SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized to Ad- RSV βgl ctivity. Averge from three independent experiments shown (P <.). B. Immunocytochemicl nlysis of endogenous nd α stining in primry heptocytes exposed to THA. Pre-tretment with CsA indicted. Scle r; µm.

2 doi:.8/nture8 S (gi6) Coverge: 6.% K.SSSVPPYLR.D R.NVGSDIAVLR.R K.EAQDTSDGIIQK.N R.NSGSELQVYYASPR.S K.AEPQPLSPASSSYSVSSPR.S G S T WT F F CBD F F F F GST pull-down 6 HA/ Input HA/ IP IgG % input - + HA/ Coomssie stining Supplementry Figure : A. Top, α peptide sequences recovered from immunoprecipittes of endogenous prepred from HEK9T cells. Percent coverge indicted. Bottom, immunolot showing recovery of HA-tgged α from IPs of endogenous prepred from HEK9T cells. B. Top, immunolot of HA-tgged α recovered from HEK9T lystes following pull-down ssy with recominnt GST- polypeptide frgments (F-F6). Amino cid endpoints for ech frgment indicted. Bottom, Coomssie stined gel showing GST- peptide frgments employed in GST pull down ssys.

3 doi:.8/nture8 S TCL Cyto M / N LDM PM HDM KDEL DAPI Merge IB: nti- IB: nti-kdel EEA DAPI Merge IB: nti-eea IB: nti-tgn6 TGN6 DAPI Merge IB: nti-cyto. C Cyto. C DAPI Merge IB: nti-tuulin IB: nti- c Trypsin (min) d KDEL DAPI Merge GRP9 Supplementry Figure : is peripherlly ssocited with the endoplsmic reticulum. A. Immunolots of sucellulr frctions prepred from CRL-89 slivry glnd cells. protein mounts in cytoplsmic (cyto), mitochondril nd nucler (M/N), high or low density microsoml (HDM, LDM) nd plsm memrne (PM) frctions reltive to totl cell lyste (TCL) shown. Co-frctiontion with ER (KDEL), endosoml (EEA), Golgi (TGN6), mitochondril (cyto C), nucler (), or cytoplsmic (tuulin) mrkers shown. B. Immunocytochemicl studies of CRL slivry glnd cells showing reltive colocliztion of with sucellulr mrkers in A. Scle rs: µm. C. Immunolot showing reltive protese sensitivity of nd ER-resident GRP9 proteins in ER-contining HDM frctions incuted with trypsin. D. Immunocytochemicl nlysis of cultured mouse primry heptocytes stined with nti- or ER specific nti-kdel ntiserum. Scle r: µm.

4 doi:.8/nture8 S X p- lu c c tiv it y Insulin- Insulin+ THA TUN lu y Xp- c ctivit 7 6 SIK SIKi THA TUN c lu y Xp- c ctivit N/ (S7A) (S7A) N THA TUN d Ad li Fsted Xp-luc Supplementry Figure : A. Effect of insulin (nm) on Xp-luc reporter ctivity in heptocytes. Cells were exposed to TUN, THA, or vehicle for 8 hours, followed y incution with insulin for hours. (P <.; P <.; n=). B. Effect of Adenovirl SIK over-expression or RNAi-medited knockdown on Xp-luc reporter ctivity in primry heptocytes exposed to THA or TUN s indicted. (P <.; P <.; n=). C. Ad-Xp luc reporter ctivity in heptocytes expressing ctive N nd phosphoryltion-defective, ctive Ser7Al. Exposure to THA or TUN indicted. (P <.; P <.; n=). D. Live imging nlysis of d liitum fed nd 6 hour fsted mice expressing denovirlly encoded Xp-luciferse reporter.

5 doi:.8/nture8 S Fsted Refed Xp-luc Fsted Refed Fsted Refed (p) Supplementry Figure : A. Live imging nlysis showing effect of IP TUN dministrtion on Xp- luc ctivity in 8 hour fsted compred to hour refed mice. B. Immunolot of, α, nd proteins in liver extrcts from fsted nd refed mice. S6 h Xp-luc h X p - l uc cti vi ty 7 6 Supplementry Figure 6: Live imging (left) nd quntittive nlysis (right, P< h h.; P <.; n=) of Xp- luc ctivity in mice or hours following IP dministrtion of tunicmycin or DMSO vehicle.

