SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 SUPPLEMENTRY INFORMTION doi: /nature11808 NT Phen Met ICR Oligo FCCP pmpk tmpk Supplemental figure Primary hepatocytes were treated with 250 um Phenformin, 1 mm Metformin 250 um ICR, 100 nm Oligomycin, or 500 nm FCCP for 2 hours, and assayed for total and phospho T172 MPK () or treated with 5 nm glucagon for 15 minutes and subjected to assay for cmp (). 1

2 RESERCH SUPPLEMENTRY INFORMTION NT Glucagon C NT Glucagon NT Glucagon D 100 nm Glucagon (min) NT pmpk tmpk Supplemental Figure 2. -C. Primary hepatocytes isolated from fasted mice were plated in M199 media and treated with the indicated concentrations of metformin and pbs or 100 nm glucagon for 18 hours. Metabolites were extracted with perchloric acid and analyzed by HPLC. D. P rim a ry h e p a to cyte s p late d o ve rn ig h t in M m e d ia w e re tre ate d w ith nm g lu ca g o n for th e in d ica te d tim e s a n d e xtra cts w e re p ro b e d b y w e ste rn b lo t fo r th e p h o sp h o ryla tio n sta tu s of M P K. 2

3 SUPPLEMENTRY INFORMTION RESERCH Supplemental figure 3 FRET Ratio (FRET/CFP) Time post-glucagon (10 nm) 500 µm Phenformin No Phenformin CFP Pre-glucagon 200 sec. 600 sec sec. High FRET Low FRET Supplemental figure Primary hepatocytes were isolated and infected with adenovirus expressing the KR3 FRET-based activity probe.cells were treated with the indicated concentrations of phenformin for 2 hours and images were aquired starting 5 minutes before addition of 10 nm glucaogn.. Representative cells from untreated and phenformin treated cells, pseudocolored to reflect the FRET/CFP ratio.. The calculated FRET/CFP ratios from cytoplasmic ROI (one ROI per cell) for untreated, 250 um, and 500 um phenformin treated cells. W W W. N T U R E. C O M / N T U R E 3

4 RESERCH SUPPLEMENTRY INFORMTION MPK α1/α2 lox/lox 0 C Supplemental figure 4.. P rim a ry h e p a tocyte s w e re p la te d o ve rn ig h t in M m e d ia a n d tre ate d w ith p b s or IC R a n d stim u la te d w ith 5 n M g lu ca g o n for 1 5 m in ute s. E xtra cts w e re a ssa ye d fo r P K a ctivity (P K I-se nsitive k e m ptid e p h o sp h oryla tio n ).. P rim a ry h e p ato cyte s iso la te d fro m M P K α1 a n d α2 flo xe d m ice infe cte d w ith V -T G -C re o r V -T G -G F P 1 4 d a ys p rio r w e re tre ate d w ith th e in d ica te d IC R d o se for 2 h o u rs a n d stim u la te d w ith 5 n M g lu ca g o n for 1 5 m in u te s. c M P le ve ls w e re q u a ntifie d b y E L IS. C. P rim ary h e p a to cyte s w e re p la te d o ve rn ig h t in M m e d ia a n d tre a te d w ith µm IC R fo r 2 h o u rs a n d su b seq u en tly stim u la te d w ith 5 n M g lu ca g o n o r 5 0 µm F o rsk o lin for 1 5 m in ute s. c M P le ve ls w e re q u a ntifie d b y E L IS. 4

5 SUPPLEMENTRY INFORMTION RESERCH Supplemental figure 5.. Primary hepatocytes were incubated with 250 and 500 um phenformin for 2 hours and treated with the indicated glucagon concentrations. Western blots were performed, quantified and three representative blots are shown. 5

6 RESERCH SUPPLEMENTRY INFORMTION C PK-DN Phenformin Supplemental figure Primary hepatocytes were isolated, cultured for 18 hours in the presence or absence of 65 um phenformin and treated for 15 minutes with the indicated concentrations of glucagon () or the cell permeable PK agonist SP-8r-cMPS-M (). Western blots were performed for phospho and total PFKF1, CRE, and the IP3R. Three or more western blots were quantified. C. Primary hepatocytes isolated from mice infected with V-TG-PK-DN or V-TG-GFP control virus 7 days earlier were plated and treated for 1 hour with 250 um phenformin or PS and then subjected to a glucose production assay for 2 hours with 10 nm glucagon and 250 um phenformin. Data represents the mean of 3 of these experiments. 6

