Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
|
|
|
- Maude Gilbert
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, shmkp-3, shfoxo1 at MOI 5. For RNA extraction, cells were incubated in William s E medium containing.5% SA, 1 μm dexamethasone and 1 mm 8-bromo-cAMP for 8 hr forty-eight hours post infection. For glucose production, cells were incubated in William s E medium containing.5% SA, 1 μm dexamethasone and 1 mm 8-bromocAMP for 5 hr forty-eight hours post infection, then incubated in.5 ml/well of phenol red-free, glucose-free DMEM containing 1μM dexamethasone, 2 mm pyruvate, 2 mm lactate and 1mM 8-bromo-cAMP for 3h. Medium was collected and subjected to glucose measurement. The glucose output rate was normalized by cellular protein content. Immunolocalization Fao cells were infected with adenoviruses expressing a control protein (an inactive kinase) or MKP-3. Twenty-four hours post infection, cells were transfected with GFP- FOXO1 expression plasmid. Forty-eight hours after infection, cells were incubated in serum-free RPMI 164 medium in the presence of Veh, 1μM Dex or 1μM Dex plus 1ng/ml insulin overnight. Next day, cells were incubated in serum-free and glucosefree DMEM medium supplemented with 2mM sodium pyruvate and 2mM sodium lactate for another three hours in the presence of veh, Dex or Dex plus insulin. Cells were 39
2 then fixed in 5% PS-buffered formalin for 1 minutes and examined for FOXO1 localization. Mouse model To study the regulation of MKP-3 protein by hormones, glucagon was injected into lean mice fasted for 3 hours at the dose of 1mg/kg i.p. and livers were collected 1, 5 and 2 hours post injection; insulin was injected into lean mice fasted for 6 hours at the dose of.5u/kg, and livers were collected 1, 5 and 2 hours post injection. Male ob/ob mice were purchased from The Jackson Laboratory at 7 weeks of age and fed on a chow diet with 5% calories derived from fat. After one week of acclimation, ob/ob mice were randomized into two groups with equal body weight and postprandial blood glucose levels. Adenoviruses expressing shgfp or shmkp-3 were injected at the dose of 3x1 9 pfu/mouse via tail vein. Mice were sacrificed in fasted condition for plasma and tissue collection. 4
3 Saline 1h Glucagon 1h Saline 1h Insulin 1h Saline 5h Glucagon 5h Saline 5h Insulin 5h Saline 2h Glucagon 2h Saline 2h Insulin 2h MKP-3/Tubulin Saline Glucagon h 5h 2h MKP-3/Tubulin Saline Insulin h 5h 2h Supplemental Figure 1. Regulation of MKP-3 protein by glucagon and insulin. A. Effect of glucagon on expression of MKP-3 protein in the liver of lean mice (n=4 each group).. Effect Of insulin on expression of MKP-3 protein in the liver of lean mice (n=3-4 each group). P<.5, hormone treated group vs. saline treated group.
4 MKP-3 mrna C E G6Pase 1 Glucose (nm/mg protein) Dex GFP MKP GFP MKP GFP MKP-3 GFP MKP GFP MKP-3 GFP MKP-3 PEPCK D PGC-1α GFP MKP-3 GFP MKP GFP MKP-3 GFP MKP-3 Supplemental Figure 2. MKP-3 overexpression in rat primary hepatocytes. A-E. MKP-3 overexpression in rat primary hepatocytes. MKP-3 is overexpressed in rat primary hepatocytes through adenovirus-mediated gene transfer. Expression of MKP-3 (A), PEPCK (), G6Pase (C), and PGC-1α (D) genes as well as glucose output (E) was measured. P<.5, bar 2 vs.1; 4 vs. 3. P<.5, bar 3 vs. 1.
5 FAS PEPCK VLCAD PDK PGC-1a G6Pase shgfp shmkp3 shgfp shmkp3 shgfp shmkp3 shgfp shmkp3 PS Dex PS Dex Supplemental Figure 3. Gene expression analysis in DIO mice with reduced hepatic MKP-3 expression. FAS was measured in fed state and the rest genes were measured in fasted state. P<.5, mice injected with Ad-shGFP vs. mice injected with Ad-shMKP-3.
6 Relative MKP-3 mrna Ob/ob, shgfp Ob/ob, shmkp-3 MKP-3 Tubulin ob/ob shgfp ob/ob shmkp-3 C ody weight (gram) Ob/ob, shgfp Ob/ob, shmkp-3 Glucose (mg/dl) Ob/ob, shgfp Ob/ob, shmkp-3 Supplemental Figure 4. MKP-3 knockdown in the liver of ob/ob mice. Male ob/ob mice in C57L/6J background were injected with adenoviruses expressing either shgfp or shmkp-3 at the dose of 3x1 9 pfu/mouse. ody weight and blood glucose levels were measured in fasted state. Liver samples were collected on the same day in fasted state for determination of MKP-3 mrna and protein levels. A. Relative MKP-3 mrna level (n=6 each group);. MKP-3 protein expression (n=6 each group); C. ody weight and glucose levels (n=14-16 each group)., P<.5, mice injected with Ad-shGFP versus mice injected with Ad-shMKP-3.
