Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang

Transcription

1 Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with APA were recruited from the General Hospital of the Chinese People s Liberation Army (PLA) between December 2008 and March patients with APA were recruited from Tongji Hospital (Wuhan, China) between February 2002 and December Blood samples were available in 48 patients from the General Hospital of the Chinese PLA. The characteristics of patients from the two centers are shown in Supplemental Table 1. APA was diagnosed following previously described procedures (23). Briefly, first, all patients had hypertension, increased plasma aldosterone concentration(pac) (>17.4ng/dL) and increased ARR (>40ng/dL / ng/ml h). Second, all had positive results of subsequent confirmatory testing (captopril suppression test and intravenous saline loading test). Third, all patients received a computed tomography scan or adrenal venous sampling(avs) for differentiating PH subtypes. For AVS, we followed the same criteria as previously described. Adrenal vein cannulation was considered successful if the adrenal vein/inferior vena cava cortisol gradient was at least 2 and lateralization was determined when the aldosterone/cortisol ratio from one side was at least 4 times the ratio from the other side. Additionally glucocorticoid remediable aldosteronism was excluded in all patients using a long PCR technique as previously described. The medications considered to affect aldosterone and plasma renin activity (PRA) levels were withdrawn for at least 2 weeks before evaluation (while for spironolactone, at least 6 weeks before the evaluation). In the presence of severe or symptomatic hypertension, the workup was made under antihypertensive medications known to have little plasma renin and aldosterone influence on levels. Classically, calcium channel blockers, α-blockers and/or central-acting agents at low doses were used in such patients in the week preceding the workup. Potassium chloride was given to the patients in order to

2 maintain serum potassium levels at >3 mmol/l. The plasma aldosterone, angiotensin II and renin concentration was detected by radioimmunoassay kit (Beijing North Biotechnology Research institute, China). The plasma aldosterone concentration analyzed in the text refer to that detected in the supine position. Unilateral adrenalectomy was performed on each patient, and the diagnoses were surgically and histologically confirmed. All tumor samples appeared golden yellow, and were frozen in liquid nitrogen immediately after resection based on the specimen regulations of PLA General Hospital and Tongji Hospital. All blood samples were obtained from patients preoperatively. The six normal adrenal glands were obtained from patients receiving radical nephrectomy. All patients were followed up for the data of the blood pressure, potassium levels, plasma aldosterone levels and echocardiography parameters with a median time of 16 months (ranging from 4.6 to 51.2 months).. Cell culture and materials The H295R human adrenocortical cells (Cell Resource Center, Institute of Basic Medicine Sciences, Chinese Academy of Medal Sciences) were cultured in DMEM/high glucose medium (Hyclone USA), supplemented with 2.5% Nu Serum (BD Biosciences, USA), 1% ITS+1 (Sigma-Aldrich, USA) and 1% antibiotics. The HEK293 cells were cultured in DMEM/high glucose medium (Hyclone, USA) with 10% fetal calf serum (Gibco, USA). The culture temperature was 37 C under an atmosphere of 5% CO 2. Angiotensin-II (A-II) and the dye to detect membrane voltage, DiSBAC2, were purchased from Sigma-Aldrich. Plasmid construction and transient transfection The full-length cdna of KCNJ5, KCNJ3 and mutant KCNJ5 sequence was synthesized by GENEWIZ (Beijing, China), and subcloned into the pbabe-puro vector (kindly provided by Prof. Hai-liang Feng, Cell Resource Center, Chinese Academy of Medical Sciences) and pires2-egfp vector (Clontech, USA). Detection of membrane voltage, aldosterone production and gene expression Control pbabe-puro vector and pbabe-puro vector with KCNJ5-M1 and KCNJ5-M2 were transfected into HEK293 cells (kindly provided by Prof. Hai-liang Feng) with KCNJ3 respectively using

