GE ImgeQunt LAS 4 imging sttion (GE Helthcre Chicgo, IL, USA). Quntifiction ws determined y densitometry using ImgeJ. Islet isoltion nd ex vivo studies Islets were isolted nd n ex vivo glucose stimulted insulin secretion ssy ws performed s descried previously (Neumn et l. 214; Truchn et l. 215; Fontn et l. 216). Briefly, mice were nesthetized with 24 mg kg 1 of freshly prepred vertin, form of nesthesi tht does not dilte the vsculture or lter lood glucose levels, nd the mouse ws then killed y exsnguintion while the pncres ws inflted with collgense to isolte the islets. Mitochondril memrne potentil ws mesured in islets pre-loded with Rhodmine123 (5 μm, 5 min) (Sigm) nd perfused with stndrd externl solution (135 mm NCl, 4.8 mm KCl,5mM CCl 2, 1.2 mm MgCl 2 nd 2 mm Hepes, ph 7.35) contining 2 or 2 mm glucose, followed y reference solution contining 2 mm glucose nd 5 mm KCN, which ws used to normlize the dt. Excittion (5/2 ) nd emission (535/3 m) filters (ET type; Chrom Technology Corportion, Rockinghm, VT, USA) were used in comintion with n FF444/521/68-Di1 dichroic (Semrock, Rochester, NY, USA) on Ti-Eclipse microscope (Nikon, Tokyo, Jpn); the imging system hs een descried previously (Gregg et l. 216). A single region of interest ws used to quntify the verge response of ech islet using Elements (Nikon). Sttisticl nlysis Sttisticl nlysis ws conducted using Prism, version 7 (GrphPd Softwre Inc., Sn Diego, CA, USA). Tests involving repeted mesurements were nlysed with two-wy repeted-mesures ANOVA, followed y Tukey Krmer or Dunnett s post hoc test s specified. All other comprisons of three or more mens were nlysed y one-wy ANOVA followed y Dunnett s or Tukey Krmer post hoc test s specified where pproprite. Additionl comprisons, if ny, were corrected for multiple comprisons using the Bonferroni method. Results DIO mice switched to norml clorie diets with reduced BCAAs rpidly lose weight nd improve glycemic control We induced oesity nd metolic dysfunction y feeding C57BL/6J mice for 12 weeks (DIO mice). DIO mice were then switched to one of severl different diets of vrying mino cid compositions, with n energy density nd mcronutrient composition typicl of rodent chow (Fig. 1A). One group of mice ws mintined on, wheres n dditionl group of mice ws fed supplemented with BCAAs. Finlly, prllel group of mice never exposed to ws plced on Control mino cid defined diet. Exct diet formultions re provided in Tle 1. All DIO mice lost weight when switched to norml clorie diet, wheres mice consuming (with or without supplementl BCAAs) continued to gin weight (Fig. 1B). Mice consuming diets in which the BCAAs [extr low (ExLow) BCAA] or ll mino cids (ExLow AA) were specificlly reduced lost weight very rpidly, shedding 25% of their ody weight in 2 weeks efore eventully stilizing t weight lower thn mice never exposedto.incontrst,diomiceswitchedto norml clorie Control diet normlized their weight more slowly, over 2 dditionl months. Mice fed the ExLow BCAA or ExLow AA diets lost ft mss, including epididyml WAT, nd len mss, with net effect of gretly reduced diposity reltive to mice switched to the Control diet s well s to those remining on (Fig. 1C nd D). The drmtic weight loss of mice consuming the ExLow BCAA nd ExLow AA diets ws not the result of decresed food consumption. Indeed, the solute cloric intke of mice consuming these diets ws similr to tht of mice switched to the norml clorie Control diet (dt not shown) nd, reltive to their ody weight, the cloric intke of mice on either the ExLow BCAA or ExLow AA diets ws incresed (Fig. 1E). Low protein nd low mino cid diets promote energy expenditure (Leger et l. 214; Fontn et l. 216). We ssessed ctivity nd energy expenditure vi indirect clorimetry once the weights of ll groups hd stilized. Although ll mice switched to norml clorie diets hd similr levels of ctivity, we oserved incresed energy expenditure in mice switched to the ExLow AA diet (Fig. 1F). DIO mice switched to ny of the norml clorie diets hd significntly thinner derml WAT (dwat) (Fig. 2A nd B) thn mice remining on. DIO mice fed the ExLow BCAA diet hd thinner dwat thn DIO mice switched to the Control diet. DIO mice consuming or supplemented with BCAAs hd evident heptic stetosis with lrge ft droplets, wheres DIO C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

