The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
|
|
|
- Nathan Sherman
- 6 years ago
- Views:
Transcription
1 Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: ) GW464 CDCA Supplementary Figure S1. Chemical structures of GW464, CDCA and ivermectin. Schematic diagram of ivermectin displays a scaffold distinct from those of GW464 and CDCA, two known FXR ligands.
2 Relative Luciferase Activity DMSO GW464 control SRC1 NCoR ID2 Supplementary Figure S2. FXR recruited coregulators induced by ligands by mammalian two-hybrid assays. Cos7 cells were cotransfected with 2 ng of VP16-FXR LBD, 2 ng of Gal4-SRC1 ( ) or Gal4-NCoR ID2 (C-terminal residues ), together with 2 ng of pg5luc reporter. After transfection, cells were treated with.5 µm ivermectin or GW464. Cells were harvested 24 h later for the luciferase assays. Values are the means ± SEM of three independent experiments. p<.5, p<.1 compared with DMSO, as determined by Student s t test.
3 GW Photon counts ( 1,) No Peptide DAX1-1 DAX1-2 DAX1-3 SRC1-2 SRC1-3 SRC1-4 SRC2-2 SRC2-3 SRC3-3 PGC-1-1 PGC-1-2 PGC-1β-1 PGC-1β-2 TRAP22-1 SMRT-2 NCOR-2 Supplementary Figure S3. The recruitments of coregulator motifs by FXR are differentially regulated by ivermectin and GW464. Relative binding affinity of various coregulator peptide motifs to the FXR LBD/ivermectin and FXR LBD/GW464 complexes is determined by peptide competition assays, in which various unlabeled peptides (2 µm) are used to compete off the binding of the biotin-labeled SRC1-2 LXXLL motif to FXR LBD in response to.5 µm ivermectin or.5 µm GW464, respectively. Values are the means ± SEM of three independent experiments. Sequences of peptides used in the AlphaScreen assays are listed in Supplementary Table S3.
4 Relative Luciferase Activity 2 1 DMSO FXR PPAR PPAR PPAR PR GR RAR RAR PXR CAR ROR ROR ROR Supplementary Figure S4. Receptor-specific transactivation by ivermectin. Cos7 cells were cotransfected with pg5luc reporter together with the Gal4 DNA-binding domain fused with LBDs of various nuclear receptors. After transfection, cells were treated with DMSO or.5 M ivermectin. Cells were harvested 24 h later for the luciferase assays. Values are the means ± SEM of three independent experiments.
5 Relative Luciferase Activity Supplementary Figure S5. activated the transcriptional activity of FXR in different FXR response elements (RE). Different FXREs were synthesized and cloned into tk-luc vector. The sequences of FXRE1-4 are as follows: FXRE1, AGGTCA C TGACCT CG AGGTCA; FXRE2, AGGTCA T TGACCT TT; FXRE3, G AGGTCA A TGACCT TG AGGTCA TTG; FXRE4, TGACCT CN AGGTCA T TGACCT. COS-7 cells were cotransfected with plasmids encoding full-length FXR and FXRE1-4, respectively. After transfection, cells were treated with DMSO,.5 µm ivermectin or.5 µm GW464 for 18 h. Luciferase data were normalized to renilla activity cotransfected as an internal control. Values are the means ± SEM of three independent experiments.
6 A B F284H X A291W C D X L287T H447F X X E Coregulator Binding Activity (x1,) WT F284H WT DMSO GW464 F284H SRC1-2 NCoR-2 Supplementary Figure S6. Differential effects of FXR mutations on ligand binding. (A-D)In the structural models, FXR is in gray, ivermectin is in yellow and GW464 is in purple. The hydrophobic interactions and hydrogen bonds are shown with lines and arrows, respectively. The lost interactions by the mutations are marked with X. (E) The binding of coregulator motifs to FXR F284H mutant in response to.5 µm ivermectin by AlphaScreen assays. Values are the means ± SEM of three independent experiments. p<.5, p<.1 versus vehicle, as determined by Student s t test.
7 A 1 B AST(U/L) 6 4 ALT(U/L) Vehicle Vehicle C D 5 m 5 m Supplementary Figure S7. Liver injury evaluation of ivermectin on mice. Wild-type (WT) and FXR-/- (KO) mice were fed with high fat diet and i.p. injected with vehicle or ivermectin for 14 days (n=6 per group). The liver injury of ivermectin on mice were evaluated by analyzing the serum level of aspartate aminotransferase (AST) (A) and alanine aminotransferase (ALT) (B) using commercial kits (Biosino Bio-technology and science inc., Beijing, China). Values are the means ± SEM of six independent experiments. Liver histology characterization of mice injected with vehicle (C) or ivermectin (D) was analyzed by H&E staining which was performed on paraformaldehyde-fixed, paraffin-embedded sections by standard procedures.
