SITA 100 mg (n = 378)
|
|
- Oscar Montgomery
- 6 years ago
- Views:
Transcription
1 Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755) Glipizide 40 (11) 47 (12) 87 (12) Glipizide extended release 18 (5) 16 (4) 34 (5) Glyburide/glibenclamide 133 (35) 128 (34) 261 (35) Glimepiride 106 (28) 121 (32) 227 (30) Gliclazide 30 (8) 26 (7) 56 (7) Gliclazide modified release 50 (13) 37 (10) 87 (12) Glyburide micronized 0 2 (1) 2 (<1) Tolazamide 1 (<1) 0 1 (<1) Sulfonylurea daily dose at baseline, n (%) < Minimum daily dose required * 5 (1) 7 (2) 12 (2) Minimum daily dose required * 373 (99) 370 (98) 743 (98) Changed sulfonylurea dose, n (%) Unchanged 338 (89) 345 (92) 683 (90) Changed 40 (11) 32 (8) 72 (10) Decreased 33 (9) 31 (8) 64 (8) Increased 5 (1) 3 (1) 8 (1) Interrupted 4 (1) 0 4 (1) SITA, sitagliptin; CANA, canagliflozin. * Sulfonylurea minimum daily dose required at randomization is defined as: glipizide, 20 mg; glipizide extended release, 10 mg; glyburide/glibenclamide, 10 mg; glimepiride, 4 mg; gliclazide, 160 mg; gliclazide modified release, 60 mg; glyburide micronized, 6 mg. Only for subjects who had sulfonylurea dose change on at least 7 consecutive days.
2 Supplementary Table 2. Summary of Blood Pressure and Fasting Plasma Lipid Findings at Week 52 (LOCF). Parameter SITA 100 mg CANA 300 mg Systolic BP, n Mean ± SD baseline, mm Hg ± ± 13.2 LS mean ± SE change 0.9 ± ± 0.7 Difference vs SITA (95% CI) 5.9 ( 7.6, 4.2) * Diastolic BP, n Mean ± SD baseline, mm Hg 78.6 ± ± 7.8 LS mean ± SE change 0.3 ± ± 0.4 Difference vs SITA (95% CI) 2.7 ( 3.8, 1.7) Triglycerides, n Mean ± SD baseline, mmol/l (mg/dl) 1.9 ± 1.3 (168.2 ± 117.5) 2.1 ± 1.4 (182.7 ± 123.0) LS mean ± SE change, mmol/l (mg/dl) 0.06 ± 0.06 (5.7 ± 5.2) 0.03 ± 0.06 (2.4 ± 5.1) Median (IQR) percent change 4.8 ( 17.1, 33.0) 4.0 ( 26.8, 26.2) LS mean ± SE percent change 11.9 ± ± 2.8 Difference vs SITA (95% CI) 2.3 ( 9.8, 5.3) LDL-C, n Mean ± SD baseline, mmol/l (mg/dl) 2.5 ± 0.9 (96.3 ± 35.8) 2.6 ± 1.0 (101.1 ± 36.7) LS mean ± SE change, mmol/l (mg/dl) 0.01 ± 0.04 (0.4 ± 1.5) 0.16 ± 0.04 (6.3 ± 1.5) Median (IQR) percent change 1.3 ( 12.7, 16.7) 4.4 ( 9.9, 22.4) LS mean ± SE percent change 5.2 ± ± 1.8 Difference vs SITA (95% CI) 6.4 (1.7, 11.2) HDL-C, n Mean ± SD baseline, mmol/l (mg/dl) 1.2 ± 0.3 (45.7 ± 11.9) 1.2 ± 0.3 (45.6 ± 11.9) LS mean ± SE change, mmol/l (mg/dl) 0.01 ± 0.01 ( 0.5 ± 0.4) 0.07 ± 0.01 (2.9 ± 0.4) Median (IQR) percent change 1.7 ( 9.1, 9.2) 7.0 ( 2.7, 17.1) LS mean ± SE percent change 0.6 ± ± 0.9 Difference vs SITA (95% CI) 7.0 (4.6, 9.3) LDL-C/HDL-C, n Mean ± SD baseline 2.2 ± ± 0.9 LS mean ± SE change 0.03 ± ± 0.04 Median (IQR) percent change 0.6 ( 14.8, 20.1) 2.4 ( 17.6, 16.6) LS mean ± SE percent change 7.2 ± ± 2.0 Difference vs SITA (95% CI) 1.1 ( 6.3, 4.2) Non HDL-C, n