6 628 N. E. Cummings nd others J Physiol A 6 Western diet 12 chow diet Week 12 Western diet Control AA diet + BCAA ExLow BCAA diet ExLow AA diet Control AA diet B weight (g) time since diet switch (weeks) chow Control Control + BCAA ExLow BCAA ExLow AA C E ft mss (g) kcl/dy/g ody weight chow Control Control ExLow BCAA + BCAA ExLow AA len mss (g) time since diet switch (weeks) time since diet switch (weeks) 2 weeks fter diet switch 1 weeks fter diet switch c.6.6 c,d,c,c,,d.4, D ewat weight (g) chow Control Control + BCAA ExLow BCAA ExLow AA chow Control Control + BCAA ExLow BCAA ExLow AA F Spontneous ctivity 3 2 1,,, Dy chow Control Night Control + BCAA Energy expenditure (kcl/kg/hr) 2 1,c ExLow BCAA ExLow AA,c c c Dy Night Figure 1. Norml clorie diets with reduced levels of BCAAs promote rpid weight loss A, schemtic representtion of the experimentl pln; mice were preconditioned with for 12 weeks nd then rndomized to the five experimentl groups shown, wheres chow-fed Control mice were plced on n mino cid defined Control diet. B, weight s well s (C) dipose nd len mss, of mice in ech experimentl group, ws trcked (n = 12 mice per group). D, epididyml WAT ws collected t necropsy nd weighed (n = mice per C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

7 J Physiol A low BCAA diet restores metolic helth 629 group; P <.5, Dunnett s test following ANOVA, P <.5, Bonferroni s test). E, 2 nd 1 weeks following the strt of the specified dietry intervention, food intke ws ssessed over 4 dy period in home cges, clculted s kcl dy g 1 ody weight (n = 6 7 cges per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). F, spontneous ctivity nd energy expenditure were mesured using metolic chmers 7 8 weeks fter the strt of the dietry intervention (n = 5 8 mice per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). Error rs represent the SE. mice switched to either the Control or ExLow BCAA diets hd decresed liver droplet size nd norml liver histology y the conclusion of the experiment (Fig. 2C nd D). DIO mice switched to the ExLow AA diet hd trend towrds reduced lipid droplet size (corrected P =.12), ut heptic stetosis ws still evident. mrna expression of mny lipogenic genes nd trnscription fctors ws reduced in the livers of mice switched to Control or ExLow BCAA diets, with similr ut less drmtic effects in mice switched to the ExLow AA diet (Fig. 2E). Surprisingly, mice fed supplemented with BCAAs lso hd decresed heptic expression of mny lipogenic genes nd trnscription fctors. Glucose tolernce improved in ll mice switched to norml clorie diets; fter 3 weeks, mice switched to ExLowBCAAndExLowAAdietshdimprovedglucose tolernce reltive to ll other groups, including mice never exposed to (Fig. 3A), which ws n effect tht ws sustined throughout the experiment. In contrst, supplementing with BCAAs resulted in worse glucose tolernce vs. ll other groups fter 9 weeks (dt notshown).diomicethtreminedonwereinsulin resistnt; ll mice plced on norml clorie diets showed improved insulin sensitivity reltive to mice, with mice switched to n ExLow AA diet showing improved insulin sensitivity reltive to ll groups (Fig. 3B). DIO mice tht remined on hd fsting hyperglycemi nd hyperinsulinemi, s well s incresed HOMA2-IR (Levy et l. 1998; Mther, 29), reltive to mice never exposed to (Fig. 3C E). In greement with our tolernce tests, these deficits were corrected in mice switched to ny of the norml clorie diets (Fig. 3C E). Specificlly reducing dietry BCAAs restores metolic helth to DIO mice continuing to consume While these results supported our hypothesis tht reducing dietry BCAAs would restore metolic helth, the simultneous ltertions in energy density nd mcronutrient rtios mde it difficult to elucidte the precise contriution of the BCAAs. To specificlly ddress this question, we designed new series of diets sed on novel mino cid-defined ( Control AA) closely mtching the mcronutrient profile of the nturlly sourced diet TD Using this Control AA diet s our se, we developed severl dditionl isocloric Tle 2. Composition of mino cid defined s Diet nme Description Control AA AA-defined 41% of clories from ft, 38% of clories from crohydrtes (high sucrose), with cholesterol High BCAA Similr to Control AA; with 2 BCAAs Low BCAA Similr to Control AA; with 67% reduction in the BCAAs Low AA Similr to Control AA; with 67% reduction in ll AAs Control AA AA defined norml clorie diet The