8 25 Cholesterol (mg/dl) WT KO WT KO WT KO HDL LDL/VLDL Total Cholesterol Vehicle Supplementary Figure S8. lowered serum cholesterol levels including HDL and LDL/VLDL. Wild-type (WT) and FXR-/- (KO) mice were fed with high fat diet and i.p. injected with vehicle or ivermectin for 14 days (n=6 per group). After fasting for 6 h, mice were sacrificed and serum were collected. HDL cholesterol (HDL), LDL + VLDL cholesterol (LDL/VLDL) and total cholesterol serum levels were measured with the EnzyChrom AF HDL and LDL/VLDL Assay Kit (BioAssay Systems, Hayward, CA, USA). Error bars are SEM; p<.5, p<.1 compared with vehicle, as determined by Student s t test.
9 A 35 GTT Vehicle B 3 ITT Vehicle 3 25 Glucose (mg/dl) Glucose (mg/dl) Time (min) Time (min) Supplementary Figure S9. improved glucose tolerance and insulin sensitivity. Mice fed with high fat diet and treated with ivermectin or vehicle for 1 days were fasted for 6 h with free access to water. For the glucose tolerance test (GTT) (A), 1 g/kg of glucose was injected intraperitoneally and blood glucose was measured with the Accu-Check Performa (Roche Applied Science, Mannheim, Germany ) at, 3, 6, 9, 12 and 15 min. For the insulin tolerance test (ITT) (B), 1 U/kg of recombinant human insulin (Novolin 3R; Novo Nordisk, Bagsvaerd, Denmark) was injected intraperitoneally, and blood glucose was measured at, 3, 6, 9, 12 and 15 min after insulin injection. n=6 for each group. Error bars are SEM; p<.5, p<.1 compared with vehicle, as determined by Student s t test.
10 2.5 DMSO GW464 Relative mrna expression WT KO Supplementary Figure S1. mrna levels of L-PK regulated by ivermectin. mrna levels of L-PK in primary hepatocytes treated with DMSO, GW464 or ivermectin were quantified by real-time PCR and normalized to actin. Values are the means ± SEM of three independent experiments. p<.5 compared with vehicle, as determined by Student s t test.
11 Supplementary Table S1 Data collection and refinement statistics FXR/ Data collection Space group I Cell dimensions a, b, c (Å) 53.1, , ( ) 9., 9., 9. Resolution (Å) ( ) R sym or R merge.76(.615) I / I 3.7(2.6) Completeness (%) 92.(85.) Redundancy 7.5(6.6) Refinement Resolution (Å) No. reflections R work / R free 25.4/28.2 No. atoms Protein 346 Ligand/ion 124 Water 13 B-factors Protein 76.7 Ligand/ion 92.5 Water 47.2 R.m.s. deviations Bond lengths (Å).9 Bond angles ( ) 1.3 Values in parentheses are for highest-resolution shell.