3 Lipofectamine 2000 to assess their effects on the membrane voltage. At 36 h after transfection, the medium was replaced with fresh DMEM/high glucose containing 0.1% fetal bovine serum with 5 µm DiSBAC 2 for membrane voltage detection. After incubation for the indicated times, the cells were washed using PBS buffer. Fluorescence was detected using an Olympus IX81 microscope. pires2-egfp vector with and without KCNJ5 sequence and its two mutant forms were transiently transfected into H295R cells using polyplus transfection reagent (Polyplus-transfection SA, USA) according to the manufacturer s instructions. Cells were harvested for 24 and 48 h after transfection to measure the mrna expression levels of CYP11B1 and CYP11B2, respectively. To assess the effects of KCNJ5 mutant sequences on basal and A-II-induced aldosterone secretion, cells were incubated for another 24 h in the absence and presence of 100 nm A-II after 24 h of transfection. The supernatants were then collected for aldosterone detection by radioimmunoassay kit (North Institute of Biological Technology, Beijing, China). Cell proliferation assay HEK293 Cells were seeded into 60 mm plates 24 hours prior to transfection. The cells were then transfected with plasmid as indicated above, after which cells/well were reseeded into 96-well plates and incubated at different time points(0h,24h,48h,72h,96h,120h). Then 20 ul of MTS (CellTiter 96 AQueous One Solution Reagent; Promega, Madison, WI) was added directly to the cultured wells, which were incubated for 2 hours. The absorbance at 490 nm was recorded with a 96-well plate reader. RNA Isolation, RT PCR and immunohistochemical staining The total RNA of tissues was extracted using a pure RNA rapid extraction kit (Aidlab Biotechnology, Beijing) according to the manufacturer s protocol, and reversely transcribed to cdna using a one-step RT-PCR kit (TransGen Biotech Co., Ltd., Beijing, China). The mrna expression was quantified using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with SYBR Green (TransGen Biotech Co., Ltd., Beijing, China). The relative mrna levels were normalized to glyceraldehyde-phosphate dehydrogenase (GAPDH) using the 2 -ΔΔCT method. The primer sequences are shown in Supplemental Table 1. The experiments were repeated thrice, and each sample was performed in triplicate.

4 Formalin-fixed, paraffin-embedded APA tissue sections were confirmed by hematoxylin-eosin staining and then were incubated overnight at 4 with rabbit anti-kcnj5 antibodies(1:200 dilution, Abcam) and goat anti-cyp11b2 antibodies(1:50 dilution, Santa Cruz).Secondary detection was carried out with anti-rabbit and anti-goat peroxidase polymer detection kit (Vector Laboratories). Images were acquired with an Olympus IX81 microscope (Olympus, Japan). The images of sections were taken at 100 magnification. Phenotype of index case The patient with both c.439 G>C and c ins CAACAACCA of KCNJ5 is a yellow female, born in She was found to have hypertension with a blood pressure of 180/120mmHg in 2003(28 years old) and began to feel palpitations and tiredness. She was first seen in the first hospital of Jilin university in 2008, where she was diagnosed with PA. She presented with a blood pressure ranging from 140/100 to 180/120 mmhg under medication and hypokalemia( serum potassium: 2.3 to 2.6 mmol/l under potassium supplementation). CT scanning of the adrenal gland showed a mass with the size of 2cm 3cm. Recumbent-upright test showd a slightly high level of serum aldosterone (17.88 and ng/ dl -1 ) and a suppressed plasma renin activity (<0.1 ug/l h). Both the intravenous saline loading test and captopril suppression test showed the plasma aldosterone concentration couldn t be suppressed under the normal range. The resected adenoma speciman showed a golden appearance with the size of cm. She recovered well postoperatively and both her blood pressure and serum potassium level have returned to normal range without medication. The patient with duplication mutation c.457_492dupg_g of KCNJ5 is also a yellow female, born in She had a history of hypertension since 1995 (32 years old) and her blood pressure fluctuated between 140/80 to 160/90 mmhg under medication. She was first seen in our hospital for limb weakness in 2012 and had severe hypertension (250/120mmHg) and hypokalemia (2.31 mmol/l). CT scaning showed a mass with the size of cm in the right adrenal gland. Recumbent-uprght test showed high level of serum aldosterone (37.15 and ng/ dl -1 ) and a suppressed plasma renin activity(0.1 and 0.1 ug/l h ). Enantone suppression test showed the plasma aldosterone concentration couldn t be suppressed under the normal range. The tumor specimen showed a golden face with the size of

5 cm. The patient s blood pressure and serum potassium also returned to normal without any medication postoperatively. The patient with V748I mutation of CACNA1D is a yellow male, born in He was first seen in our hospital in He had a history of hypertension of 12 years and his blood pressure could rise to as high as / mmhg. Under medication of calcium channel blockers his blood pressure fluctuated around / mmhg. He was found with hypokalemia (2.6 mmol/l) in medical examination one month ago. CT scaning showed a mass with the size of 1.4*1.7cm in the right side. Recumbent-upright test showed no aldosterone increase after recumbent posture (22.42 and ng/dl -1 ) and a suppressed plasma renin activity(<0.1 ug/l h). Enantone suppression test showed the plasma aldosterone concentration couldn t be suppressed under the normal range. The tumor specimen showed a golden face with the size of cm. The patient s blood pressure and serum potassium also returned to normal without any medication postoperatively. However, half a year ago, his blood pressure began to increase as high as 180/ /110 mmhg and was around 150/90 mmhg under calcium channel blocker recently. 2 months ago, CT scaning showed a mass in the left adrenal gland with the size of cm. The blood potassium level was in normal range. He is scheduled to undergone another operation at present. Supplemental table 1 Clinical and biochemical characteristics of patients from Beijing and Wuhan

