INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

Size: px
Start display at page:

Download "INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells"

Transcription

1 Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology, May 2007 Type 1 (insulin-dependent) diabetes millitus Monocyte chemoattractant protein (MCP- 1) The circulating renin angiotensin system (RAS) Type 1 (insulin-dependent) diabetes millitus Type 1 diabetes develops as a consequence of autoimmunity, leading to beta cell destruction The early stages of insulitis cytokines Monocyte chemoattractant protein (MCP- 1) a protein from the chemotactic cytokines ( C-C chemokine) subfamily is expressed in human and rodent islets macrophages T-cells free radicals MCP-1 attracts monocytes, T-cells, and natural killer cells to the site of inflammation beta cell dysfunction and death play a role in the clinical outcome of islet allografts in type 1 diabetic patients high MCP-1 is negatively correlated with successful engraftment and long-lasting g insulin independence Transgenic mice expressing MCP-1 under control of the insulin promoter develop an intense insulitis The circulating renin angiotensin system (RAS) angiotensinogen critical Zn 2+ -dependent metallopeptidase angiotensin nsin I (AngI) angiotensin I-converting enzyme (ACE) the bioactive octapeptide AngII multiple G-protein-coupled receptor subtypes including AngII receptor 1 and 2 (AT1R, AT2R) 1

2 AngII PLC-β NF-kB γ α ß AT1R R R T T P K K P MAPK expression of proinflammatory genes such as MCP-1 Gene expression Hypothesis AngII may contribute to islet inflammation through induction of MCP-1 in the islets and beta cells MAPK=The mitogen-activated protein (MAP) kinases Cell culture -RINm5F insulinoma cell line -grown at 37 o C under a humidified -5% CO 2 atmosphere in RPMI 1640 medium -supplemented with -10% fetal bovine serum -2 mm glutamine -100 units/ml of penicillin -100 μg/ml of streptomycin -2.5 μg/ml of amphotericin B Cell culture Serum free media RINm5F AII 10-6 mol/l overnight AII 10-8 mol/l AII 10-7 mol/l 3 & 6 hrs IL-1β 0.1 ng/ml cells and media were harvested : MCP-1 & GAPDH = Reverse Transcription Polymerase Chain Reaction GAPDH= Glyceraldehyde 3-phosphate dehydrogenase RINm5F Cell Trizol reagent, DNase-digested RNAs Reverse Transcriptase cdnas EDAS 290 Electrophoresis semi-quantitative PCR Kodak Electrophoresis Documentation and Analysis System 290 (EDAS 290). AngII-induces MCP-1 mrna accumulation and secretion of MCP-1 in cultured beta cells MCP-1/GAPDH mr RNA (arbitrary units s) Cont. IL-1ß AII h 6h 2

3 To examine whether the increase in MCP-1 mrna levels in response to AngII is associated with MCP-1 production IL-1β 0.1 ng/ml AII 10-7 mol/l 6 & 12 hrs MCP-1 protein levels in the media rat-specific MCP-1 ELISA kit AngII-induces MCP-1 mrna accumulation and secretion of MCP-1 in cultured beta cells l (ng/ml) MCP-1 protein level ELISA -AngII - is a potent stimulator of MCP-1 expression -induced MCP-1 accumulation rapidly in the pancreatic islets and with significant magnitude -In beta cells, AngII (10-7 mol/l) significant induction of MCP-1 mrna and protein levels AngII-induced MCP-1 mrna expression in RINm5F cells is blocked by AT1R antagonist Losartan PD hr 3 hrs AngII 10-7 mol/l Losartan AngII 10-7 mol/l AngII 10-7 mol/l PD AT1R blocker=losartan and the AT2R blocker= PD To determine the receptor that mediates the AngIIinduced MCP-1 gene expression in beta cells MCP-1/GAPDH mrna (arbitrary u nits) AngII Losartan PD MCP-1 GAPDH AngII induces MCP-1 promoter activity in RINm5F cells ORI luciferase expression vector pgl3 basic rat MCP-1 promoter -514(enh)luc TransFast reagent 24-well culture plates luciferase expression vector pgl3 basic pgfp vector (transfection control) 3