12 Supplementary Table S2 The sequences of primers used in quantitative PCR. Genes Primer sequences Shp F: TGGGTCCCAAGGAGTATGC R: CAGTGATGTCAACGTCTCC Cyp7a1 F: CAAGAACCTGTACATGAGGGAC R: CACTTCTTCAGAGGCTGCTTTC BSEP F: GGGAGCAGTGGGTGTGGTAAAAG R: TCCTGGGAGACAATCCCAATGTT MDR2 F: GCAGCGAGAAACGGAACAG R: GGTTGCTGATGCTGCCTAGTT SR-BI F: CCTTCAATGACAACGACACCG R: CCATGCGACTTGTCAGGCT HMGCR F: AGCCGAAGCAGCACATGAT R: CTTGTGGAATGCCTTGTGATTG FDFT1 F: CATAACCAACACCCTACAGCACA R: TGCTTGCCCCTTCCGAA HMGCS F: GCCGTGAACTGGGTCGAA R: GCATATATAGCAATGTCTCCTGCAA LDLR F: GAGGAACTGGCGGCTGAA R: GTGCTGGATGGGGAGGTCT G6Pase F: ATGGAGGAAGGAATGAACA R: TGGGAAAGAGGACATAGAA PEPCK F: CTCACTGACTCGGCTTACG R: CCACTGAATGCAGACACTT L-PK F: ACCACCGCCAGTTGTTTGAG R: GGTCGGTAGCGAGACAGAAGC Actin F: CCAGCCTTCCTTCTTGGGTAT R: GTTGGCATAGAGGTCTTTACGG
13 Supplementary Table S3 The sequences of coregulator peptides used in the peptide competition profiling assays. Coregulator motifs Sequences DAX1-1 DAX1-2 DAX1-3 SRC1-2 SRC1-3 SRC1-4 SRC2-2 SRC2-3 SRC3-3 PGC-1-1 PGC-1-2 PGC-1β-1 PGC-1β-2 TRAP22-1 SMRT-2 NCoR-2 WQGSILYNMLMSA RQGSILYSMLTSA RQGSILYSLLTSS SLTERHKILHRLLQEGSP SKDHQLLRYLLDKDE AQQKSLLQQLLTE KHKILHRLLQDSS SLTERHKILHRLLQEGSP KENNALLRYLLDRDD AEEPSLLKKLLLAP PQRRPCSELLKYLTTNDD ELSLLQKLLLATS TEFSILRELLAQD VSQNPILTSLLQITG NMGLEAIIRKALMGKYDQ SFADPASNLGLEDIIRKALMGS
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR
Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR Yanqiao Zhang, 1,2 Lawrence W. Castellani, 2 Christopher J.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
supplementary information
DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa
SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
Supplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
SUPPLEMENTAL INFORMATION. Evolving Spindlin1 Small Molecule Inhibitors Using Protein Microarrays
SUPPLEMETAL IFRMATI Evolving Spindlin1 Small Molecule Inhibitors Using Protein Microarrays arkhyun Bae 1, Monica Viviano 2, Xiaonan Su 3, Jie Lu 4, Donghang Cheng 1, Cari Sagum 1, Sabrina Castellano 2,6,
Bile acid receptor FXR: metabolic regulator in the gut. Sungsoon Fang
Bile acid receptor FXR: metabolic regulator in the gut Sungsoon Fang Nuclear hormone receptor 1905: Ernest Starling coined hormone 1929: Estrogen structure 1958: Estrogen receptor by Elwood Jensen 1985:
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTARY INFORMATION
Glucose is a ligand for the oxysterol receptor LXR Supplementary Figure 1 Schematic representation of pathways influencing glucose fate in the liver. Glucose induces insulin secretion, suppressing hepatic
Chapter 3. Selective Estrogen Receptor Modulator and Antagonist Induced Transrepression of NF-kB Activity Mediated by Estrogen Receptor a.
Chapter 3 Selective Estrogen Receptor Modulator and Antagonist Induced Transrepression of NF-kB Activity Mediated by Estrogen Receptor a Submitted Chapter 3 Selective Estrogen Receptor Modulator and Antagonist
Supporting Information
Supporting Information Chlorinated Polyfluorinated Ether Sulfonates Exhibit Higher Activity towards Peroxisome Proliferator-Activated Receptors Signaling Pathways than Perfluorooctane Sulfonate Chuan-Hai
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Nuclear Receptor Monoclonal Antibodies
High affinity and specificity 研究用 Research www.funakoshi.co.jp Use Only Nuclear Receptor Monoclonal Antibodies All antibodies are validated by reactivity with proteins from full length cdna expressed in
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
Transcription Regulation and Gene Expression in Eukaryotes FS 08 Co-activators and Co-repressors
Transcription Regulation and Gene Expression in Eukaryotes FS 08 Co-activators and Co-repressors P. Matthias, April 02, 2008 Co-regulators: a separate class of transcription factors Do not bind to DNA
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/4/e1500980/dc1 Supplementary Materials for The crystal structure of human dopamine -hydroxylase at 2.9 Å resolution Trine V. Vendelboe, Pernille Harris, Yuguang
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature07422 SUPPLEMENTARY INFRMATIN K S(P) R S I M Q(L4) R M 7 6 Sp Q I K R 5 4 3 2 1 L(L0) L L S E 0 +1 +2 +3 Figure S1a Difference electron density (mfo DFc) for the peptide (Qpeptide),
Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
Supplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
TR2 Orphan Receptor Functions as Negative Modulator for Androgen Receptor in Prostate Cancer Cells PC-3
TheProstate57:129^133(2003) TR2 Orphan Receptor Functions as Negative Modulator for Androgen Receptor in Prostate Cancer Cells PC-3 Xiaomin Mu 1,2 and Chawnshang Chang 1,2 * 1 Department of Pathology,GeorgeWhipple
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Supplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA