Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
|
|
- Myrtle Sanders
- 5 years ago
- Views:
Transcription
1 Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90 Systolic blood pressure (mmhg) < 130 Diastolic blood pressure (mmhg) < 85 Fasting plasma glucose (mg/dl) < 110 Total cholesterol (mg/dl) < 220 Triglycerides (mg/dl) < 150 LDL cholesterol (mg/dl) < 140 HDL cholesterol (mg/dl) 40 AST (U/L) 40 ALT (U/L) 40 γ-gt (U/L) (Men) 70, (Women) 30 Uric acid (mg/dl) 7.0 Plasma creatinine (mg/dl) (Men) < 1.05, (Women) < 0.8 egfr (ml/min/1.73m 2 ) ACR (mg/g Cr) < 10 ACR, urinary albumin creatinine ratio; AST, aspartate aminotransferase; ALT, alanine aminotransferase; Cr, urinary creatinine; egfr, estimated glomerular filtration rate; γ-gt, γ-glutamyl transferase. Supplementary Table 2. Urinary markers in the normal control individuals C-megalin (fmol/g Cr) 145 (87-233) A-megalin (pmol/g Cr) 73 (35-106) Albumin (mg/g Cr) 5.2 ( ) NAG (IU/g Cr) 2.1 ( ) α 1 -microglobulin (mg/g Cr) 2.2 ( ) β 2 -microglobulin (μg/g Cr) 79 (61-102) Data are medians (interquartile range). Cr, urinary creatinine; NAG, N-acethyl-β-D-gulcosaminidase. Supplementary Table 3. Urinary A- and C-megalin levels in the normal control individuals and 68 patients with type 2 diabetes Normal control Type 2 diabetes individuals Normoalbuminuria Microalbuminuria Macroalbuminuria Number Urinary markers C-megalin (fmol/g Cr) 145 ( ) 330 ( ) 486 ( ) 1315 (765-2,575) A-megalin (pmol/g Cr) 73 (35-106) 115 (89-172) 122 (84-202) 63 (45-174) Albumin (mg/g Cr) 5.2 ( ) 7.4 ( ) 59.8 ( ) ( ,966.0) Data are median (interquartile range). Cr, urinary creatinine; Macroalbuminuria, >300 (mg/g Cr); microalbuminuria, (mg/g Cr); normoalbuminuria, <30 (mg/g Cr).
2 Supplementary Table 4. Characteristics of 52 patients with type 2 diabetes Number 52 RBC count ( 10 4 /mm 3 ) ± 49.3 Sex (% men) 61.5 Hemoglobin (g/dl) 13.8 ± 1.5 Age (years) 66.5 ± 10.9 Hematocrit (%) 41.5 ± 4.2 BMI (kg/m 2 ) 24.9 ± 5.5 MCV (fl) 93.1 ± 4.8 MCH (pg) 30.9 ± 1.6 MCHC (%) 33.2 ± 0.9 Clinical parameters WBC count (cell/μl) 6,115 ± 1,549 Systolic blood pressure Platelet count ( 10 4 /μl) 19.5 ± ± 15.0 (mmhg) Diastolic blood pressure Medications, % (n/n) 78.2 ± 9.8 (mmhg) Antihypertensive A1C (%) 6.9 ± 0.8 ACE inhibitors 29 (15/52) Total cholesterol (mg/dl) ± 30.1 ARBs 60 (31/52) Triglycerides (mg/dl) ± 54.1 Diuretics 13 (7/52) LDL cholesterol (mg/dl) ± 30.0 Others 50 (26/52) HDL cholesterol (mg/dl) 60.0 ± 26.7 Antihyperglycemic ALT (U/L) 27.5 ± 16.1 Insulin 10 (5/52) AST (U/L) 26.0 ± 7.3 Sulfonylurea 44 (23/52) γ-gt (U/L) 43.1 ± 65.2 Glinide 4 (2/52) Total protein (g/dl) 7.7 ± 0.4 Biguanide 27 (14/52) Creatinine kinase (U/L) ± 87.8 Thiazolidine 19 (10/52) α-gulucosidase inhibitor Lactate dehydrogenase (U/L) ± (29/52) Alkaline phosphatase (U/L) ± 75.5 Antidyslipidemic Cholinesterase (U/L) ± 76.1 Statins 31 (16/52) Blood urea nitrogen (mg/dl) 14.8 ± 4.6 Fibrates 4 (2/52) Plasma creatinine (mg/dl) 0.80 ± 0.21 egfr (ml/min/1.73m 2 ) 70.6 ± 14.6 Urinary markers Uric acid (mg/dl) 5.5 ± 1.3 C-megalin (fmol/g Cr) 502 ( ) Na (meq/l) ± 2.4 A-megalin (pmol/g Cr) 130 (87-178) K (meq/l) 4.3 ± 0.3 Albumin (mg/g Cr) 18.1 ( ) Cl (meq/l) ± 3.1 NAG (IU/g Cr) 7.6 ( ) Ca (mg/dl) 9.3 ± 0.4 α 1 -microglobulin (mg/g Cr) 6.2 ( ) Pi (mg/dl) 3.3 ± 0.5 β 2 -microglobulin (μg/g Cr) 113 (66-256) Data are mean ± SD or median (interquartile range). ALT, alanine aminotransferase; ARB, angiotensin II receptor blocker; AST, aspartate aminotransferase; Cr, urinary creatinine; egfr, estimated glomerular filtration rate; γ-gt, γ-glutamyl transferase; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; MCV, mean corpuscular volume; NAG, N-acethyl-β-Dgulcosaminidase; Pi, inorganic phosphate; RBC, red blood cell; WBC, white blood cell.