4 transfected cells AngII (10-7 mol/l) AngII induces MCP-1 promoter activity in RINm5F cells. 24 hrs 1 & 2 hrs luciferase activity in the cell lysates was measured Fold Inducti ion of Luciferase Activity P<0.05 control 1 hr P= hr -AT1R antagonist prevented the AngII-MCP-1 production -AngII addition to beta cells results in a concomitant increase in AT1R mrna expression -Assume that AngII itself could have a regulatory effect on AT1R in beta cells which could consequently contribute to AngII-MCP-1 induction -possible that AngII induces MCP-1 transcripts in the pancreatic islets and beta cells directly through acting on its promoter indirectly through AT1R upregulation -MCP-1 promoter was induced significantly as early as after 1 hour of stimulation. acute response to AngII -Further studies are required -analyze the AngII specific cis-elements on MCP-1 promoter -AngII-induced MCP-1 upregulation is mediated through NF-kB? To determine whether an increase in tyrosine phosphorylation induces MCP-1 mrna accumulation sodium orthovanadate 50 μm sodium orthovanadate 100 μm 3 hrs sodium orthovanadate 200 μm sodium orthovanadate = protein tyrosine phosphatase inhibitor 4

5 Result To determine the involvement of protein kinase in AngII-induced MCP-1 expression Genistein 60 μm mol/l MCP-1 /GADPH mrna (arbitrary unit ts) RINm5F cells 1 hr 3 hr genistein mol/l Genistein Sod.orthovanadate - 50µM 100µM 200µM RINm5F cells Genistein= specific tyrosine kinase inhibitor Result AngII-induced MCP-1 gene expression requires ERK1/2 MAP kinase activity RINm5F + mol/l 5 & 10 & 15 & 30 & 60 min NA MCP-1 /GADPH mrn (arbitrary units) Genistein protein Washing and lysed cells Western blot Protein isolation and Western blot analysis RINm5F cell modified RIPA lysis buffer protein incubate 4 o C overnight Protein gel loading buffer at 85 o C 5 min 10 % SDS-polyacrylamide slab gels transfered BCA protein assay reagent BCA =Bicinchoninic Acid primary antibody diluted in PBS/Tween 20 PVDF 5

6 Western blot analysis Western blot analysis anti-total and anti-phospho-p38 MAPK anti- total and anti-phospho-erk1/2mapk Substrate HRP Secondary Ab anti-total and anti phospho JNK/SAPK Primary Ab Proteins from beta cells treated with AngII Blot JNK/ SAPK =c-jun NH2-terminal protein kinase/ stress-activated protein kinases MAPK=The mitogen-activated protein (MAP) kinases Proteins from beta cells treated with AngII Blot -The protein bands were visualized with enhanced chemiluminescence reagents -analyzed and intensity quantified using EDAS 290 AngII-induced MCP-1 gene expression requires ERK1/2 MAP kinase activity AngII-induced MCP-1 gene expression requires ERK1/2 MAP kinase activity MEK1/2 selective inhibitor U µm mol/l mol/l U µm Western blot RINm5F MEK1/2 selective inhibitor U µm 10 min 3 hrs U µm mol/l U µm ERK =extracellular signal regulated kinase RINm5F MCP-1 /G GADPH mrna (arbitr rary units) Statistical analysis Figure 4.A,B: Data represent three independent experiments. *p < 0.05 vs. AngII treated cells using one-way repeated ANOVA with subsequent all pairwise comparison procedure by student t-test U µM U0126 =MEK1/2 selective inhibitor 30µM 30µM 6