3 Mean ± SD baseline, mmol/l (mg/dl) 3.3 ± 1.0 (129.3 ± 40.2) 3.5 ± 1.1 (136.6 ± 41.2) LS mean ± SE change, mmol/l (mg/dl) 0.04 ± 0.05 (1.6 ± 1.8) 0.18 ± 0.04 (6.7 ± 1.7) Median (IQR) percent change 0.7 ( 10.1, 13.7) 2.7 ( 9.0, 16.1) LS mean ± SE percent change 4.0 ± ± 1.5 Difference vs SITA (95% CI) 3.9 (0.0, 7.7) LOCF, last observation carried forward; SITA, sitagliptin; CANA, canagliflozin; BP, blood pressure; SD, standard deviation; LS, least squares; SE, standard error; CI, confidence interval; IQR, interquartile range; LDL-C, low-density lipoprotein cholesterol; HDL-C, highdensity lipoprotein cholesterol; NS, not significant. * p<0.001 versus SITA. Statistical comparison versus SITA not pre-specified. p = NS versus SITA. Statistical comparison versus SITA not performed due to multiplicity control.
4 Supplementary Table 3. Summary of Changes in Indices of β-cell function at Week 52 (LOCF). Parameter SITA 100 mg (n = 378) CANA 300 mg (n = 377) HOMA2-%B, n Mean (SD) baseline 56.8 (35.1) 52.5 (30.1) LS mean change (SE) 9.0 (2.6) 21.6 (2.5) Difference vs SITA (95% CI) 12.6 (5.8, 19.3) Proinsulin/insulin ratio, n Mean (SD) baseline, pmol/miu 4.4 (2.5) 4.2 (2.6) LS mean change (SE) 0.2 (0.2) 0.6 (0.2) Difference vs SITA (95% CI) 0.4 ( 0.1, 0.9) Proinsulin/C-peptide ratio, n Mean (SD) baseline, pmol/nmol 46.0 (21.5) 46.9 (24.3) LS mean change (SE) 1.0 (1.4) 3.3 (1.2) Difference vs SITA (95% CI) 4.3 ( 7.7, 1.0) AUC C /AUC G ratio (0-3 h), n Mean (SD) baseline, pmol/mmol (54.1) (46.4) LS mean change (SE) 19.3 (4.2) 18.1 (3.9) Difference vs SITA (95% CI) 1.2 ( 12.2, 9.8) LOCF, last observation carried forward; SITA, sitagliptin; CANA, canagliflozin; HOMA, Homeostasis Model Assessment; SD, standard deviation; LS, least squares; SE, standard error; CI, confidence interval; AUC C, C-peptide area under the curve; AUC G, glucose area under the curve.
5 Supplementary Table 4. Summary of Laboratory Parameters at Baseline and Week 52. Parameter SITA 100 mg CANA 300 mg ALT, n Mean baseline, U/L (50.0) (38.1) Bilirubin, n Mean baseline, μmol/l BUN, n Mean baseline, mmol/l egfr, n Mean baseline, ml/min/1.73 m 2 Urate, n Mean baseline, μmol/l Hemoglobin, n Mean baseline, g/l (35.5) (25.2) (14.6) (18.3) (6.5) (40.1) (30.5) (11.6) (18.2) (6.2) SITA, sitagliptin; CANA, canagliflozin; ALT, alanine aminotransferase; SD, standard deviation; BUN, blood urea nitrogen; egfr, estimated glomerular filtration rate. Supplementary Figure 1. Change in A1C over time (Per-protocol). SITA, sitagliptin; CANA, canagliflozin; LS, least squares; SE, standard error; CI, confidence interval.