3 Supplementary Figure 1. Comparison of urinary megalin levels between first- and second-void urine specimens A and B: Urinary A- (A) and C-megalin (B) levels were measured in type 2 diabetic patients with normoalbuminuria (closed circles, n=10, urinary albumin<30 mg/g creatinine), microalbuminuria (open triangles, n=5, 30 mg/g urinary albumin<300 mg/g creatinine), and macroalbuminuria (closed triangles, n=4, 300 mg/g creatinine urinary albumin). C and D: Urinary A- (C) and C-megalin (D) levels were measured in first- (open bars) and second-void urine specimens (closed bars) of 3 patients with type 2 diabetes on the same day. Each specimen was analyzed three times. Key: Cr, urinary creatinine
4 Supplementary Figure 2. Stability of urinary megalin at 37 ºC for 12 hrs. Measurement of urinary A- (A) and C-megalin (B) concentrations were not changed in urine specimens obtained from 3 patients with type 2 diabetes before (open bars) and after incubation at 37 ºC for 12 hrs (closed bars). Each specimen was used for the measurements three times. Supplementary Figure 3. Measurement of urinary A- and C-megalin levels of urine specimens before and after storage at -80 ºC for 2-4 yrs. Urinary A- (A) and C-megalin concentration (B) in urine specimens obtained from patients with chronic kidney disease was consistent before (Pre) and after (Post) storage at -80 ºC for 2-4 yrs (n = 19).
5 Supplementary Figure 4. Immunoblot assay of normal human kidney lysates with monoclonal antibodies against human megalin. Normal human kidney lysates (15 µg/lane) were subjected to immunoblot assay with previously characterized polyclonal antibody against human megalin (1) (Reference 20) and monoclonal antibodies, A5 (2), A12 (3), C25 (4) and C37 (5) (100 ng/ml each) in the absence (-) or presence (+) (100-fold molar excess of each monoclonal antibody) of glutathione S- transferase (GST), GST-ligand-binding domain 1 (LBD1) or GST-cytoplasmic tail (CT) proteins, showing the specificity of the monoclonal antibodies against megalin. Supplementary Figure 5. Megalin ELISA calibration standard curves (A): A-megalin ELISA; (B): C-megalin ELISA; (C): F-megalin ELISA Key: S/N ratio, signal/noise ratio (of the chemiluminescent relative light units)
6 Supplementary Figure 6. The ectodomain form of megalin is present in the soluble urine fraction but the full-length form is in both soluble and insoluble fractions. Original urine specimens (Ori) were separated into supernatants 1 (S1) and precipitants 1 (P1) by low-speed centrifugation, and the S1 were further separated into supernatants 2 (S2) and precipitants 2 (P2) by ultracentrifugation. A and B: Urine specimens from controls (n=10, open circles) and 11 patients with type 2 diabetes and normoalbuminuria (closed circles), microalbuminuria (open triangles), or macroalbuminuria (closed triangles) were subjected to A- (A) and C-megalin (B) assays. C and D: A- and C-megalin assays correlated stoichiometrically in P1 (C) and P2 (D) of urine samples from the controls (n=10) and the patients with type 2 diabetes (n=11). Key: Cr, urine creatinine
7 Supplementary Figure 7. Association between urinary C-megalin levels and egfr (<60 ml/min/1.73 m2) in patients with type 2 diabetes (n=21) Key: Cr, urinary creatinine; egfr, estimated glomerular filtration rate; rs, Spearman s rank-correlation coefficient (vs. 1/eGFR)