7 -MAP kinases encoded by the extracellular signal regulated kinase (ERK) genes are a family of serine/threonine protein kinases -ERK referred to as p44 (ERK1), and p42 (ERK2) are activated by phosphorylation of threonine and tyrosine residues by MAP kinase kinase(mek) -Using U0126, a selective inhibitor for MEK activation -AngII-induced MCP-1 mrna occurs through a MEK-sensitive mechanism -Further studies -fully delineate the specific signaling pathway by which AngII ultimately modulates MCP-1 synthesis in the islets Mice NOD pancreatic AngII generating system expression correlates with hyperglycemia and progression to severe diabetes Female NOD pancreata (3 gr.) Female NOD mice ;n=5 1.prediabetic (2-4 wks) 2.diabetic FBG mg/dl (13-15 wks) 3.diabetic FBG >350 mg/dl (20-22 wks) ICR mice normoglycemic; n= wks wks wks : ACE mrna, GAPDH Clean Western blot : ACE protein Actin NOD pancreatic NOD pancreatic Western blot ACE protein/actin (arbitrary units) 2-4 wks wks wks ACE mrna/gapdh (arbitrary units) 2-4 wks wks wks 7

8 ICR mice pancreata (3 gr.) Clean Western blot ICR mice pancreata Western blot tin ACE protein/act arbitrary units 2-4 wks wks wks ICR mice pancreata ACE distribution in the diabetic pancreas and colocalization with MCP-1 in beta cells pancreata ACE mrna/ga APDH arbitrary un nit 2-4 wks wks wks Serial sections at 5 μm formaline fixed paraffin embedded tissue blocks stained -a goat polyclonal antibody against ACE -goat polyclonal antibody against human MCP-1 -antibodies against mouse insulin glucagon somatostatin -A vectastain universal elite ABC kit and diaminobenzedine i (DAB) chromogenic substrate -Insulin was visualize by alkaline phosphatase reaction (red) -DAB was used to visualize the rest of the islet hormones in addition to ACE and MCP-1 (brown) ACE distribution in the diabetic pancreas and colocalization with MCP-1 in beta cells. 8

9 Angiotensin II alone and in combination with IL-1β elicit an inflammatory response in the islets by stimulation of MCP-1 Islet cell normoglycemic female NOD mice clean digested in shaker-type water bath at 37 C culture in RPMI medium Islets cells AngII (10-7 -mol/l) IL-1ß ß (0.1 ng/ml) RPMI medium overnight 3 hrs AngII + IL- 1ß AngII+ losartan 100 μm /GAPDH MCP-1 / trary units) mrna (arbit IL-1ß(0.1 ng/ml) Losartan The first time the presence of an active AngII generating system in the pancreata of NOD mice - As early as 2 weeks of age ACE mrna and protein were detectable in the non diabetic pancreata -Development of insulitis and progression to hyperglycemia and beta cell destruction expression levels of ACE -suggesting that AngII generation is an active ongoing process with diabetes advancement -ACE is constitutively expressed in most of the islet cells, colocalizing with MCP-1 -suggesting an endogenous autocrine / paracrine interaction -Using of angiotensin blockade therapies could improve islet function and glucose intolerance in type 2 diabetes patients and in animal models 9

10 adding ACE inhibitors in vitro to the islets leads to their protection against glucotoxcitiy and oxidative stress AngII g itself affects the islet short-term insulin release the long-term effects of AngII on the islet functions are yet to be determined -The novel data about the role of the local pancreatic renin angiotensin system as a source of islet inflammation -suggest that targeting g AngII could be used as a novel therapeutic strategy to -reduce MCP-1 levels in the islets -inhibit beta cell directed immunity in type 1 diabetes This research showed that 1.AngII elicits an inflammatory response in the islets and beta cells by stimulation of MCP-1 production through h an AT1R-ERK1/2-dependent nt mechanism 2.hyperglycemia and progression to diabetes correlate with upregulation of ACE 10

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB

Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.

