SUPPLEMENTARY INFORMATION
|
|
- Nathaniel Jenkins
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION doi: /nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood glucose for lean wt (n= 20), high fat diet (HFD) fed wt (n= 18) and db/db (n= 19) mice. c, Quantification of neutral lipid accumulation by oil red O (ORO) analysis on sections from skeletal (sk.) and cardiac muscles (n= 4/group). d-g, Relative mrna expression of Mitochondrial transcription factor A (d, Tfam), NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit 5 (e, Ndufa5), Vegfb (f) and Fatp3 (g), in skeletal and cardiac muscles (n= 4/group). N.s., non significant. #P<0.05, ##P<0.01, ###P<0.001 compared to lean mice. Values are means ± s.e.m. 1
2 RESEARCH SUPPLEMENTARY INFORMATION Supplemental Figure S2. HFD-fed Vegfb -/- mice retain normoglycemia despite increased body weight. Endpoint analysis of male wt (n= 18) and Vegfb -/- (n= 20) mice that were kept on a HFD for 12 weeks. a-c, Body weight (a), visceral fat pads mass (b) and blood glucose levels (c). *P<0.05 as compared to HFD-fed wt controls. Values are means ± s.e.m. 2
3 SUPPLEMENTARY INFORMATION RESEARCH Supplemental Figure S3. Male and female db/db//vegfb +/- and db/db//vegfb -/- mice have lower blood glucose levels than db/db mice, and retain weight gain. Analysis of db/db (n= 15 females, n= 10 males), db/db//vegfb +/- (n= 21 females, n= 11 males) and db/db//vegfb -/- (n= 12 females, n= 8 males) mice shown separately for both sexes. a-b, Postprandial blood glucose levels of female and male mice. c-d, Body weight separately shown for female and male mice. Statistical significance analyses are omitted for clarity in a-d. e-f, Mean change in body weight during the indicated time periods for female and male mice. **P<0.01, ***P<0.001 compared to db/db controls. Values are means ± s.e.m. 3
4 RESEARCH SUPPLEMENTARY INFORMATION Supplemental Figure S4. Genetic deletion of Vegfb does not influence food intake. a, Mean food intake per day in lean male wt (n= 13) and Vegfb -/- (n= 15) mice and HFD-fed male wt (n= 6) and Vegfb -/- (n= 5) mice. b, Mean food intake in male and female db/db (n= 3 males, n= 7 females), db/db//vegfb +/- (n= 3 males, n= 6 females) and db/db//vegfb -/- mice (n= 3 males, n= 7 females). Values are means ± s.e.m. Supplemental Figure S5. Muscular expression of Vegfb and Fatp3. a-b, mrna expression of Vegfb (a) and Fatp3 (b) in skeletal (sk.) muscle of db/db (n= 4), db/db//vegfb +/- (n= 4) and db/db//vegfb -/- (n= 5) mice, and in cardiac muscle of db/db (n= 6), db/db//vegfb +/- (n= 7) and db/db//vegfb -/- (n= 7) mice. *P<0.05, **P<0.01, ***P<0.001 as compared to db/db controls. Values are means ± s.e.m. 4
5 SUPPLEMENTARY INFORMATION RESEARCH Supplemental Figure S6. Genetic deletion of VEGF-B in diabetic db/db animals improves metabolic balance. a, Staining of neutral lipids by ORO on cardiac muscles from of lean, db/db, db/db//vegfb +/- and db/db//vegfb -/- mice (scale bar 100 µm). Quantification of stained lipids is shown in Fig. 1f. b, Mean cardiac [2-18F]-2- Fluoro-2-deoxy-D-glucose ([ 18 F]FDG) accumulation in db/db and db/db//vegfb -/- mice (n= 4/group) during 60 minutes of positron-emission tomography (PET) analyses. c, Relative hepatic mrna expression of Pck1, Phosphoenolpyruvate carboxykinase 1; G6pc, Glucose-6-phosphatase catalytic; Fasn, Fatty acid synthase; Srebf1, Sterol regulatory element binding transcription factor 1; Creb1, camp responsive element binding protein 1; Pgc1a, Peroxisome proliferator-activated receptor gamma, coactivator 1 alpha and Cpt1, Carnitine palmitoyltransferase 1a in lean (n= 6), db/db (n= 4), db/db//vegfb +/- (n= 8) and db/db//vegfb -/- (n= 8) mice. #/*P<0.05, ##/**P<0.01, ###/***P<0.001 compared to lean/db/db controls respectively. Values are means ± s.e.m. 5
6 RESEARCH SUPPLEMENTARY INFORMATION Supplemental Figure S7. Schematic illustration of the anti-vegf-b administration strategies and validation of the VEGF-B antibody. Analysis of control-treated or 2H10-treated pre-diabetic or diabetic db/db mice. a, Schematic illustration of the timing of the two antibody administration strategies in db/db mice described in this study. Pre-diabetic db/db mice had a starting blood glucose level <14mM, whereas the diabetic animals had blood glucose levels >14mM. b-c, Cardiac mrna expression of Fatp3 and Vegfb in pre-diabetic db/db mice (b, n= 7 controltreated, n= 4 2H10-treated) and diabetic db/db mice (c, n= 4/group) after treatment for 10 weeks. ***P<0.001 as compared to db/db controls. Values are means ± s.e.m 6
7 SUPPLEMENTARY INFORMATION RESEARCH Supplemental Figure S8. Pharmacological inhibition of VEGF-B signalling reduces muscular lipid accumulation. Analysis of control-treated or 2H10-treated pre-diabetic or diabetic db/db mice, as compared to lean mice. a-c, Representative images showing staining of neutral lipids with ORO on cardiac (a and c, scale bar 100 μm) and skeletal (b, scale bar 50 μm) muscles from pre-diabetic or diabetic db/db mice after 10 weeks of treatment. Quantifications of the ORO staining are shown in the main Fig. 3c-d. 7
8 RESEARCH SUPPLEMENTARY INFORMATION Supplemental Figure S9. Pharmacological inhibition of VEGF-B signalling enhances glucose tolerance and reduces circulating plasma NEFAs and ketones. Analysis of control-treated or 2H10-treated diabetic db/db mice, as compared to lean mice. a, Intraperitoneal glucose tolerance test (IPGTT) and area under curve (AUC) analysis of untreated lean (n= 6), control-treated (n= 3) or 2H10-treated (n= 3) diabetic db/db mice. b, Plasma levels of TGs (n= 17 lean, n= 3 control-treated, n= 3 2H10-treated), HDL-c and LDL-c (n= 3/group), NEFAs (n= 27 lean, n= 9 controltreated, n= 10 2H10-treated) and ketones (n= 16 lean, n= 9 control-treated, n= 8 2H10-treated). *P<0.05, ##/**P<0.01, ###/***P<0.001 compared to lean/db/db controls respectively. Values are means ± s.e.m 8