6 Supplementary Figure 2. Change in A1C from baseline to Week 52 by baseline A1C subgroup. * LS, least squares; SE, standard error; SITA, sitagliptin; CANA, canagliflozin. * A1C <8.0%: SITA 100 mg (n = 174), CANA 300 mg (n = 185); A1C 8.0 to <9.0%: SITA 100 mg (n = 122), CANA 300 mg (n = 125); A1C 9.0%: SITA 100 mg (n = 82), CANA 300 mg (n = 67).
Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures
Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationSerum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic
Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Serra AL, Poster D, Kistler AD, et al. Sirolimus and kidney
More informationSupplementary Table 1. Patient demographics and baseline characteristics (treated patients).
Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Placebo (n=188) 10 mg (n=186) 25 mg (n=189) Total (n=563) Gender, n (%) Male 75 (40) 97 (52) 84 (44) 256 (45)
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationClinical Trial Synopsis TL-OPI-518, NCT#
Clinical Trial Synopsis, NCT# 00225264 Title of Study: A Double-Blind, Randomized, Comparator-Controlled Study in Subjects With Type 2 Diabetes Mellitus Comparing the Effects of Pioglitazone HCl vs Glimepiride
More informationFigure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution
Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationPFIZER INC. THERAPEUTIC AREA AND FDA APPROVED INDICATIONS: See USPI.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. For publications based on this study, see associated bibliography.
More informationSupplementary Online Content
Supplementary Online Content Xu X, Qin X, Li Y, et al. Efficacy of folic acid therapy on the progression of chronic kidney disease: the Renal Substudy of the China Stroke Primary Prevention Trial. JAMA
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and
More informationSupplementary Online Content
Supplementary Online Content Afkarian M, Zelnick L, Hall YN, et al. Clinical manifestations of kidney disease among US adults with diabetes, 1988-2014. JAMA. doi:10.1001/jama.2016.10924 emethods efigure
More informationGALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS
GALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS Table of Contents List of authors pag 2 Supplemental figure I pag 3 Supplemental figure II pag 4 Supplemental
More informationSYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779)
TITLE OF THE STUDY / REPORT No. / DATE OF REPORT INVESTIGATORS / CENTERS AND COUNTRIES Clinical Study Report Protocol BC20779: Multicenter, double-blind, randomized, placebo-controlled, dose ranging phase
More informationElevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
More informationSUPPLEMENTARY DATA. Supplementary Table S1. Clinical characteristics of the study subjects.*
Supplementary Table S1. Clinical characteristics of the study subjects.* T2D ND n (F/M) 66 (21/45) 25 (7/18) Age (years) 61.8 ± 6.9 49.4 ± 7.3 # Body weight (kg) 95 ± 16 105 ± 13 # Body mass index (kg.
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationThe clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only.