exct formultion of these diets is provided in Tle 3. s with incresed or decresed dietry levels of BCAAs (Tle 2). As shown in Fig. 4A, we induced oesity in 48 C57BL/6J mice y feeding them for 12 weeks; these mice were then rndomized into four groups of 12 mice ech, nd ech group ws plced on either Control AA, High BCAA, Low BCAA or Low AA diet. In prllel,groupof12miceneverexposedtowere switched to the Control mino cid defined diet. Exct diet formultions re provided in Tle 3. DIO mice fed either the Control AA or High BCAA diets mintined or gined weight, wheres DIO mice switched to the Low BCAA or the Low AA diets progressively lost weight for 3 weeks (Fig. 4B). TheweightofmicefedLowBCAAdietthen stilized, mtching the weight of Control AA-fed mice neverexposedto;micefedthelowaadiet continued to lose weight t gretly reduced rte. The weight loss of these mice ws primrily due to drmtic decrese in ft mss, wheres len mss ws preserved (Fig. 4C), nd ws not ssocited with decresed food consumption (Fig. 4D). Overll, the mice fed the Low BCAA or Low AA diets hd improved ody composition, with decresed diposity nd resulting increse in the len frction (Fig. 4E). The dwatthickness of mice fed the Low BCAA or Low AA diets ws significntly decresed; curiously, mice fed the High BCAA diet lso hd thinner dwat (Fig. 5A). Mice fed the Low BCAA diet hd smller heptic lipid droplets thn mice fed the Control AA diet, nd clered much of the heptic ft deposited y feeding (Fig. 5B). Intriguingly, there ws lso qulittive C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

8 63 N. E. Cummings nd others J Physiol A skin epidermis dermis dwat muscle chow Control 2 μm 2 μm Control + BCAA ExLow BCAA ExLow AA B DWAT thickness (μm) chow Control Control +BCAA ExLow BCAA ExLow AA C liver chow Control Control + BCAA ExLow BCAA ExLow AA D Droplet Size (μm 2 ) 5 25 chow Control Control + BCAA ExLow AA ExLow BCAA E chow Control Control + BCAA ExLow BCAA ExLow AA 125 Gene expression (% of ) Acl Acc1 Fsn Scd1 Gpt Dgt1 Dgt2 Srep1c Pprg Figure 2. Consumption of n ExLow BCAA diet reduces dipose tissue nd reverses diet-induced heptic stetosis A, prffin-emedded skin smples were collected t necropsy 15 weeks following the strt of the specified dietry intervention, sectioned, nd H&E stined, nd the thickness of derml WAT ws quntified (B) for non-ngen stge skin smples, mesuring from muscle to dermis; scle r = 2 µm (n = 5 7 mice per group, P <.5, Dunnett s test following ANOVA, P <.5, Bonferroni s test). C, liver smples were stined with Oil-Red-O nd (D) droplet size ws quntified; scle r = 2 µm (n = 3 mice per group, P <.5 vs., Dunnett s test following ANOVA). E, lipogenic gene expression ws mesured in the livers of fsted mice (n = 5 6 mice per group, P <.5 vs., Dunnett s test following two-wy repeted mesures ANOVA). Error rs represent the SE. C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

9 J Physiol A low BCAA diet restores metolic helth 631 A lood glucose (mg/dl) 3 weeks fter diet switch GTT time (minutes) chow Control Control + BCAA ExLow BCAA ExLow AA Are under the curve chow Control Control + BCAA ExLow BCAA ExLow AA c c B lood glucose (% of sl) 4 weeks fter diet switch time (minutes) ITT chow Control Control + BCAA ExLow BCAA ExLow AA Are under the curve ,d,c, c,d chow Control Control + BCAA ExLow BCAA ExLow AA d C D E 5 weeks fter diet switch 5 weeks fter diet switch 5 weeks fter diet switch lood glucose (mg/dl) 1 5,c c,d d chow Control Control + BCAA ExLow BCAA ExLow AA insulin (ng/ml) 1.5 chow Control Control + BCAA ExLow BCAA ExLow AA HOMA2-IR chow Control Control + BCAA ExLow BCAA ExLow AA Figure 3. Consumption of BCAAs inversely correltes with glucose tolernce nd insulin sensitivity Glucose (A) nd(b) insulin tolernce tests were conducted t the specified times fter the strt of the dietry interventions (n = 1 12 per group; for the re under the curve, mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). C E, mice were fsted overnight nd (C) lood glucose nd (D) insulin were mesured nd (E) the HOMA2-IR ws clculted fter5 weeks on the specified diets (n = 5 7 mice per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). Error rs represent the SE. C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