6 Center No. Sex (M/F ) Age at diagnosis, y SBP, mmhg DBP, mmhg Aldosterone, ng/dl Preoperative plasma K+, mmol/l* Beijing 87 41/ ±7.9(87) 180(160,190)(87) 110(100,120)(87) 27.82±8.062(81) 2.993±0.4898(84) PLA hospital Wuhan 27 11/ ±9.6(27) 170(155,181)(22) 110(95,120)(22) 20.96±8.833(24) 3.357±0.6526(25) Tongji hospital P Values are represented with mean±sd unless otherwise specified. Non-symmetric data are represented median (interquartile range) *These data show the last K + concentration detected preoperatively. Supplemental table 2 Primer sequences Primer name Primer sequence KCNJ5-E21F GATGGTGTCTTTTTAACTCAAAGC KCNJ5-E21R GTGATGACTCGGAAGCCATAC KCNJ5-E22F CTTTCCTGTTCTCCATTGAGACC KCNJ5-E22R CTGAGGAGGACAAAGCGCC KCNJ5-E3F ATGCATGTAACTTCCGTTTCCC KCNJ5-E3R GCCAGTGACAGGAGGTCTTAG KCNJ5-Verification-F CTTCATTTGGTGGCTCATTGC KCNJ5-Verification-R GGGACTTGATGAGCTTGGC KCNJ5-cDNA -F GGATTATACTCCTCTTGGTCCAG KCNJ5-cDNA -R AGGAGGTCTTAGGGAGGCT KCNJ5-expression-F GGAGACTTACCTGATGAGAG KCNJ5-expression-R GCCTATGTGATATGGATGGA CYP11B1-expression-F GCCAGTTCCATTCAAGAG CYP11B1-expression-R CCAAGGTGACGATAATAGC CYP11B2-expression-F ATGGGAAAGGAATAAGGG CYP11B2-expression-R TGACTAGAGGAGTTGGAT ATP1A1-expression-F CATCCTTGAGTACACCTG ATP1A1-expression-R CTTCTAAGTTCTTCACTAAGC ATP2B3-expression-F CTGACCGATGACAACTTC ATP2B3-expression-R GAGAGTCCTGAGTAATGC CACNA1D-expression-F TGACACAGATTCAAGATATTG

7 CACNA1D-expression-R GAPDH-F GAPDH-R ATP1A1-1F ATP1A1-1R ATP1A1-2F ATP1A1-2R ATP1A1-3F ATP1A1-3R ATP1A1-4F ATP1A1-4R ATP2B3-1F ATP2B3-1R ATP2B3-2F ATP2B3-2R CACNA1D-1F CACNA1D-1R CACNA1D-2F CACNA1D-2R CACNA1D-3F CACNA1D-3R CACNA1D-4F CACNA1D-4R CACNA1D-5F CACNA1D-5R CACNA1D-6F CACNA1D-6R CACNA1D-7F CACNA1D-7R CACNA1D-8F CACNA1D-8R CACNA1D-9F CACNA1D-9R CACNA1D-10F CACNA1D-10R CACNA1D-11F CACNA1D-11R CAAGATCGTCTCAGTGAT AAGCTCATTTCCTGGTATGACA TCTTACTCCTTGGAGGCCATGT ATTATTCATGGAGGAATTTGCTAG AATCCATATGCTGAATTACAGAAC TTAGTCATCCTATGTAATTGTGTAAA AGCGGAAGAGTGTAACATTC TGACTCTATCGTTCATAAATGTTAA CTAAGAGATGAAGCCAAGGA ATGAAGTAAGTAATGAAGGACATG TAGCTGCTATCATGGAAGC CGTGTCCATACCTCTTCTTC ACATTGTGCAGATGCTGAA AGAGTGGTTTCAGACACAG ATTCAGGACACAAAGCACT TAGGAGCACTAACCTTCAG ACGGAATCTCACAGACAGA AGCTATAGATACGTAGATGTTTGG AACCATGATC CACAAAGCA TCTATCTCACATCCAGGCTT TCAGTAAATGTGCTGGTATATTG ACATGCCAACAGTGTATTCATA CCTTACATAAACCATTCAGCC ACACAGTAGAATACGTGGACA TCTCTCCAGCATTCCATGT ACTGTGAAAGGCAGCTTAA AACTACTACCACCACCATC AACCCACTCCTATGAGACCA AAAGCATCTCAGAGGACACATA GTCCTGCATGGGTGTTCTGA ACGAAGTGCTTTTCGGGGAA CACGCTAACTGTGCAGGGA TCAGCTCTGCCCAGAAGAG CCAATCTACAACCACCGCGT GACCAAGGGACAGAAGCCAA ACGGTTCTTCCTCACTGTCG CTTCAGCAGAGGCATTTGGCT Supplemental table 3 Clinical and biochemical correlates of KCNJ5 mutation for sex