7 SUPPLEMENTRY INFORMTION RESERCH Supplemental figure 7.. Primary hepatocytes were incubated with 250 um Phenformin for 2 hours, with or without 20 um IMX, 20 um Cilostamide (PDE3i), or 50 um RO (PDE4i) for the final 30 minutes. Cells were treated with 5 nm glucagon for 15 minutes, lysed, and total cellular cmp assayed.. Primary hepatocytes were incubated with 250 um phenformin for 2 hours, treated wiht 5 nm glucagon or 20 um forskolin for 15 minutes, lysed, and total cellular cmp was assayed. 7

8 RESERCH SUPPLEMENTRY INFORMTION C Supplemental figure 8. Membranes from primary hepatocytes were isolated and assayed for adenylyl cyclase activity in the presence of the indicated concentrations of forskolin and glucagon. ll incubations included 100 um GTP.. C assays were performed at low (40 um) and high (500 um) TP concentrations in the presence of 300 um MP. ssays were stopped with PC before or after 10 minutes at 30 C. Nucleotides were quantified by HPLC. C. C assays were perfomed with 500 um TP in the presence or absence of 300 um MP. Nucleotides were separated by TLC and the radioactivity in the TP fraction was quantified in scintillation solution after removal from the TLC plates. 8

9 SUPPLEMENTRY INFORMTION RESERCH Glucagon Metformin ppk Substrates pmpk MPK pcc CC Supplemental figure 9.. Fed mice were fasted for 1 hour and gavaged with water or 500 mg/kg bw of metformin. One hour later mice were injected intraperitoneally with 2 mg/kg glucagon, and liver tissue was collected 5 minutes later. Western blot analysis was performed, examining reactivity to phospho-pk substrate antibodies, phosphorylated and total MPK, and phosphorylated and total CC.. 18 hour fasted mice were gavaged with 50 mg/kg metformin and 1 hour later blood glucose levels were measured. 9

10 RESERCH SUPPLEMENTRY INFORMTION C D Metformin + E pmpk tmpk ppfkf1 tpfkf1 pip3r tip3r pkt 473 tkt Supplemental figure 10.. Mice fed normal chow or high fat diet for 10 weeks were fasted overnight and blood glucose was tested., and the total hepatic MP levels were quantified. C-E. Mice fed high fat diet for 10 weeks were fasted overnight and gavaged with 250 mg/kg metformin. One hour later blood glucose was assayed (C) and livers were collected and assayed by western blots for total and phosphorylated MPK, PFKF1, IP3R, and KT (D). pkt/total KT is quantified (E). 10

11 SUPPLEMENTRY INFORMTION RESERCH Supplemental Figure 11 Proposed Model Metformin enters the cell and acts on the mitochondria, causing increased MP. Elevated cellular MP levels inhibit membrane bound denylyl Cyclase, causing a reduction in cellular cmp levels and decreased PK activation and target phosphorylation. 11

12 RESERCH SUPPLEMENTRY INFORMTION Supplemental Table 1 denine nucleotides in liver M P (m M ) D P (m M ) T P (m M ) M P / T P N C W ate r ± ± ± ±.0 8 N C M e tform in ± ± ± ±.2 4 H F D W ate r ± ± ± ±.0 5 H F D m etform in ± ± ± ±.0 9 N o rm a l ch o w (N C ) a n d hig h fa t d ie t fe d m ice (H F D ) w e re fa ste d 1 8 h o urs a n d g a va g e d w ith w a te r o r m g /kg m etfo rm in. 1 h o ur late r, live rs w e re co lle cte d, a n d a d en in e n u cle o tid e s w e re e xtra cte d a n d q u a ntifie d b y H P L C. M e a su re m e n ts (µm o le s/m g p rote in ) w e re co n ve rte d to co n ce ntratio n s b ase d o n p rote in re co ve ry a n d h e p a to cyte vo lu m e 2 4. de n o te s p< from w a te r co n tro l. 12