10 632 N. E. Cummings nd others J Physiol Tle 3. Diet composition of diets used to investigte the effect of specificlly ltering dietry BCAAs in the context of Amino cid defined diets Control AA Control AA High BCAA Low BCAA Low AA Tekld diet numer TD TD TD TD TD Colour Red Aqu Green Blck Ornge Formul (g kg 1 ) L-Alnine L-Arginine L-Asprgine L-Asprtic cid L-Cysteine L-Glutmic cid L-Glutmine Glycine L-Histidine HCl, monohydrte L-Isoleucine L-Leucine L-Lysine HCl L-Methionine L-Phenyllnine L-Proline L-Serine L-Threonine L-Tryptophn L-Tyrosine L-Vline Sucrose Corn strch Mltodextrin Anhydrous milkft Cholesterol Corn oil 52. Olive oil 29. Cellulose Minerl mix, AIN-93M-MX (9449) Clcium phosphte C(H 2 PO 4 ) 2 H 2 O Vitmin mix, Tekld (46) TBHQ, nti-oxidnt Food colouring % kcl from: Protein (sed on N 6.25) Crohydrtes Ft kcl g Amino cid defined diets with the specified formultions were otined from Envigo. These diets were used in the experiment outlined in Fig. 4A ndusedtootintheresultsshowninfigs4 1. histologicl improvement nd non-significnt trend towrds reduced lipid droplet size in mice consuming extr BCAAs ( High BCAA). The livers of mice fed the Low AA diet did not hve smller lipid droplets nd retined lrge lipid droplets (Fig. 5B). Mice fed the Low AA or High BCAA diets hd incresed heptic triglyceride levels (Fig. 5C). We oserved numericl decreses in the mrna expression of two lipogenic genes (Fsn, Scd1) in the livers of mice fed either the Low BCAA diet or the High BCAA diet, s well s sttisticlly significnt decrese in the trnscription fctor Pprg in the livers of mice switched to Low BCAA diet (Fig. 5D). We exmined glycemic control y conducting glucose nd insulin tolernce tests, s well s y determining fsting glucose nd insulin levels. Glucose tolernce ws improved in mice eting the Low BCAA nd Low AA diets 3 weeks fter the diet switch, time when these mice still weighed more thn Control AA-fed mice never exposed to (Fig. 6A). Insulin sensitivity ws C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

11 J Physiol A low BCAA diet restores metolic helth 633 similrly improved in oth groups (Fig. 6B), even s the mice continued to consume. These improvements were mintined over the course of the study (dt not shown). Mice on Low BCAA nd Low AA diets hd decresed fsting lood glucose nd insulin levels (Fig. 6C nd D), wheres incresing dietry BCAAs resulted in fsting hyperglycemi nd hyperinsulinemi. HOMA2-IR clculted from these vlues indicte tht insulin sensitivity is inversely correlted with dietry BCAAs (Fig. 6E). A 48 Western diet 12 chow diet Control AA High BCAA Low BCAA Low AA Control AA diet B weight (g) 4 3 chow Control AA High BCAA Week time since diet switch (weeks) C ft mss (g) len mss (g) 2 1 chow Control AA High BCAA time since diet switch (weeks) time since diet switch (weeks) D kcl/dy/g ody weight Food Intke 2 weeks fter diet switch E ody composition (%) weeks on diet ft len Figure 4. Specificlly reducing dietry BCAAs in the context of promotes rpid weight loss nd reduced diposity A, schemtic representtion of experimentl pln; mice were preconditioned with for 12 weeks nd then rndomized to the four experimentl groups shown, wheres chow-fed Control mice were plced on n mino cid defined Control diet. B, weight,swells(c) dipose nd len mss of mice in ech experimentl group ws trcked (n = 12 mice per group). D, food intke ws mesured 2 weeks fter specil diet feeding egn (n = 8 cges per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). E, ody composition t diet intervention strt nd 12 weeks lter. Error rs represent the SE. C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

12 634 N. E. Cummings nd others J Physiol A skin epidermis dermis dwat muscle DWAT thickness (μm) B Liver Droplet Size (μm 2 ) n.s. C Triglycerides (mg/dl/mg tissue) D Gene expression (% of ) # Fns Scd1 Srep1c Pprg chow Control AA High BCAA # Figure 5. Specificlly reducing dietry BCAAs in the context of reduces dipose tissue nd reverses diet-induced heptic stetosis A, skin smples were collected fter feeding mice the indicted diets for 14 weeks, sectioned, H&E stined nd the thickness of derml WAT ws quntified for non-ngen stge skin smples, mesuring from muscle to dermis; scle r = 2 µm (n = 6 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). B, OCT-emedded liver smples were cryosectioned nd stined with Oil-Red-O, nd droplet size ws quntified; scle r = 2 µm (n = 3 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). C, triglyceride levels in liver s mg dl 1 mg 1 of tissue ssyed (n = 6 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). D, lipogenic gene expression in the livers of mice on the specified diets ws mesured y quntittive PCR fter n overnight fst (n = 8 9 mice per group, P <.5, #P <.1 vs. Control AA, Dunnett s test following ANOVA). Error rs represent the SE. C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