8 Parameter Total Mutations No mutations P Patient number Males-No.(%) 52 40(76.9%) 12(23.1%) Females-No. (%) 62 46(74.2%) 16(25.8%) Age at diagnosis, y 38.9±8.3(114) 37.6±7.5(86) 43.0±9.4(28) Males 38.6±8.0(52) 37.3±8.0(40) 43.1±6.3(12) Females 39.2±8.6(62) 37.9±7.1(46) 42.9±11.4(16) Preoperative SBP, mmhg 170(160,190) 180(160,190)(85) 160(150,180)(24) Males 177±25(49) 180(163,198)(40) 150(140,165)(9) Females 170(160,189)(60) 170(160,190)(45) 170(153,180)(15) Preoperative DBP, mmhg 110(100,120)(109) 110(100,120)(85) 100(92,118)(24) Males 111(100,120)(49) 110(110,120)(40) 100(93,105)(9) Females 106±15(60) 106 ±13(45) 106±20(15) Preoperative potassium 3.00(2.64,3.39)(109) 2.90(2.60,3.19)(83) 3.52(3.11,3.87)(26) level, mmol/l Males 3.14±0.57(50) 3.06±0.53(40) 3.47±0.65(10) Females 3.02±0.53(59) 2.86±0.42(43) 3.46±0.55(16) < Preoperative plasma 23.5±7.1 (105) 25.1±6.8(80) 18.6±5.5(25) < aldosterone concentration, ng/dl Males 23.7±8.4(48) 26.1±7.4(38) 14.5±5.0(10) < Females 23.4±5.8(57) 24.1±6.2(42) 21.29±4.0(15) Adenoma size, mm 1.5(1.2,2.0)(105) 1.5(1.2,2.0)(82) 1.3(1.2,1.5)(23) Males 1.5±0.6(49) 1.5±0.6(38) 1.4±0.5(11) Females 1.6±0.5 (56) 1.7±0.5 (44) 1.4±0.3(12) Values are represented with mean±sd unless otherwise specified. SBP, systolic blood pressure; DBP, diastolic blood pressure. Non-symmetric data are represented median (interquartile range)

9 Supplemental figure 1 KCNJ5 and CYP11B2 immunohistochemistry. KCNJ5 staining was observed on the membrane of almost all cells in KCNJ5 non-mutant APA. While every type of KCNJ5 mutant APA showed increased staining of KCNJ5. Accordingly, CYP11B2 staining was also slightly strong in mutant APA compared with non-mutant APA.

10 Supplemental figure 2 Effect of KCNJ5-M1 and KCNJ5-M2 on the HEK293 cell membrane voltage and proliferation. For membrane voltage detection, HEK293 cells under microscopy and fluorescence analyses after cotransfection with wild-type or mutant KCNJ5 and KCNJ3 plasmid for 48 h. Fluorescence was stimulated under 488 nm. For proliferation assay, the absorbance at 490 nm was recorded with a 96-well plate reader. (A, B, C) HEK293 cells transfected with control, KCNJ5-M1, and KCNJ5-M2 plasmids under microscopy,respectively. (D, E, F) HEK293 cells transfected with control, KCNJ5-M1, and KCNJ5-M2 plasmids under fluorescence, respectively. Compared with control group, cells transfected with KCNJ5-M1 and

11 KCNJ5-M2 exhibited increased intensity of fluorescence in more HEK293 cells. (G) HEK293 cell proliferation assay. Compared with control group, cells transfected with KCNJ5-M1 and KCNJ3, KCNJ5-M2 and KCNJ3 respectively showed poor proliferation after seventy-two hours. While proliferation of cells transfected with wild-type KCNJ5 were not affected. Each experiment was performed in triplicate.