8 Supplementary Figure 8. The effect of albumin to A- and C-megalin ELISA in urine A and B: The recombinant megalin standard was added to a normoalbuminuric urine specimen and measured by A- (A) and C-megalin (B) ELISA with incrementally increased addition of human serum albumin (HSA). The final concentrations of the added standard were 100 (open bars), 200 (shaded bars) and 400 pmol/l (closed bars) for A-megalin ELISA (A) and 1 (open bars), 3 (shaded bars) and 11 pmol/l (closed bars) for C-megalin ELISA (B). Both A- and C-megalin ELISA measurements remained at ~85% of the control level (2), even at the maximum albumin concentration (7). 1, the original urine specimen with no addition of the recombinant standard. The albumin concentration was 5, 5, 71, 335, 947, 1,889 and 2,831 mg/g Cr for 1, 2, 3, 4, 5, 6 and 7, respectively. C and D: The recombinant megalin standard was added to 5 macroalbuminuric urine specimens and A- (C) and C-megalin (D) ELISA were carried out. The values were obtained by subtracting the endogenous A- (C) and C-megalin values (D) from the raw measurements for each urine specimen. Neither A- or C-megalin measurements were affected by different albumin concentrations in urine specimens. The final concentrations of the added standard were 34 (open bars), 140 (shaded bars) and 560 pmol/l (closed bars) for A-megalin ELISA (C) and 1.1 (open bars), 6.2 (shaded bars) and 63 pmol/l (closed bars) for C-megalin ELISA (D). Data are presented as mean ± SD (n = 3). Key: Cr, urinary creatinine.
Supplementary Online Content
Supplementary Online Content Afkarian M, Zelnick L, Hall YN, et al. Clinical manifestations of kidney disease among US adults with diabetes, 1988-2014. JAMA. doi:10.1001/jama.2016.10924 emethods efigure
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationSITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationSupplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures
Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationE#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationegfr > 50 (n = 13,916)
Saxagliptin and Cardiovascular Risk in Patients with Type 2 Diabetes Mellitus and Moderate or Severe Renal Impairment: Observations from the SAVOR-TIMI 53 Trial Supplementary Table 1. Characteristics according
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Serra AL, Poster D, Kistler AD, et al. Sirolimus and kidney
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationSupplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Solomon SD, Uno H, Lewis EF, et al. Erythropoietic response
More informationS150 KEEP Analytical Methods. American Journal of Kidney Diseases, Vol 55, No 3, Suppl 2, 2010:pp S150-S153
S150 KEEP 2009 Analytical Methods American Journal of Kidney Diseases, Vol 55, No 3, Suppl 2, 2010:pp S150-S153 S151 The Kidney Early Evaluation program (KEEP) is a free, communitybased health screening
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationSUPPLEMENTARY DATA. Supplementary Table S1. Clinical characteristics of the study subjects.*
Supplementary Table S1. Clinical characteristics of the study subjects.* T2D ND n (F/M) 66 (21/45) 25 (7/18) Age (years) 61.8 ± 6.9 49.4 ± 7.3 # Body weight (kg) 95 ± 16 105 ± 13 # Body mass index (kg.
More information1. Albuminuria an early sign of glomerular damage and renal disease. albuminuria
1. Albuminuria an early sign of glomerular damage and renal disease albuminuria Cardio-renal continuum REGRESS Target organ damage Asymptomatic CKD New risk factors Atherosclerosis Target organ damage
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationSupporting Materials for a 31-Day Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects
Supporting Materials for a 31- Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects Brent L. Finley a, Kenneth M. Unice b, Brent D. Kerger c, Joanne M. Otani a, Dennis
More informationSupplementary Online Content
Supplementary Online Content Xu X, Qin X, Li Y, et al. Efficacy of folic acid therapy on the progression of chronic kidney disease: the Renal Substudy of the China Stroke Primary Prevention Trial. JAMA
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationResearch Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
More informationSupplementary Table 1. Patient demographics and baseline characteristics (treated patients).
Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Placebo (n=188) 10 mg (n=186) 25 mg (n=189) Total (n=563) Gender, n (%) Male 75 (40) 97 (52) 84 (44) 256 (45)
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Baseline Patient Characteristics
Supplementary Table 1. Baseline Patient Characteristics Normally distributed data are presented as mean (±SD), data that were not of a normal distribution are presented as median (ICR). The baseline characteristics
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationTABLE OF CONTENTS GENERAL INFORMATION... 1
BIOO RESEARCH PRODUCTS Glucose Assay Kit Manual Catalog #: 5611-01 BIOO Scientific Corp. 2011 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 1 Required Materials
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationPlease contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
More informationAnalytical Methods: the Kidney Early Evaluation Program (KEEP) The Kidney Early Evaluation program (KEEP) is a free, community based health
Analytical Methods: the Kidney Early Evaluation Program (KEEP) 2000 2006 Database Design and Study Participants The Kidney Early Evaluation program (KEEP) is a free, community based health screening program
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationEzetimibe Reduces Urinary Albumin Excretion in Hypercholesterolaemic Type 2 Diabetes Patients with Microalbuminuria
The Journal of International Medical Research 2012; 40: 798 803 Ezetimibe Reduces Urinary Albumin Excretion in Hypercholesterolaemic Type 2 Diabetes Patients with Microalbuminuria T NAKAMURA 1, E SATO
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationAppendix This appendix was part of the submitted manuscript and has been peer reviewed. It is posted as supplied by the authors.
Appendix This appendix was part of the submitted manuscript and has been peer reviewed. It is posted as supplied by the authors. Appendix to: Banks E, Crouch SR, Korda RJ, et al. Absolute risk of cardiovascular
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationLab Values Explained. working at full strength. Other possible causes of an elevated BUN include dehydration and heart failure.
Patient Education Lab Values Explained Common Tests to Help Diagnose Kidney Disease Lab work, urine samples and other tests may be given as you undergo diagnosis and treatment for renal failure. The test
More informationGALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS
GALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS Table of Contents List of authors pag 2 Supplemental figure I pag 3 Supplemental figure II pag 4 Supplemental
More informationData Analysis Plan for assessing clinical efficacy and safety of ER niacin/laropiprant in the HPS2-THRIVE trial
Data Analysis Plan for assessing clinical efficacy and safety of ER niacin/laropiprant in the HPS2-THRIVE trial 1 Background This Data Analysis Plan describes the strategy, rationale and statistical methods
More informationTrial to Reduce. Aranesp* Therapy. Cardiovascular Events with
Trial to Reduce Cardiovascular Events with Aranesp* Therapy John J.V. McMurray, Hajime Uno, Petr Jarolim, Akshay S. Desai, Dick de Zeeuw, Kai-Uwe Eckardt, Peter Ivanovich, Andrew S. Levey, Eldrin F. Lewis,
More informationSupplementary Online Content
Supplementary Online Content Nikolova AP, Hitzeman TC, Baum R, et al. Association of a novel diagnostic biomarker, the plasma cardiac bridging integrator 1 score, with heart failure with preserved ejection
More informationLaboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes
Laboratory Issues David Winsemius, MD, MPH Heritage Laboratories/HooperHolmes Age and Gender: Association with Analytes The following Age-Sex distribution slides all have a common format: Males on left,
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationRationale: Objectives: Indication: Diabetes Mellitus, Type 2 Study Investigators/Centers: 300 physicians in 292 clinics Research Methods: Data Source:
GSK Medicine: N/A Study No.: 112255 Title: A Korean, multi-center, nation-wide, cross-sectional, epidemiology study to identify prevalence of diabetic nephropathy in hypertensive patients with type 2 diabetes
More informationThe Diabetes Kidney Disease Connection Missouri Foundation for Health February 26, 2009
The Diabetes Kidney Disease Connection Missouri Foundation for Health February 26, 2009 Teresa Northcutt, RN BSN Primaris Program Manager, Prevention - CKD MO-09-01-CKD This material was prepared by Primaris,
More informationKidney and heart: dangerous liaisons. Luis M. RUILOPE (Madrid, Spain)
Kidney and heart: dangerous liaisons Luis M. RUILOPE (Madrid, Spain) Type 2 diabetes and renal disease: impact on cardiovascular outcomes The "heavyweights" of modifiable CVD risk factors Hypertension
More informationEffect of Saxagliptin on Renal Outcomes in the SAVOR TIMI- 53 study- Appendixes:
Effect of Saxagliptin on Renal Outcomes in the SAVOR TIMI- 53 study- Appendixes: Appendix Table 1: Number and % of patients at the saxagliptin and placebo arms, according to egfr and on treatment ACR groups
More informationRenal tubular secretion in chronic kidney disease: description, determinants, and outcomes. Astrid M Suchy-Dicey
Renal tubular secretion in chronic kidney disease: description, determinants, and outcomes Astrid M Suchy-Dicey A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor
More informationSupplementary Information for: Predictors of chronic kidney disease in type 1 diabetes: a longitudinal study from the AMD Annals initiative.