7 C MKP-3 mrna G6Pase shgfp shmkp-3 shgfp shmkp shgfpshmkp-3 shgfpshmkp-3 PEPCK D PGC-1α shgfpshmkp-3 shgfpshmkp shgfpshmkp-3 shgfpshmkp-3 E Glucose (nm/mg.protein) shgfpshmkp-3 shgfp shmkp-3 Supplemental Figure 5. MKP-3 knockdown in rat primary hepatocytes. MKP-3 is knocked down in rat primary hepatocytes through adenovirusmediated expression of a short hairpin interfering RNA against MKP-3. Expression of MKP-3 (A), PEPCK (), G6Pase (C), and PGC-1α (D) genes as well as glucose (E) output was measured. Dex, Dexamethasone. P<.5, bar 2 vs.1; 4 vs. 3. P<.5, bar 3 vs. 1.
8 C E Relative MKP-3 expression Relative PEPCK expression Relative FOXO1 expression D F Relative PGC-1α expression Relative G6Pase expression Glucose (μm/μg protein) GFP MKP shgfp shfoxo GFP MKP shgfp shfoxo Supplemental Figure 6. Effect of FOXO1 knockdown on MKP-3 stimulated glucose production. A. Relative MKP-3 mrna levels in rat primary hepatocytes infected with Ad-shGFP or Ad-shMKP-3 together with Ad-shScramble or Ad-shFOXO1; -E. Relative PGC-1α, PEPCK, G6Pase and FOXO1 mrna levels in the same cells as described in A; F. Glucose production in the same cells as described in A. P<.5.
9 Insulin GFP MKP Insulin GFP MKP MKP-3 IP: IR; WS: P-Tyr IP: IR; WS: IR IP: IRS-1; WS:P-Tyr IP: IRS-1; WS: IRS-1 p-akt Ser 473 Akt p-akt Thr 38 Akt Tubulin Control+Veh MKP3+Veh Control+Dex MKP3+Dex Control+Dex/Ins MKP3+Dex/Ins Supplemental Figure 7. Effect of MKP-3 on insulin signaling and FOXO1 nuclear translocation. A. Effect of MKP-3 over-expression on insulin signaling.. Effect of MKP-3 over-expression on FOXO1 nuclear translocation. Representative fluorescent photos of GFP-FOXO1 expressing cells under various conditions. Veh, Vehicle; Dex, dexamethasone; Ins, insulin.
10 Firefly/Renilla Vec CRTC MKP PEPCK-Luc Firefly/Renilla Vec CRTC MKP PEPCK-Luc Supplemental Figure 8. CRTC2 and MKP-3 on transcription of gluconeogenic genes. A. CRTC2 and MKP-3 do not have additive effect on transcription of PEPCK promoter.. CRTC2 and MKP-3 do not have additive effect on transcription of G6Pase promoter. P<.5 as indicated.
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state
Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,
Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?
7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
AN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012.
AN ABSTRACT OF THE DISSERTATION OF Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012. Title: Polyunsaturated Fatty Acid Synthesis and Type 2 Diabetes Complications Abstract
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han,, Domenico Accili, Alan R. Tall J Clin Invest. 2009;119(4):1029-1041. https://doi.org/10.1172/jci36523. Research
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
Identified proteins interacting with TMBIM1 by mass spectrometry
Supplementary Information Journal: Nature Medicine Article Title: Corresponding Author: A novel multivesicular body regulator TMBIM1 protects against non-alcoholic fatty liver disease in mice and monkeys
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
SREBPs suppress IRS-2-mediated insulin signalling in the liver
SREBPs suppress -mediated insulin signalling in the liver Tomohiro Ide 1,Hitoshi Shimano 2,,Naoya Yahagi 2,Takashi Matsuzaka 1,Masanori Nakakuki 1, Takashi Yamamoto 1,Yoshimi Nakagawa 2,Akimitsu Takahashi
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
Ginsenoside Rg1 Inhibits Glucagon-Induced Hepatic Gluconeogenesis through Akt-FoxO1 Interaction
Ivyspring International Publisher 4001 Theranostics Research Paper 2017; 7(16): 4001-4012. doi: 10.7150/thno.18788 Ginsenoside Rg1 Inhibits Glucagon-Induced Hepatic Gluconeogenesis through Akt-FoxO1 Interaction
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Jang, H; Lee, GY; Selby, CP; Lee, G; Jeon, YG; Lee, JH; Cheng, KY; Titchenell, P; Birnbaum, MJ; Xu, A; Sancar, A; Kim, JB
Title SREBPc- signalling represses hepatic glucose production by promoting FOXO degradation during refeeding Author(s) Jang, H; Lee, GY; Selby, CP; Lee, G; Jeon, YG; Lee, JH; Cheng, KY; Titchenell, P;
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways
![Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways](/thumbs/96/128474991.jpg "Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways")
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Data Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic
Regulation of Hepatic Gluconeogenesis by an ER-Bound Transcription Factor, CREBH
Cell Metabolism, Volume 11 Supplemental Information Regulation of Hepatic Gluconeogenesis by an ER-Bound Transcription Factor, CREBH Min-Woo Lee, Dipanjan Chanda, Jianqi Yang, Hyunhee Oh, Su Sung Kim,
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis
Supplementary Information Cryptochrome Mediates Circadian Regulation of camp Signalling and Hepatic Gluconeogenesis Eric E. Zhang 1,2*, Yi Liu 3,5*, Renaud Dentin 3, Pagkapol Y. Pongsawakul 1, Andrew C.