13 SUPPLEMENTRY INFORMTION RESERCH Supplemental Table 2 denine nucleotides in primary hepatocytes M P (µm ) D P (m M ) T P (m M ) M P / T P N T ± ± ± ± µm ± ± ± ± µm ± ± ± ± µm ± ± ± ± µm ± ± ± ± µm ± ± ±, ± P rim a ry h e p a tocyte s w e re iso la te d from fe d m ice a n d tre a te d w ith p h e nfo rm in for 2 h o u rs. d e n in e n u cle o tid e s w e re e xtra cte d a n d q u a n tified b y H P L C. C o n ce ntratio n va lu e s w e re ca lcu la te d a s in T a b le 1. T h e M P va lu e s a n d tho se in fig ure 1 d a re d e rive d fro m th e sam e e xp e rim e n t. d e n ote s p < com p a re d to co ntro ls. N T = N o t tre ate d 13

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * * Supplemental Figure 1 Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes a b c d e [ C 3 ]Pyruvate [ C 3 ]Malate [ C 3 ]Aspartate [ C 3 ]Citrate [ C 2 ] -Ketoglutarate f g h [

More information

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum

More information

The in Vitro and in Vivo Pharmacology of AB101, a Potential Once-Weekly Basal Subcutaneous Insulin

The in Vitro and in Vivo Pharmacology of AB101, a Potential Once-Weekly Basal Subcutaneous Insulin The in Vitro and in Vivo Pharmacology of AB11, a Potential Once-Weekly Basal Subcutaneous Insulin BRIAN K ROBERTS, XUEYAN WANG, MARY S ROSENDAHL, SANKARAM MANTRIPRAGADA, Louisville, CO 97-OR American Diabetes

More information

Figure S1. B % of Phosphorylation 32H. 32ss

Figure S1. B % of Phosphorylation 32H. 32ss Figure S1 8H 32ss 32H 32Hc % of Phosphorylation 3 32H 2 1 32ss 1 2 3 4 Extract (μg) C % of Phosphorylation 18 12 6-32H 32Hc 8H 32ss Dbait Figure S1. List of the Dbait molecules and activation of DN-PK

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B). Intra Immune nalysis Surface Supplementary Figure 1. Flow cytometry panels used for D Canto () and D Fortessa (). Name Fluorochrome ID F488 PE PerCp-Cy5.5 PC Paclue PE-Cy7 PC-H7 Lympho* 1 CD56 CD8 CD16

More information

Diet, Exercise and Nutrition in Cancer Prevention and Survivorship

Diet, Exercise and Nutrition in Cancer Prevention and Survivorship Diet, Exercise and Nutrition in Cancer Prevention and Survivorship Jessica Clague DeHart, PhD, MPH Visiting Professor, Department of Medical Oncology, City of Hope Assistant Professor, Claremont Graduate

More information

Progestin-only methods Type or dose of progestagen

Progestin-only methods Type or dose of progestagen Progestin-only contraception and beneficial effects on migraine Conflicts of interest A d v ise r a n d le ctu re r fo r E X E LT IS Le ctu re s a n d A d v iso ry b o a rd s B aye r Le ctu re s a n d

More information

Francesco Parlati, Ph.D.

Francesco Parlati, Ph.D. Novel Pharmacodynamic Assays to Measure Glutaminase Inhibition Following Oral Administration of CB-839 Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, California Disclosure Information

More information

Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis

Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis V. Deshmukh 1, T. Seo 1, C. Swearingen 1, Y. Yazici 1 1 Samumed,

More information

Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in

Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *

More information

A. Generation and characterization of Ras-expressing autophagycompetent

A. Generation and characterization of Ras-expressing autophagycompetent Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Imtiyaz et al., Fig. S1

Imtiyaz et al., Fig. S1 . Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Imaging of Coronary Atherosclerosis. Dr Marc Dweck BHFSenior Lecturer Edinburgh Heart Centre& University of Edinburgh

Imaging of Coronary Atherosclerosis. Dr Marc Dweck BHFSenior Lecturer Edinburgh Heart Centre& University of Edinburgh Imaging of Coronary Atherosclerosis Dr Marc Dweck BHFSenior Lecturer Edinburgh Heart Centre& University of Edinburgh Echo CT Angiography& Plaque MRI - Assess Anginal Symptoms SPECT PERFUSION - Risk Stratification

More information

7th International Congress of the Spanish Society of Obesity Surgery. Valladolid Spain May, 2004.