The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only. Please note that the results reported in any single trial may not reflect the overall
More informationSYNOPSIS 2/198 CSR_BDY-EFC5825-EN-E02. Name of company: TABULAR FORMAT (For National Authority Use only)
SYNOPSIS Title of the study: A randomized, double-blind, placebo-controlled, parallel-group, fixed-dose (rimonabant 20 mg) multicenter study of long-term glycemic control with rimonabant in treatment-naïve
More informationTable S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
More informationegfr > 50 (n = 13,916)
Saxagliptin and Cardiovascular Risk in Patients with Type 2 Diabetes Mellitus and Moderate or Severe Renal Impairment: Observations from the SAVOR-TIMI 53 Trial Supplementary Table 1. Characteristics according
More informationBariatric Surgery versus Intensive Medical Therapy for Diabetes 3-Year Outcomes
The new england journal of medicine original article Bariatric Surgery versus Intensive Medical for Diabetes 3-Year Outcomes Philip R. Schauer, M.D., Deepak L. Bhatt, M.D., M.P.H., John P. Kirwan, Ph.D.,
More informationEffective and Safe Management of Patients With Type 2 Diabetes and Chronic Kidney Disease Using Sitagliptin
2013 춘계당뇨병학회 Effective and Safe Management of Patients With Type 2 Diabetes and Chronic Kidney Disease Using Sitagliptin Eun Seok Kang Yonsei University College of Medicine Severance Hospital Diabetes
More informationPFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PROPRIETARY DRUG NAME / GENERIC DRUG NAME: Caduet / Amlodipine
More informationStatistical Analysis Plan FINAL. DexComG4 (DexCom Corporation) CGMMDI GOLD-Study
1.0 Page 1 of 15 FINAL DexComG4 (DexCom Corporation) CGMMDI GOLD-Study monitoring (CGM) in individuals with type 1 diabetes treated 2016-07-07 Approvals Name/Title: Nils-Gunnar Pehrsson / Statistiska Konsultgruppen,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schauer PR, Kashyap SR, Wolski K, et al. Bariatric surgery
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Randomized Controlled Trial of to Increase Serum Bicarbonate in Chronic Kidney Disease Patients David A. Bushinsky a, Thomas Hostetter b, Gerrit Klaerner c, Yuri Stasiv c, Claire
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Solomon SD, Uno H, Lewis EF, et al. Erythropoietic response
More information(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects
Table 1. Distribution of baseline characteristics across tertiles of OPG adjusted for age and sex (n=6279). Continuous variables are reported as mean with 95% confidence interval and categorical values
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Baseline Patient Characteristics
Supplementary Table 1. Baseline Patient Characteristics Normally distributed data are presented as mean (±SD), data that were not of a normal distribution are presented as median (ICR). The baseline characteristics
More informationSupplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
More informationpulmonary artery vasoreactivity in patients with idiopathic pulmonary arterial hypertension
Supplementary material Jonas K, Magoń W, Waligóra M, et al. High density lipoprotein cholesterol levels and pulmonary artery vasoreactivity in patients with idiopathic pulmonary arterial hypertension Pol
More informationJARDIAMET. (empagliflozin and metformin hydrochloride) 5 mg/500 mg, 5 mg/850 mg, 5 mg/1000 mg, 12.5 mg/500 mg, 12.5 mg/850 mg, 12.
JARDIAMET (empagliflozin and metformin hydrochloride) 5 mg/500 mg, 5 mg/850 mg, 5 mg/1000 mg, 12.5 mg/500 mg, 12.5 mg/850 mg, 12.5 mg/1000 mg NAME OF THE MEDICINE JARDIAMET contains two oral antihyperglycaemic
More informationNewer Drugs in the Management of Type 2 Diabetes Mellitus
Newer Drugs in the Management of Type 2 Diabetes Mellitus Dr. C. Dinesh M. Naidu Professor of Pharmacology, Kamineni Institute of Medical Sciences, Narketpally. 1 Presentation Outline Introduction Pathogenesis
More informationErtugliflozin Compared with Glimepiride in Patients with Type 2 Diabetes Mellitus Inadequately Controlled on Metformin: The VERTIS SU Randomized Study
Diabetes Ther (2018) 9:193 207 https://doi.org/10.1007/s13300-017-0354-4 ORIGINAL RESEARCH Ertugliflozin Compared with Glimepiride in Patients with Type 2 Diabetes Mellitus Inadequately Controlled on Metformin:
More informationLab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.
Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationSUPPLEMENTARY DATA. Supplementary Figure 1. PubMed
Supplementary Figure 1. PubMed ((((((type 2 diabetes[title/abstract] OR type II diabetes[title/abstract] OR non-insulin diabetes[title/abstract]) AND (monounsaturated[title/abstract] OR polyunsaturated[title/abstract]
More informationPFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550
More informationEffects of Lowering LDL Cholesterol on Progression of Kidney Disease
Effects of Lowering LDL Cholesterol on Progression of Kidney Disease Richard Haynes, David Lewis, Jonathan Emberson, Christina Reith, Lawrence Agodoa, Alan Cass, Jonathan C. Craig, Dick de Zeeuw, Bo Feldt-Rasmussen,
More informationResearch Article The Effects of Simvastatin on Proteinuria and Renal Function in Patients with Chronic Kidney Disease
International Nephrology Volume 2015, Article ID 485839, 6 pages http://dx.doi.org/10.1155/2015/485839 Research Article The Effects of Simvastatin on Proteinuria and Renal Function in Patients with Chronic
More informationTable S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).
Table S1. Characteristics associated with frequency of nut (full entire sample; Nn=4,416). Daily nut Nn= 212 Weekly nut Nn= 487 Monthly nut Nn= 1,276 Infrequent or never nut Nn= 2,441 Sex; n (%) men 52
More informationLaboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes
Laboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes Age and Gender: Association with Analytes The following Age-Sex distribution slides all have a common format: Males on left,
More informationSupplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups
Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationSupplementary Online Content
Supplementary Online Content Engebretson SP, Hyman LG, Michalowicz BS, et al. The effect of nonsurgical periodontal therapy on hemoglobin A1c levels among persons with type 2 diabetes and chronic periodontitis:
More informationData Analysis Plan for assessing clinical efficacy and safety of ER niacin/laropiprant in the HPS2-THRIVE trial
Data Analysis Plan for assessing clinical efficacy and safety of ER niacin/laropiprant in the HPS2-THRIVE trial 1 Background This Data Analysis Plan describes the strategy, rationale and statistical methods
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationApplication of the Diabetes Algorithm to a Patient
Application of the Diabetes Algorithm to a Patient Apply knowledge gained from this activity to improve disease management and outcomes for patients with T2DM and obesity Note: The cases in this deck represent
More informationABFM Diabetes SAM Part 4
ABFM Diabetes SAM Part 4 37. A 55-year-old male with type 2 diabetes mellitus has a chronic history of reduced libido and erectile dysfunction. On examination you note hepatomegaly and mild testicular
More informationSupplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationOnline Appendix (JACC )
Beta blockers in Heart Failure Collaborative Group Online Appendix (JACC013117-0413) Heart rate, heart rhythm and prognostic effect of beta-blockers in heart failure: individual-patient data meta-analysis
More informationModule 2. Global Cardiovascular Risk Assessment and Reduction in Women with Hypertension
Module 2 Global Cardiovascular Risk Assessment and Reduction in Women with Hypertension 1 Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored,
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationDiabete: terapia nei pazienti a rischio cardiovascolare
Diabete: terapia nei pazienti a rischio cardiovascolare Giorgio Sesti Università Magna Graecia di Catanzaro Cardiovascular mortality in relation to diabetes mellitus and a prior MI: A Danish Population
More informationEfficacy/pharmacodynamics: 85 Safety: 89
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor/Company: Sanofi Drug substance:
More informationStudy No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationSoo LIM, MD, PHD Internal Medicine Seoul National University Bundang Hospital
Soo LIM, MD, PHD Internal Medicine Seoul National University Bundang Hospital Agenda Association between Cardiovascular Disease and Type 2 Diabetes Importance of HbA1c Management esp. High risk patients
More informationPatient enrolment details CKDOD registry
Patient enrolment details CKDOD registry Personal Information Date of enrolment D D Date of birth D D Gender Descent Height cm m History of smoking Y N U Date of first diagnosis of CKD D D Primary Cause
More informationSCIENTIFIC STUDY REPORT
PAGE 1 18-NOV-2016 SCIENTIFIC STUDY REPORT Study Title: Real-Life Effectiveness and Care Patterns of Diabetes Management The RECAP-DM Study 1 EXECUTIVE SUMMARY Introduction: Despite the well-established
More informationEfficacy and Safety of Canagliflozin Used in Conjunction with Sulfonylurea in Patients with Type 2 Diabetes Mellitus: A Randomized, Controlled Trial
Diabetes Ther (2015) 6:289 302 DOI 10.1007/s13300-015-0117-z ORIGINAL RESEARCH Efficacy and Safety of Canagliflozin Used in Conjunction with Sulfonylurea in Patients with Type 2 Diabetes Mellitus: A Randomized,
More informationCVD Prevention, Who to Consider
Continuing Professional Development 3rd annual McGill CME Cruise September 20 27, 2015 CVD Prevention, Who to Consider Dr. Guy Tremblay Excellence in Health Care and Lifelong Learning Global CV risk assessment..