Last updated Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes
Last updated 2011-03-02 Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes Media Formulations A. Media for glycogen synthesis: Culture medium base: DMEM-Low (Mediatech/Cellgro
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Figures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
Insulin-inducible SMILE inhibits hepatic gluconeogenesis
Page 1 of 39 1 Insulin-inducible SMILE inhibits hepatic gluconeogenesis Running title: SMILE inhibits gluconeogenesis Ji-Min Lee 1*, Woo-Young Seo 2*, Hye-Sook Han 2, Kyoung-Jin Oh 2, Yong-Soo Lee 1, Don-Kyu
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Research article Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han, Chien-Ping Liang, Marit Westerterp, Takafumi Senokuchi, Carrie L. Welch, Qizhi Wang, Michihiro
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
Phospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
Body Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 26 February 2007 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" 5'4" Weight
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
Excessive intake of diets rich in fat results in the. Endoplasmic Reticulum Stress Promotes LIPIN2-Dependent Hepatic Insulin Resistance
ORIGINAL ARTICLE Endoplasmic Reticulum Stress Promotes LIPIN2-Dependent Hepatic Insulin Resistance Dongryeol Ryu, 1 Woo-Young Seo, 1 Young-Sil Yoon, 1 Yo-Na Kim, 2 Su Sung Kim, 2 Hye-Jin Kim, 2 Tae-Sik
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP1-FOXO1 INTERACTION
REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP-FOXO INTERACTION Yingjiang Zhou, Justin Lee, Candace M. Reno, Cheng Sun, Sang Won Park, Jason Chung, Jaemin Lee, Simon J. Fisher, Morris F. White, Sudha B.
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
PEPCK. The Regulation of Eukaryotic Gene Expression. Why choose PEPCK? PEPCK. PEPCK overexpression in muscle. The Supermouse.
PEPK The Regulation of Eukaryotic Gene Expression..using the example of PEPK This is an acronym for an enzyme PhosphoEnol Pyruvate arboxykinase This enzyme is NLY regulated by gene expression! No allosteric
Transcriptional coactivator NT-PGC-1a promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis
ORIGINAL RESEARCH Physiological Reports ISSN 2051-817X Transcriptional coactivator NT-PGC-1a promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis Ji Suk Chang, Hee-Jin Jun & Minsung
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Glucocorticoids, Metabolism and Metabolic Diseases
Glucocorticoids, Metabolism and Metabolic Diseases Alexandros Vegiopoulos, Stephan Herzig To cite this version: Alexandros Vegiopoulos, Stephan Herzig. Glucocorticoids, Metabolism and Metabolic Diseases.
Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
TITLE: Maintenance of Glucose Homeostasis through Acetylation of the Metabolic Transcriptional Coactivator PGC-1alpha
AD Award Number: W81XWH-06-1-0214 TITLE: Maintenance of Glucose Homeostasis through Acetylation of the Metabolic Transcriptional Coactivator PGC-1alpha PRINCIPAL INVESTIGATOR: Pere Puigserver, Ph.D. CONTRACTING
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Contents Materials and Methods Figs. S1 and S8 References and Notes
Özcan et al., p. 1 Science Supporting Online Material Endoplasmic Reticulum Stress Links Obesity, Insulin ction, and Type 2 Diabetes Umut Özcan, Qiong Cao, Erkan Yilmaz, nn-hwee Lee, Neal N. Iwakoshi,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling
Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling Russell A. Miller,, Benoit Viollet, Morris J. Birnbaum J Clin Invest. 2011;121(6):2518-2528.
Hepatic gluconeogenesis is essential for maintenance
ORIGINAL ARTICLE Yin Yang 1 Promotes Hepatic Gluconeogenesis Through Upregulation of Glucocorticoid Receptor Yan Lu, 1 Xuelian Xiong, 1 Xiaolin Wang, 1 Zhijian Zhang, 1 Jin Li, 1 Guojun Shi, 1 Jian Yang,