More information

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000 Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

MEK1 Assay Kit 1 Catalog # Lot # 16875

MEK1 Assay Kit 1 Catalog # Lot # 16875 MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

AMPK Phosphorylation Assay Kit

AMPK Phosphorylation Assay Kit AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle

More information

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae

More information

alveolar macrophages (AMs) after 24 hours of in vitro culture in complete medium

alveolar macrophages (AMs) after 24 hours of in vitro culture in complete medium Online Supplement for: NF-κB ACTIVATION IN ALVEOLAR MACROPHAGES REQUIRES IκB KINASE-β, BUT NOT NF-κB INDUCING KINASE Supershift and Competition Assays for NF-κB Competition and supershift assays were performed

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Supporting Information

Supporting Information Supporting Information Stegbauer et al. 10.1073/pnas.0903602106 SI Methods Analysis of Plasma Renin Activity (PRA) and ACE Activity. PRA and serum ACE activity levels were determined by RIA (RENCTK, DiaSorin;

More information

Cell Lysis Buffer. Catalog number: AR0103

Cell Lysis Buffer. Catalog number: AR0103 Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state

More information

Mammalian Tissue Protein Extraction Reagent

Mammalian Tissue Protein Extraction Reagent Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Protein MultiColor Stable, Low Range

Protein MultiColor Stable, Low Range Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary

ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU PhD THESIS Summary INVOLVEMENT OF ALARMIN HMGB1 IN INFLAMMATORY PROCESSES ASSOCIATED WITH VASCULAR DYSFUNCTION IN HYPERLIPIDEMIA

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,

More information

Phospholipase C γ Prof. Graham Carpenter

Phospholipase C γ Prof. Graham Carpenter Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular

More information

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats

Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Doctor of Philosophy

Doctor of Philosophy Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada

More information

20X Buffer (Tube1) 96-well microplate (12 strips) 1

20X Buffer (Tube1) 96-well microplate (12 strips) 1 PROTOCOL MitoProfile Rapid Microplate Assay Kit for PDH Activity and Quantity (Combines Kit MSP18 & MSP19) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MSP20 Rev.1 DESCRIPTION MitoProfile Rapid Microplate

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

Revision. camp pathway

Revision. camp pathway االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

MAPK Pathway

MAPK Pathway MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)

More information

β-cell Preservation and Regeneration After Islet Transplantation

β-cell Preservation and Regeneration After Islet Transplantation β-cell Preservation and Regeneration After Islet Transplantation Jyuhn-Huarng Juang, MD Division of Endocrinology and Metabolism, Department of Internal Medicine, Chang Gung University and Memorial Hospital,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

METHODS. mg/ml (or 222 mm) of nicotine). E-liquid was diluted in culture media to the concentrations outlined in the figures.

METHODS. mg/ml (or 222 mm) of nicotine). E-liquid was diluted in culture media to the concentrations outlined in the figures. Are E-Cigarettes a Safe Alternative to Smoking? Hayley Tartell Williams College The health effects of E-cigarettes, widely used alternatives to tobacco cigarettes, are not well known. The aim of this project

More information

Molecular mechanisms involved in HIV-1 Tat-mediated induction of IL-6 and IL-8 in astrocytes

Molecular mechanisms involved in HIV-1 Tat-mediated induction of IL-6 and IL-8 in astrocytes Nookala and Kumar Journal of Neuroinflammation (2014) 11:214 DOI 10.1186/s12974-014-0214-3 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Molecular mechanisms involved in HIV-1 Tat-mediated induction

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis

Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis 212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

Chapter 15: Signal transduction

Chapter 15: Signal transduction Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,

More information

Antibodies for Unfolded Protein Response

Antibodies for Unfolded Protein Response Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)

More information

Serum cytokine levels in control and tumor-bearing male and female mice at day 15.

Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*

More information

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Data Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic

More information

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit CATALOG NO: IRAAKT2552 LOT NO: SAMPLE INTENDED USE The Hydrogen Peroxide Fluorescent Detection Kit is designed to quantitatively measure H2O2 in

More information

Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences

Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine

More information