More informationA factorial randomized trial of blood pressure lowering and intensive glucose control in 11,140 patients with type 2 diabetes
A factorial randomized trial of blood pressure lowering and intensive glucose control in 11,140 patients with type 2 diabetes Hypotheses: Among individuals with type 2 diabetes, the risks of major microvascular
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationKnow Your Number Aggregate Report Single Analysis Compared to National Averages
Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationSample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone
Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing
More informationEffects of Sodium-Glucose Cotransporter 2 Inhibitors on Metabolic Parameters in Patients With Type 2 Diabetes: A Chart-Based Analysis
Elmer ress Original Article J Clin Med Res. 2016;8(3):237-243 Effects of Sodium-Glucose Cotransporter 2 Inhibitors on Metabolic Parameters in Patients With Type 2 Diabetes: A Chart-Based Analysis Hisayuki
More informationABSTRACT ORIGINAL RESEARCH. Ichiro Nakamura. Hiroshi Maegawa. Kazuyuki Tobe. Satoshi Uno
Adv Ther (2019) 36:923 949 https://doi.org/10.1007/s12325-019-0895-1 ORIGINAL RESEARCH Safety and Effectiveness of Ipragliflozin for Type 2 Diabetes in Japan: 12-Month Interim Results of the STELLA-LONG
More informationTable 1 Baseline characteristics of 60 hemodialysis patients with atrial fibrillation and warfarin use
Table 1 Baseline characteristics of 60 hemodialysis patients with atrial fibrillation and warfarin use Baseline characteristics Users (n = 28) Non-users (n = 32) P value Age (years) 67.8 (9.4) 68.4 (8.5)
More informationMultiple Factors Should Be Considered When Setting a Glycemic Goal
Multiple Facts Should Be Considered When Setting a Glycemic Goal Patient attitude and expected treatment effts Risks potentially associated with hypoglycemia, other adverse events Disease duration Me stringent
More information(For National Authority Use Only) Name of Study Drug: to Part of Dossier:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115
More informationMEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.
MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As
More informationAuthor Correction to: Diabetes Ther https://doi.org/ /s
Diabetes Ther (2018) 9:613 621 https://doi.org/10.1007/s13300-018-0386-4 AUTHOR CORRECTIO Author Correction: Effectiveness and Safety of a ovel Care Model for the Management of Type 2 Diabetes at 1 Year:
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationSupplementary Online Content
Supplementary Online Content Leibowitz M, Karpati T, Cohen-Stavi CJ, et al. Association between achieved low-density lipoprotein levels and major adverse cardiac events in patients with stable ischemic
More informationMetabolic Syndrome and Chronic Kidney Disease
Metabolic Syndrome and Chronic Kidney Disease Definition of Metabolic Syndrome National Cholesterol Education Program (NCEP) Adult Treatment Panel (ATP) III Abdominal obesity, defined as a waist circumference
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More informationAddendum to Commission A14-12 (canagliflozin) 1
IQWiG Reports Commission No. A14-24 Addendum to Commission A14-12 (canagliflozin) 1 Addendum Commission:A14-24 Version: 1.0 Status: 4 August 2014 1 Translation of addendum A14-24 Addendum zum Auftrag A14-12
More informationCardiovascular Diabetology. Open Access ORIGINAL INVESTIGATION. C. R. L. Cardoso 1, N. C. Leite 1, C. B. M. Moram 2 and G. F.
https://doi.org/10.1186/s12933-018-0677-0 Cardiovascular Diabetology ORIGINAL INVESTIGATION Open Access Long term visit to visit glycemic variability as predictor of micro and macrovascular complications
More informationMipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
More informationJoslin Diabetes Center Joslin Diabetes Forum 2013: The Impact of Comorbidities on Glucose Control Scenario 2: Reduced Renal Function
Scenario 2: Reduced Renal Function 62 y.o. white man with type 2 diabetes for 18 years Hypertension and hypercholesterolemia Known proliferative retinopathy Current medications: Metformin 1000 mg bid Glyburide
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationFaculty Affiliation. Faculty Disclosures. Learning Objectives. Prevalence and Burden of Diabetes in the United States
Faculty Affiliation Combined Targeted Approaches for the Treatment of Type 2 Diabetes: The Role of the Kidney Mark Stolar, MD Associate Professor of Clinical Medicine Division of General Internal Medicine
More informationLEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME
LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME Diana A. Chirinos, Ronald Goldberg, Elias Querales-Mago, Miriam Gutt, Judith R. McCalla, Marc Gellman and Neil Schneiderman
More informationSupplementary Online Content
Supplementary Online Content Kavousi M, Leening MJG, Nanchen D, et al. Comparison of application of the ACC/AHA guidelines, Adult Treatment Panel III guidelines, and European Society of Cardiology guidelines
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationStatin therapy in patients with Mild to Moderate Coronary Stenosis by 64-slice Multidetector Coronary Computed Tomography
Statin therapy in patients with Mild to Moderate Coronary Stenosis by 64-slice Multidetector Coronary Computed Tomography Hyo Eun Park 1, Eun-Ju Chun 2, Sang-Il Choi 2, Soyeon Ahn 2, Hyung-Kwan Kim 3,
More informationDeprivation Study. The Freiburg Study
The Freiburg Study Deprivation Study Free Radicals Inflammation (hs-crp) Blood Pressure (Systolic, Diastolic) Blood Lipids (Cholesterol, Triglycerides) Energy Utilization (Heart Rate) Sugar Metabolism
More informationForm 8: Post Transplant Annual Followup
Page 1 of 8 Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Toggle Question Year/Info Print this Form t Started
More informationThe role of physical activity in the prevention and management of hypertension and obesity
The 1 st World Congress on Controversies in Obesity, Diabetes and Hypertension (CODHy) Berlin, October 26-29 2005 The role of physical activity in the prevention and management of hypertension and obesity
More information2.0 Synopsis. Choline fenofibrate capsules (ABT-335) M Clinical Study Report R&D/06/772. (For National Authority Use Only) Name of Study Drug:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: Choline Fenofibrate (335) Name of Active Ingredient:
More informationAppendix This appendix was part of the submitted manuscript and has been peer reviewed. It is posted as supplied by the authors.
Appendix This appendix was part of the submitted manuscript and has been peer reviewed. It is posted as supplied by the authors. Appendix to: Banks E, Crouch SR, Korda RJ, et al. Absolute risk of cardiovascular
More informationClinical research. A b s t r a c t. Introduction
Clinical research Differences in metabolic parameters and cardiovascular risk between American Diabetes Association and World Health Organization definition of impaired fasting glucose in European Caucasian
More informationSupplementary Online Content
Supplementary Online Content Pedersen SB, Langsted A, Nordestgaard BG. Nonfasting mild-to-moderate hypertriglyceridemia and risk of acute pancreatitis. JAMA Intern Med. Published online November 7, 2016.
More informationEffective Health Care
Number 8 Effective Health Care Comparative Effectiveness and Safety of Oral Diabetes Medications for Adults With Type 2 Diabetes Executive Summary Background Type 2 diabetes is characterized by insulin
More information