6 mrna levels doi:.8/nture8 S7 USi Xp-luc i X p -luc ctivity USi i THA TUN c USi i Xp d USi i TUN: (p) Xp Supplementry Figure 7: A. nd B. Effect of denovirlly encoded α RNAi on Xp-luc reporter ctivity in liver (A) nd primry heptocytes (B, P <.; P<.; n=) exposed to THA or TUN s indicted. C. Q-PCR nlysis of heptic Xp nd mrna mounts in control (USi) nd i expressing mice. D. Immunolot showing full-length nd proteolyticlly cleved (p) α s well s XBP proteins in heptic extrcts from mice depleted of α y RNAi-medited knockdown (i) reltive to controls following IP dministrtion of TUN or DMSO vehicle s indicted. 6

7 doi:.8/nture8 S8 TUN: HA/ TUN: USi i p S9 Supplementry Figure 8: Immunolots showing heptic protein mounts in mice injected with denoviruses encoding HA-tgged (A) or RNAi (B) s shown in figure (pnels C nd D). Intrperitonel (IP) dministrtion of TUN or control vehicle indicted. 7

8 doi:.8/nture8 S9 N N N FSK: c Reltive ChI P s ig nl (G6Pse) IP IgG % input 8 6 USi i p FSK- FSK+ (p) CRE - luc ctivity 8 N /N (S7A) (S7A)/N FSK- FSK+ S Supplementry Figure 9: α disrupts : dependent trnscription. A. Immunolot showing recovery of from IPs of prepred from nucler extrcts of primry heptocytes expressing denovirl N or green fluorescent protein () control. B. Effect of N expression on Ad-CRE luc ctivity in primry heptocytes co-expressing either wild-type or phosphoryltion-defective, ctive Ser7Al. Exposure to FSK indicted. (P <.; P <.; n=). C. ChIP ssy of primry heptocytes showing no effect of over-expression or RNAi medited depletion (i) on occupncy of phospho(ser) in cells exposed to FSK or DMSO vehicle (P <.; n=). USi, cells expressing with denovirlly encoded unspecific RNAi. 8

9 doi:.8/nture8 p S h: m: h : m : RRKKKEYVKCLENR RRKKKEYVKCLENR RKKKKEYMLGLEAR RKKKKEYMLGLEAR 7 VAVLE VAVLE LKA AL LKA AL Co n IgG R/ A WT IP R/ A WT Input R/A WT HA/ c T r ov y A F6 ec er..8. WT R/ A d X p- lu c c tiv it y WT R/A e CR E - l uc c t ivi ty 8 FSK- FSK+ WT R/A Supplementry Figure : Chrcteriztion of interction-defective mutnt protein. A. Alignment of nd α sequences in the ZIP domins, showing conservtion t Arg in nd Arg7 in humn α. B nd C. Co-immunoprecipittion ssy (B) nd densitometric nlysis (C) showing recovery of wild-type nd Arg7Al (R/A) mutnt α proteins from IPs of. D. nd E. Trnsient ssy of HEK9T cells showing reltive effects of wild-type α nd R/A mutnt α on Xp-luc (D) or CRE-luc (E) reporter ctivity in cells exposed to TUN or FSK s indicted (P<.; n=). 9

10 doi:.8/nture8 S X p -l u c c ti vi t y THA TUN C R E -l uc c t ivi ty N /N FSK- FSK+ S Supplementry Figure : ntgonizes α ctivity. A. nd B. Effect of denovirl over-expression on Xp-luc (A) nd CRE-luc (B) reporter ctivities in primry heptocytes exposed to ER stress ctivtors (TUN, THA; pnel A) or FSK (pnel B). Effect of in cells co-expressing N (B) indicted. (P<.; n=).

11 doi:.8/nture8 S TUN: (p) TUN: USi - + i - + (p) Supplementry Figure : Immunolots showing effect of denovirl α over-expression (A) or RNAi-medited depletion (B) on α protein mounts in fsted mice, s depicted in figure (pnels C nd D). Amounts of dephosphorylted ctive shown. Mice were nlyzed hours fter IP TUN or vehicle dministrtion.

12 Blood glucose (m g/ dl) doi:.8/nture8 S Len o/o Xp-luc CRE-luc Len o/o (p) p Xp-S Xp-U pjnk 6 Len o/ o d/d m R NA levels Len G6Pse PEPCK o/o d/d Supplementry Figure : Top left, live imging nlysis of Ad-Xp luc nd JNK JNK peif lph eif lph Ad-CRE luc ctivities in oese o/o mice reltive to len controls. Top right, immunolot of heptic extrcts from wild-type nd o/o mice showing mounts of full length nd cleved α (p) s well s other ER stress mrkers (Xp, phospho JNK, EIFlph (phospho nd totl)). Reltive mounts of nd lso shown. Bottom left, circulting glucose concentrtions (left) nd mrna mounts for gluconeogenic genes (right) in o/o, nd d/d mice reltive to len controls (P<.; P <.; n=8).

13 doi:.8/nture8 S Len N d/d N (p) Len N DIO N (p) S Supplementry Figure : Immunolots showing α (p), dephosphorylted, nd protein mounts in heptic extrcts from control () nd N over-expressing d/d (A) or high ft diet fed (B; DIO) mice reltive to len nimls under fsted conditions. Metolic effects of N over-expression shown in figure (Pnels B nd C).

14 Blood glucose (m g/ dl) Blood glucose (m g/ dl ) doi:.8/nture8 S Len N d/d N pjnk JNK pirs (Ser7) IRS pakt (Thr8) Akt Len N DIO N pjnk JNK pirs (Ser7) IRS pakt (Thr8) Akt c 7 6 Len/ Len/N d/d/ d/d/n 6 9 Time fter glucose (min) d Len/ Len/N DIO/ DIO/N 6 9 Time fter glucose (min) Supplementry Figure : Effect of heptic N expression on insulin signling nd glucose tolernce. A. nd B. Immunolot nlysis of liver extrcts from d/d (A) or high ft diet fed (B; DIO) mice reltive to len controls. Effect of denovirl N or control indicted. C. nd D. Glucose tolernce testing of len compred to d/d (C) or high ft diet fed (D) oese mice expressing denovirlly encoded N or control protein. Mice were injected IP with glucose ( g/kg ody weight), nd circulting lood glucose concentrtions were monitored s shown (P <.; P <.; n=).

15 doi:.8/nture8 Time fter glucose (min) Time fter glucose (min) S6 Fsting ER stress Oesity Gluconeogenesis Gluconeogenesis Gluconeogenesis ER qulity control ER qulity control ER qulity control NUCLEUS NUCLEUS NUCLEUS Supplementry Figure 6: Cross-tlk etween ER stress nd fsting pthwys t the level of trnscriptionl coctivtor. ER stress nd camp pthwys trigger dephosphoryltion nd nucler trnsloction of. ER stress stimultes the expression of ER qulity control genes y promoting the ssocition of with α, while fsting signls increse gluconeogenic gene expression y incresing the : interction. As consequence of its ility to ind to, α down-regultes the gluconeogenic progrm y interfering with the : interction. The cross-tlk etween these pthwys ppers criticl for glucose homeostsis ecuse reductions in heptic α protein mounts in oesity promote reciprocl increses in gluconeogenic gene expression nd in heptic glucose output.

* * * * * liver kidney ileum. Supplementary Fig.S1

* * * * * liver kidney ileum. Supplementary Fig.S1 Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.

More information

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized

More information

DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion

More information

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+

More information

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1

More information

TNF-α (pg/ml) IL-6 (ng/ml)

TNF-α (pg/ml) IL-6 (ng/ml) Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:

More information

Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome

Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does

More information

Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK

Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK 3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI

More information

Supplementary Figure 1

Supplementary Figure 1 Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION . Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,

More information

% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition

% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition % Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A

More information

Supplementary figure 1

Supplementary figure 1 Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22

More information

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd

More information

Cos7 (3TP) (K): TGFβ1(h): (K)

Cos7 (3TP) (K): TGFβ1(h): (K) IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity

More information

2018 American Diabetes Association. Published online at

2018 American Diabetes Association. Published online at Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION { OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril

More information

Molecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress

Molecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.

More information

PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis

PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet

More information

Two-step activation of FOXO3 by AMPK generates a coherent feed-forward loop determining excitotoxic cell fate

Two-step activation of FOXO3 by AMPK generates a coherent feed-forward loop determining excitotoxic cell fate (22), 2 & 22 Mcmilln Pulishers Limited All rights reserved 35947/2 www.nture.com/cdd Twostep ctivtion of FOXO3 y AMPK genertes coherent feedforwrd loop determining excitotoxic cell fte D Dvil, NMC Connolly

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity

More information

supplementary information

supplementary information DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development

More information

Supplementary Figure 1

Supplementary Figure 1 doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

Supplemental Materials

Supplemental Materials Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1849 neurotoxic insults cute synptic dysfunctions chronic cognitive deficits epigenetic lockde of gene trnscription e.g. Bdnf IV, synptophysin neurotoxic insults Aβ H 2 O 2 Cdk5/p25 P GR1

More information

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION % ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3

More information

Primers used for real time qpcr

Primers used for real time qpcr Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199

More information

Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2

Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2 Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section

More information

Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )

Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% ) Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion

More information

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient

More information

Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin

Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin Signling y promotes lterntive ctivtion of mcrophges to limit endotoxemi nd oesity-ssocited resistnce to insulin Nture Americ, Inc. All rights reserved. Jn Muer,9, Bhgirth Chursi,9, Juli Goldu, Merly C

More information

Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells

Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic

More information

Curcumin attenuates Nrf2 signaling defect, oxidative stress in muscle and glucose intolerance in high fat diet-fed mice

Curcumin attenuates Nrf2 signaling defect, oxidative stress in muscle and glucose intolerance in high fat diet-fed mice Online Sumissions: http://www.wjgnet.com/1948-938of fice wjd@wjgnet.com doi:239/wjd.v3.i.94 World J Dietes 212 My 1; 3(): 94-14 ISSN 1948-938 (online) 212 Bishideng. All rights reserved. ORIGINAL ARTICLE

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Informtion Supplementry Figure legends Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity purifiction. The hrored domins, their puttive cytologicl functions, nd

More information

Supplementary Information

Supplementary Information Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry

More information

Protein kinase Cδ regulates nuclear export of FOXO1 through phosphorylation of the chaperone ζ

Protein kinase Cδ regulates nuclear export of FOXO1 through phosphorylation of the chaperone ζ Dietologi (215) 58:2819 2831 DOI 1.17/s125-15-44-z ARTICLE Protein kinse Cδ regultes nucler export of through phosphoryltion of the chperone Felici Gerst 1,2 & Griele Kiser 1,2 & Mdhur Pnse 1 & Tin Srtorius

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE

More information

A. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5

A. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5 Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.

More information

RBP4 functions as a hepatokine in the regulation of glucose metabolism by the circadian clock in mice

RBP4 functions as a hepatokine in the regulation of glucose metabolism by the circadian clock in mice Dietologi () 59:5 DOI.7/s5-5-7- ARTICLE functions s heptokine in the regultion of glucose metolism y the circin clock in mice Xing M, & Zn Zhou, & Yqiong Chen & Yuting Wu & Yi Liu Receive: August 5 /Accepte:

More information

Heparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes

Heparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,

More information

The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages

The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages The endoplsmic reticulum is the site of cholesterol-induced cytotoxicity in mcrophges Bo Feng 1, Pin Mei Yo 1, Ynkun Li 1, Cecili M. Devlin 1, Djun Zhng 1, Hether P. Hrding 2, Michele Sweeney 3, Jmes X.

More information

Irs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling

Irs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris

More information

Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection

Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine

More information

11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None

11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison

More information

% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %

% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 % Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy

More information

Nuclear calcium signaling controls CREB-mediated gene expression triggered by synaptic activity

Nuclear calcium signaling controls CREB-mediated gene expression triggered by synaptic activity rticles Nucler clcium signling controls CREB-medited gene expression triggered y synptic ctivity Giles E. Hrdinghm, Fion J. L. Arnold nd Hilmr Bding MRC Lortory of Moleculr Biology, Hills Rod, Cmridge

More information

Calcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins

Calcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins Clcineurin imposes T cell unresponsiveness through trgeted proteolysis of signling proteins Vigo Heissmeyer, Fernndo Mcián,5, Sin-Hyeog Im,5, Rjt Vrm 2, Stefn Feske, K Venuprsd 3, Hu Gu 4, Yun-Ci Liu 3,

More information

Supplementary information

Supplementary information Supplementry informtion Unsturted liphtic lcohol s nturl lignd for mouse odornt receptor Keiichi Yoshikw, Hiroki Nkgw, Noki Mori, Hidenori Wtne nd Kzushige Touhr* Deprtment of Applied Biologicl Chemistry,

More information

DOI /mnfr

DOI /mnfr 3 Mol. Nutr. Food Res. 15, 59, 3 35 DOI 1.1/mnfr.1399 RESEARCH ARTICLE Ursolic cid improves lipid nd glucose metolism in high-ft-fed C57BL/6J mice y ctivting peroxisome prolifertor-ctivted receptor lph

More information

Gene regulation mediated by calcium signals in T lymphocytes

Gene regulation mediated by calcium signals in T lymphocytes Gene regultion medited y clcium signls in T lymphocytes Stefn Feske 1, Jen Giltnne 2, Ricrdo Dolmetsch 3, Louis M. Studt 2 nd Anjn Ro 1 Modultion of mny signling pthwys in ntigen-stimulted T nd B cells

More information

Connexin 30 sets synaptic strength. by controlling astroglial synapse invasion

Connexin 30 sets synaptic strength. by controlling astroglial synapse invasion Connexin 3 sets synptic strength y controlling stroglil synpse invsion Ulrike Pnnsch, Dominik Freche, Glenn Dllérc, Grégory Ghézli,, Crole Escrtin, Pscl Ezn, Mrtine Cohen-Slmon, Krim Benchenne, Veronic

More information

TLR7 induces anergy in human CD4 + T cells

TLR7 induces anergy in human CD4 + T cells TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Tble 1. Sttistics of dt sets nd structure refinement PYL1 po PYL2/ABA PYL2 po PYL2/ABA/HAB1 PDB code 3KAY 3KAZ 3KB0 3KB3 Dt collection APS bem line 21-ID 21-ID 21-ID 21-ID Spce group P6 5

More information

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2 Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry

More information

Vol 457 26 Ferury 29 oi:1.138/nture7617 Deficiency of -rrestin-2 signl complex contriutes to insulin resistnce Bing Lun 1, Jin Zho 1, Hiy Wu 3, Boyu Dun 1, Gungwen Shu 1, Xioying Wng 4, Dngsheng Li 2,

More information

Effects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle

Effects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes

More information

residual wild type band (Supplementary Fig. 5c) that may be explained by the presence of

residual wild type band (Supplementary Fig. 5c) that may be explained by the presence of doi:1.138/nture9387 Supplementry Text RANK deletion in tumors nd Cre effects. Southern lotting of the tumors tht developed in RANK mm femles showed deletion of RANK, leit we oserved some residul wild type

More information

Ndfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells

Ndfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher

More information

Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model

Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel

More information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal

More information

Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice

Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice nture pulishing group rticles intervention AND prevention Chromium Allevites Glucose Intolernce, Insulin Resistnce, nd Heptic ER Stress in Oese Mice Nir Sreejyn, Feng Dong, Mchender R. Knddi,2, Xioping

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nture73 Glucose SSP THF Methyl- THF Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA Cycle Glucose p53 p Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA

More information

Chow KD CR HFD. Fed Fast Refed

Chow KD CR HFD. Fed Fast Refed Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers

More information

SUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis

SUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song

More information

Arachidonic acid induces ERK activation via Src SH2 domain association with the epidermal growth factor receptor

Arachidonic acid induces ERK activation via Src SH2 domain association with the epidermal growth factor receptor http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology originl rticle Archidonic cid induces ERK ctivtion vi Src SH2 domin ssocition with the epiderml growth fctor receptor LD Alexnder

More information

CD160 inhibits activation of human CD4 + T cells through interaction with herpesvirus entry mediator

CD160 inhibits activation of human CD4 + T cells through interaction with herpesvirus entry mediator CD16 inhiits ctivtion of humn CD4 + T cells through interction with herpesvirus entry meditor Guifng Ci, Anuknth Anumnthn, Juli A Brown, Edwrd A Greenfield, Bogong Zhu & Gordon J Freemn CD16, glycosylphosphtidylinositol-nchored

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]

NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM] (A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl

More information

Background Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.

Background Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield. Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College

More information

Platelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection

Platelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection Vol 455 18 Septemer 28 doi:1.138/nture729 LETTERS Pltelet-derived growth fctor- receptor ctivtion is required for humn cytomeglovirus infection Lilin Sorocenu 1, Armin Akhvn 1 & Chrles S. Cos 1,2 Humn

More information

Synergistic effects of metformin, resveratrol, and hydroxymethylbutyrate on insulin sensitivity

Synergistic effects of metformin, resveratrol, and hydroxymethylbutyrate on insulin sensitivity Dietes, Metolic Syndrome nd Oesity: Trgets nd Therpy Open Access Full Text Article open ccess to scientific nd medicl reserch Originl Reserch Synergistic effects of metformin, resvertrol, nd hydroxymethylutyrte

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5

More information

SESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?

SESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator? SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte

More information

Supplementary Information

Supplementary Information Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information