Supplementary Information for: Predictors of chronic kidney disease in type 1 diabetes: a longitudinal study from the AMD Annals initiative. Authors: Pamela Piscitelli 1, Francesca Viazzi 2 ; Paola Fioretto
More informationSYNOPSIS. Abbreviated Clinical Study Report. Study Code: RIMON_L_01031 Document Status: Synopsis V 2.1 Date: 16-Oct Title of the study:
SYNOPSIS Title of the study: Investigator(s): A 12-month multicentre, randomised, double-blind, placebo-controlled study with two parallel groups to assess the effects of rimonabant 20 mg in patients with
More informationDiabetes and Hypertension
Diabetes and Hypertension M.Nakhjvani,M.D Tehran University of Medical Sciences 20-8-96 Hypertension Common DM comorbidity Prevalence depends on diabetes type, age, BMI, ethnicity Major risk factor for
More informationBASELINE CHARACTERISTICS OF THE STUDY POPULATION
COMPARISON OF TREATING METABOLIC ACIDOSIS IN CKD STAGE 4 HYPERTENSIVE KIDNEY DISEASE WITH FRUITS & VEGETABLES OR SODIUM BICARBONATE This was a 1-year, single-center, prospective, randomized, interventional
More informationClinical Study Factors Associated with the Decline of Kidney Function Differ among egfr Strata in Subjects with Type 2 Diabetes Mellitus
International Endocrinology Volume 2012, Article ID 687867, 6 pages doi:10.1155/2012/687867 Clinical Study Factors Associated with the Decline of Kidney Function Differ among egfr Strata in Subjects with
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationLong-Term Care Updates
Long-Term Care Updates January 2016 By Yunuo (Enora) Wu, PharmD Chronic kidney disease (CKD) is defined as kidney damage (including structural or functional abnormalities) or glomerular filtration rate
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More informationManufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018
Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationCLINICAL CHEMISTRY REAGENTS. Product Profile
Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting
More informationComparison of Age of Onset and Frequency of Diabetic Complications in the Very Elderly Patients with Type 2 Diabetes
Original Article Endocrinol Metab 2016;31:416-423 http://dx.doi.org/10.3803/enm.2016.31.3.416 pissn 2093-596X eissn 2093-5978 Comparison of Age of Onset and Frequency of Diabetic Complications in the Very
More informationDuring the past two decades,
Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes
More informationPediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationTypes of target values, acceptable ranges
Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationSerum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic
Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li
More informationJ-DOIT3 The Japan Diabetes Optimal Integrated Treatment Study for 3 Major Risk Factors of Cardiovascular Diseases
J-DOIT3 The Japan Diabetes Optimal Integrated Treatment Study for 3 Major Risk Factors of Cardiovascular Diseases A randomized controlled study comparing intensive therapy and conventional therapy in the
More informationAspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf
More informationMetabolic Syndrome and Chronic Kidney Disease
Metabolic Syndrome and Chronic Kidney Disease Definition of Metabolic Syndrome National Cholesterol Education Program (NCEP) Adult Treatment Panel (ATP) III Abdominal obesity, defined as a waist circumference
More information