13 J Physiol A low BCAA diet restores metolic helth 635 A lood glucose (mg/dl) B C lood glucose (% of sl) lood glucose (mg/dl) GTT time (minutes) time (minutes) weeks fter diet switch # 4 weeks fter diet switch D insulin (ng/ml) ITT chow Control AA High BCAA chow Control AA High BCAA # Are under the curve Are under the curve E HOMA2-IR Figure 6. Reduction of dietry BCAAs improves glycemic control even in mice continuing to consume high-clorie, high-ft, high-sugr Glucose (A) nd(b) insulin tolernce tests were conducted 3 nd 4 weeks, respectively, fter the strt of the dietry interventions (n = per group; for the re under the curve, mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). C E, fsting(c) lood glucose nd (D) insulin were mesured nd (E) the HOMA2-IR ws clculted fter 5 weeks on the specified diets (n = 3 7 mice per group; P <.5, #P <.12 vs. Control AA, Dunnett s test following ANOVA). c d C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

14 636 N. E. Cummings nd others J Physiol We exmined pncretic islet function y performing n ex vivo glucose-stimulted insulin secretion ssy (Fig. 7A). Insulin secretion ws decresed in mice fed Low AA diet (Fig. 7A); however, totl islet insulin content ws not ffected (Fig. 7A). To precisely exmine β cell metolic stress, we quntified the mitochondril memrne potentil. This ws incresed in mice eting Control AA diet, nd ws reduced nd essentilly normlized in mice consuming Low BCAA nd Low AA diets (Fig. 7B). In every cse except High BCAA, β cell function ws mtched with insulin sensitivity, implying tht incresed BCAA consumption negtively impcts mitochondril function nd insulin secretion. Chronic consumption of reduced BCAA increses energy expenditure independently of FGF21 To understnd how reducing dietry BCAAs promotes lenness without reducing clorie intke, we utilized metolic chmers to exmine food consumption, respirtion, ctivity, nd energy expenditure fter mice hdeenonthedietsfor 12 weeks. Mice fed diets with reduced levels of BCAAs or reduced levels of ll AAs consumed round twice s mny clories thn mice fed Control AA diet (dt not shown); the increse is even greter when clculted reltive to ody weight (Fig. 8A). As expected, the RER ws decresed y feeding nd incresed in mice consuming the high crohydrte Low AA diet (Fig. 8B). Intriguingly, the RER of mice fed the Low BCAA diet, contining the sme level of crohydrtes s the Control AA diet, ws lso incresed, nd ws indistinguishle from the RER of mice consuming Low AA diet. There ws no difference in spontneous ctivity etween ny of the groups (Fig. 8C). Mice consuming the Low BCAA nd Low AA diets hd greter energy expenditure during oth dytime nd night-time (Fig. 8D). Mice consuming the Low AA diet hd high A insulin, ng/ml insulin, ng/islet mm glucose 16.7 mm glucose chow Control AA High BCAA B ΔΨm (Rhodmine1,2,3) 2G 2G KCN 1 min.1 F/Fo ΔΨm normlized to KCN G 2G chow Control AA High BCAA Figure 7. Ex vivo nlysis of the effect of ltering dietry BCAAs on pncretic et cells A, nex vivo insulin secretion ssy ws performed to ssess (left) insulin secretion per islet nd (right) islet insulin content in response to low (1.7 mm) nd high (16.7 mm) glucose in mice kept on the indicted diets for 14 weeks (n = 6 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). B, the mitochondril memrne potentil ws mesured in ex vivo isolted pncretic islets stimulted with low (2 mm) nd high (2 mm) glucose levels (n = islets per group; P <.5 vs. Control AA, Dunnett s test following ANOVA). Error rs represent the SE. C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

15 J Physiol A low BCAA diet restores metolic helth 637 A C Spontneous ctivity kcl/dy/g ody weight Food Intke 12 weeks fter diet switch, Dy, chow Control AA High BCAA Night B RER chow Control AA High BCAA D Energy expenditure (kcl/kg/hr),c,c,c 2 1 Dy, Dy c c chow Control AA High BCAA,c Night,c Night E FGF21 (x1 2 pg/ml) 12 weeks fter diet switch F 12 weeks fter diet switch Fgf21 expression (% of ) Figure 8. Metolic impct of sustined consumption of diets with ltered dietry BCAAs A, food intke over 24 h period (n = 2 5 mice per group; mens with the sme lowercse letter re not significntly different from ech other, Bonferroni test, P <.5). B, RER,(C) spontneous ctivity nd (D) energy expenditure were mesured 12 weeks fter the strt of the dietry intervention (n = 4 5 mice per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). E, FGF21 ws mesured in the plsm of mice following n overnight fst (n = 4miceper group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). F, Fgf21 gene expression in the liver of mice following n overnight fst ws ssessed y quntittive PCR (n = 8 9 mice per group; #P <.1 vs. Control AA, Dunnett s test following ANOVA). Error rs represent the SE. # C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

16 638 N. E. Cummings nd others J Physiol levels of the energy lnce regulting hormone FGF21 (Fig. 8E); however, there ws no increse in FGF21 in the lood of mice consuming the Low BCAA diet nd no increse in liver Fgf21 gene expression (Fig. 8E nd F). Reduction in dietry BCAAs in -fed mice is ccompnied y trnsient increse in FGF21 levels From the perspective of weight nd ody composition, the 3 weeks following the diet switch re distinctly different from the time period during which we nlysed energy expenditure ove. In prticulr, rpid weight normliztion occurs during the first 3 weeks, wheres weights re reltively stle therefter. We therefore utilized n dditionl cohort of mice to intensively nlyse weight, ody composition, ctivity, nd energy expenditure during the 12 dys immeditely following the diet switch, during which mice fed the Low BCAA nd Low AA diets progressively lost weight nd ft mss (Fig. 9A nd B). In contrst to the incresed RER seen t lter time points, neither Low BCAA or Low AA diet fed mice hd incresed RER 1 week fter the diet switch; indeed, Low BCAA diet fed mice hd lower RER (Fig. 9C). Although there were no significnt chnges in spontneous ctivity etween groups, we oserved sttisticlly significnt increse in energy expenditure during the dytime nd night-time in Low AA diet fed mice ut, surprisingly, not in Low BCAA fed mice (Fig. 9C). As weight loss in the sence of chnge in energy expenditure or ctivity ws puzzling, we exmined energy expenditure more closely over 24 h period. We determined tht mice fed the Low BCAA diet hve significnt increse in energy expenditure for t lest 2% of 24 h period, with the most pronounced difference t night (Fig. 9D). Following completion of this nlysis, we determined tht FGF21 levels were significntly incresed in the lood of oth Low BCAA nd Low AA diet fed mice (Fig. 9E). FGF21 promotes rowning of WAT nd incresed ctivtion of BAT (Fisher et l. 212; Owen et l. 214; Douris et l. 215; Hill et l. 217; Wnders et l. 217). We oserved decresed dipocyte size in inguinl nd gondl WAT, consistent with the oserved loss of dipose mss; however, we did not oserve morphology consistent with incresed eiging (Fig. 1A) nd the expression of UCP1 ws not incresed in either gondl or inguinl WAT of Low BCAA or Low AA diet fed mice (Fig. 1B nd C). We lso did not oserve incresed expression of Ucp1 in the BAT of mice fed Low BCAA or Low AA diets (Fig. 1D); however, we did oserve significnt decrese in lipid droplet size (Fig. 1E) nd incresed expression of Bmp8 (Fig. 1F), which re chnges consistent with FGF21-medited ctivtion of BAT (Whittle et l. 212; Bendyn & Cmmisotto, 216; Quesd-Lopez et l. 216; Wnders et l. 217). Discussion Building on recent studies conducted y our lortory nd others showing tht reducing dietry BCAAs cn promote or preserve metolic helth in young mice nd rts (Xio et l. 214; Fontn et l. 216; White et l. 216), we tested the hypothesis tht reducing dietry BCAAs would e uniquely potent wy to intervene in metolic syndrome. In the present study, we find tht specificlly reducing dietry BCAAs, without ltering energy density, the cloric contriution of mino cids to the diet, or the protein:crohydrte rtio (Solon-Biet et l. 214, 215; Simpson et l. 217), is sufficient to roustly restore metolic helth. These studies represent the first exmintion of reduced BCAA diet in mouse model of pre-existing diet-induced oesity nd type 2 dietes, which re not hyperphgic nd hve grdul nd reversile onset of metolic disese (Willims et l. 214). Specificlly reducing BCAAs rpidly normlizes the weight of DIO mice without clorie restriction, even in mice continuing to consume, promoting ft mss loss s well s rpid nd drmtic improvements in glucose tolernce nd insulin sensitivity. While there re likely multiple mechnisms underlying the metolic enefits of reduced BCAA diet, the improvements in glucose homeostsisweoservehererelikelydueinprttoweightloss nd decresed diposity resulting from incresed energy expenditure. As summrized in Fig. 11, reducing either ll dietry AAs or specificlly reducing the BCAAs improves the metolic helth of DIO mice; however, the specific effects of the diets on energy lnce differ. During the cute phse of rpid weight loss, mice eting Low AA diet hve incresed food intke nd sustntil increse in energy expenditure, wheres mice eting Low BCAA diet hve no chnge in food intke nd more modest increse in energy expenditure. In contrst, during the chronic phse of reltively stle weight, energy expenditure nd cloric intke re identiclly incresed in mice consuming either the Low AA diet or Low BCAA diet. A more drmtic difference is oserved etween mice fed these two diets with regrd to the hormone FGF21, which hs pleiotropic effects on glucose metolism nd energy expenditure (Berglund et l. 29; Fisher et l. 212; Emnuelli et l. 214; Leger et l. 214, 216; Mrkn et l. 214; Owen et l. 214; Stone et l. 214). FGF21 is induced in oth humns nd rodents in response to low protein diets, nd is proposed to medite mny of the eneficil metolic effects of these diets (Leger et l. 214, 216; Fontn et l. 216; Mid et l. 216). Although our previous work, conducted in the context of norml clorie C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

17 J Physiol A low BCAA diet restores metolic helth 639 diet, reveled no effect of BCAA reduction on FGF21, in the present study we find tht specificlly reducing dietry BCAAs in the context of trnsiently induces FGF21. This is intriguing, prticulrly in light of recent study which suggests tht the increse in FGF21 in mice fed low protein diet is medited y the protein:crohydrte rtio (Solon-Bietet l. 216). Although other groups hve previously determined tht restricting or eliminting specific essentil dietry mino cids, including methionine or leucine (De Sous-Coelho et l. 212; Lees et l. 214,217; Wnders et l. 215, 217), is sufficient to induce FGF21, these studies hve utilized diets in which either methionine A weight (g) time since diet switch (dys) B chnge in 7 dys (g) dys fter diet switch ft mss len mss C 7 dys fter diet switch RER Dy Night Spontneous Activity Dy Night Energy expenditure (kcl/kg/hr) 2 1 Dy Night D Energy expenditure (kcl/kg/hr) 7 dys fter diet switch 12 dys fter diet switch 22 = p <.5 vs. Control AA minutes E FGF21 (pg/ml) c Figure 9. A Western reduced BCAA diet trnsiently induces FGF21 nd increses energy expenditure A, weight of DIO mice switched to the indicted diet t time (n = 8 per group). B, chnge in ft nd len mss of mice plced on ech diet for 7 dys (n = 8 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). C, RER, spontneous ctivity nd energy expenditure were mesured 1 week fter the diet switch (n = 6 8 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). D, energy expenditure over the course of 24 h cycle strting t 1. h (n = 8 mice per group; drk outline of symol indictes P <.5 vs. Control AA (Dunnett s test following two-wy repeted mesures ANOVA). E, FGF21 ws mesured in the plsm of mice following n overnight fst (n = 6 mice per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). Error rs represent the SE. C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

18 64 N. E. Cummings nd others J Physiol A iwat B iwat Control AA Low AA Low BCAA UCP1 HSP9 gwat gwat Control AA UCP1 HSP9 Low AA Low BCAA C UCP1 expression (% of ) 1 5 iwat UCP1 expression (% of ) 1 5 gwat D Ucp1 expression (% of ) 1 5 BAT E Brown Adipose Tissue Droplet Size (μm 2 ) 6 3 F Bmp8 expression (% of ) 2 1 BAT Figure 1. A Western reduced BCAA diet does not eige WAT ut ctivtes BAT Following n overnight fst, tissues were collected from DIO mice switched to the indicted diets for 12 dys. A, inguinl nd gondl WAT (iwat nd gwat, respectively) depots were collected, sectioned, nd H&E stined; scle r = 2 µm. B, the expression of UCP1 in iwat nd gwat ws determined y Western lotting. C, UCP1 expression in iwat nd gwat ws quntified reltive to HSP9 (n = 8 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). D, Ucp1 gene expression in BAT ws ssessed y quntittive PCR C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society

19 J Physiol A low BCAA diet restores metolic helth 641 (n = 6 mice per group, P <.5 vs. Control AA, Dunnett s test following ANOVA). E, BAT ws collected, sectioned, nd H&E stined, nd lipid droplet size ws quntified; scle r = 2 µm (n = 6 mice per group; mens with the sme lowercse letter re not significntly different from ech other, Tukey Krmer test following ANOVA, P <.5). F, Bmp8 gene expression in BAT ws ssessed y quntittive PCR (n = 6 mice per group; P <.5 vs. Control AA, Dunnett s test following ANOVA). Error rs represent the SE. or leucine levels re restricted y 8% or more. Our finding tht FGF21 is responsive to more physiologiclly relevnt 67% reduction in dietry levels of BCAAs, t lest in the context of, suggests tht the precise mino cid composition of the dietry protein my lso ply role. Further reserch will e required to define the mechnism y which FGF21 expression is regulted y dietry BCAAs nd, indeed, y other AAs such s sprgine (Wilson et l. 215). FGF21 hs een shown to ply key role in the response to cold exposure nd dietry interventions such s clorie restriction nd methionine restriction, promoting the eiging of WAT (Fisher et l. 212; Shlin et l. 213; Fino et l. 216; Wnders et l. 217). Dietry protein restriction lso promotes the eiging of WAT, nd increses energy expenditure vi FGF21 nd UCP1-dependent mechnism (Leger et l. 216; Hill et l. 217). We therefore hypothesized tht the increse in FGF21 following the reduction of dietry BCAAs or ll AAs promoted energy expenditure nd weight loss through the eiging of WAT. However, while mice fed either the Low AA or Low BCAA diet for 2 weeks hd incresed levels of FGF21 nd incresed energy expenditure, we oserved no chnges in WAT morphology consistent with eiging, nd no increse in the expression of UCP1 in either inguinl or gondl WAT. Ucp1 ws lso not incresed in BAT, despite the presence of other chnges suggestive of BAT ctivtion. These results demonstrte tht BCAA nd AA reduction in the context of does not promote energy expenditure solely y engging the FGF21-UCP1 xis nd promoting WAT eiging. However, s our nlysis of WAT nd BAT is limited to n erly time point, we cnnot rule out role for eiged WAT in the gretly incresed energy expenditure we oserved in mice consuming Low AA or Low BCAA diet for longer periods of time. Determining how UCP1 expression chnges in mice fed these diets for longer periods of time will e key point for further study. FGF21 my lso still ply role in the response to reduced dietry BCAAs, s recent reserch suggests tht some of the effects of FGF21 re mechnisticlly independent of UCP1 (Smms et l. 215). There re lso s yet undefined thermogenic mechnisms tht ct independently of FGF21 nd UCP1 (Hill et l. 217; Keipert et l. 217), which could conceivly lso ply role in the response to reduced dietry BCAAs. Understnding the moleculr mechnisms leding to incresed energy expenditure nd weight loss, including the role of FGF21 nd UCP1, will e key points for further study. The improvements in the regultion of lood glucose we oserve in mice consuming diets with reduced levels of BCAAs re not exclusively the result of weight loss. Notly, while oth glucose nd insulin tolernce re improved in oese mice switched to diets with reduced levels of the BCAAs, oese mice switched to the EE EE food intke food intke Figure 11. Specificlly reducing dietry BCAAs or ll AAs restores metolic helth to DIO mice Altering dietry levels of either the BCAAs or ll AAs promotes lenness nd restores lood glucose control to DIO mice, ut these two dietry interventions hve distinct effects on energy expenditure (EE), food intke nd lood levels of FGF21. Further, these metolic effects vry etween n cute phse (n 4 week long period following the diet switch chrcterized y rpid weight loss), nd chronic phse tht persists once mice hve reched stle weight. Western Diet Oese Impired glycemic control Low BCAA Low AA FGF21 EE FGF21 FGF21 cute phse chronic phse rpid weight loss stle weight food intke EE food intke FGF Time Post-Intervention (weeks) Len Glucose tolernt Insulin sensitive C 217 The Authors. The Journl of Physiology C 217 The Physiologicl Society