9 SUPPLEMENTARY INFORMATION RESEARCH Supplemental Figure S10. Pharmacological inhibition of VEGF-B signalling in HFD-fed rats enhances glucose tolerance and does not influence food consumption. Analysis of control-treated or 2H10-treated HFD-fed rats, as compared to control-treated normal diet (ND)-fed rats (n= 9/group). a-b, Blood glucose levels (a) and plasma insulin levels (b) during an IPGTT. The respective AUC analyses are shown to the right. c, Ratio of AUC-glucose to AUC-insulin values for the IPGTT. d, Mean food intake per day. #/*P<0.05, compared to ND-fed/HFD-fed rats respectively. Values are means ± s.e.m. 9
10 RESEARCH SUPPLEMENTARY INFORMATION Supplemental Figure S11. Inhibition of VEGF-B signalling improves pancreatic islet morphology but does not affect islet density. Analysis of pre-diabetic (n= 3 control-treated, n= 4 2H10-treated) or diabetic (n= 3/group) db/db mice, as compared to untreated lean mice (n= 7/group). a, Quantification of pancreatic islet density. b-c, Glucagon staining per pancreatic islet (b) and percentage of glucagon-secreting α- cells located within the core of the islets (c). #/*P<0.05, ##/**P<0.0, ###/***P<0.001 as compared to lean/db/db controls respectively. Values are means ± s.e.m. Supplemental Figure S12. Inhibition of VEGF-B signalling halters pancreatic islet apoptosis. Analysis of control-treated or 2H10-treated pre-diabetic or diabetic db/db mice, as compared to untreated lean mice. Representative images of pancreatic islets stained for insulin and cleaved caspase 3. Quantification of caspase 3 staining is shown in Fig. 4e. Scale bars, 100 µm. 10
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationExpanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationSupplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F
Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationFinal Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationPGC-1a Coordinates Mitochondrial Respiratory Capacity and Muscular Fatty Acid Uptake via Regulation of VEGF-B
Diabetes Volume 65, April 2016 861 Annika Mehlem, Isolde Palombo, Xun Wang, Carolina E. Hagberg, Ulf Eriksson, and Annelie Falkevall PGC-1a Coordinates Mitochondrial Respiratory Capacity and Muscular Fatty
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationImplications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss
GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction
More informationSupplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationDietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationInterleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationWeek 3 The Pancreas: Pancreatic ph buffering:
Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationDiabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More informationDiscussion & Conclusion
Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationMoh Tarek. Razi Kittaneh. Jaqen H ghar
14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationFigure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationDM, NAFLD, and conjugated linoleic acid (omega 6); what is the link
DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link Mona Hegazy Professor of Internal Medicine Hepatology Department Cairo University Egypt Agenda Congugated lionleic fatty acid NAFLD
More informationUpdate on GLP-1 Past Present Future
Update on GLP-1 p Past Present Future Effects of GLP-1: Glucose Metabolism and Nutritional Balance L-Cells: Glp-1 release Betacellfollowing ingestion Stress Increases satiety reduces appetite Betacell-
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationUniversity of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationExcessive fatty acid oxidation induces muscle atrophy in cancer cachexia
SUPPLEMENTARY INFORMATION Excessive fatty acid oxidation induces muscle atrophy in cancer cachexia Tomoya Fukawa, Benjamin Chua Yan-Jiang, Jason Chua Min-Wen, Elwin Tan Jun-Hao, Dan Huang, Chao-Nan Qian,
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationCornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
More informationANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism
ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES I. Glycolysis A. Pathway Regulation of glycolysis Hexokinase: Activated by glucose. Inhibited by G6P. 6-Phosphofructokinase: Inhibited by ATP, especially
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationLeptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
More informationInhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationMetabolic responses to leptin in obese db/db mice are strain dependent
Am J Physiol Regulatory Integrative Comp Physiol 281: R115 R132, 2001. Metabolic responses to leptin in obese db/db mice are strain dependent RUTH B. S. HARRIS, TIFFANY D. MITCHELL, XIAOLANG YAN, JACOB
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationSupplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
More informationPANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia
FEBS Letters 585 (2011) 1345 1349 journal homepage: www.febsletters.org PANDER KO mice on high-fat diet are glucose intolerant yet resistant to fasting hyperglycemia and hyperinsulinemia Claudia E. Robert-Cooperman
More information