7th International Congress of the Spanish Society of Obesity Surgery. Valladolid Spain May, 2004. 7th International Congress of the Spanish Society of Obesity Surgery. Valladolid Spain May, 2004. DIMINISHING POSTOPERATIVE RISKS OF GASTRIC BYPASS Stenosis Stenosis Leak Leak Bleeding Bleeding Stenosis

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

A Sound Track to Reading

A Sound Track to Reading A Sound Track to Reading Blending Flashcards Prepared by Donald L Potter June 1, 2018 Mr. Potter prepared these cards to be used with Sister Monica Foltzer s advanced intensive phonics program and reader,

More information

TGR5 activation induces intestinal growth and improves intestinal mucositis in mice. Hannelouise Kissow

TGR5 activation induces intestinal growth and improves intestinal mucositis in mice. Hannelouise Kissow TGR5 activation induces intestinal growth and improves intestinal mucositis in mice Hannelouise Kissow Department of Biomedical Sciences Faculty of Health and Medical Sciences Faculty Disclosure x No,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative

More information

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared

More information

Defects in glucose utilization & GLP-1

Defects in glucose utilization & GLP-1 Defects in glucose utilization & GLP-1 Song, Dae-Kyu Department of Physiology & Chronic Disease Research Center Keimyung University School of Medicine 2800 dalgubeol-daero, Dalseo-gu, Daegu, 704-701, Korea

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1. A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *

More information

Last updated Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes

Last updated Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes Last updated 2011-03-02 Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes Media Formulations A. Media for glycogen synthesis: Culture medium base: DMEM-Low (Mediatech/Cellgro

More information

An overview of findings from quantitative. research conducted across 6 European countries

An overview of findings from quantitative. research conducted across 6 European countries An overview of findings from quantitative research conducted across 6 European countries Maria Daniel Vaz de Almeida LIPGENE Diet, Genomic and the Metabolic Syndrome Objectives To assess consumers awareness

More information

Sensitivity of Serum Fructosamine in Short Term Glycemic Control

Sensitivity of Serum Fructosamine in Short Term Glycemic Control A N N A L S O F C L IN IC A L A N D L A B O R A T O R Y S C IE N C E, Vol. 19, N o. 2 Copyright 1989, Institute for Clinical Science, Inc. Sensitivity of Serum Fructosamine in Short Term Glycemic Control

More information

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

CANCER OF THE CERVIX

CANCER OF THE CERVIX 7o. CANCER OF THE CERVIX Cervical cancer is an abnormal growth occuring in the opening of the womb. If detected in its early stages, the disease can be totally cured; if unattended, it is fatal. The incidence

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

Recruitment of HBO1 Histone Acetylase and Blocks

Recruitment of HBO1 Histone Acetylase and Blocks Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin

More information

Mouse Models for Studying Human Islet Transplantation

Mouse Models for Studying Human Islet Transplantation Mouse Models for Studying Human Islet Transplantation Ronald G. Gill, Joshua Beilke,, Nathan Kuhl,, Michelle Kerklo, and Mark M. Nicolls Barbara Davis Center for Childhood Diabetes University of Colorado

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin. Figure 1 pβcat552 β-cat pgsk3β GSK3β 110 110 pgsk3β/du -cad/ TL 20 µm 20 µm pkt473 pankt pkt473 pankt (days) 0 1 2 3 4 (h) 0 1 3 6 9 12 pβ-cat552/nuclei ensitometricanalysis (Pixel intensity) F ensitometricanalysis

More information

Supplementary legends

Supplementary legends Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:

More information

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification

More information

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. A B C (A) Schematic representation of the new constructs designed for local camp imaging.

More information

Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress

Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress omparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress S DAL, S Sigrist, W Bietiger, Peronet, M Pinget and N Jeandidier

More information

* * * * * liver kidney ileum. Supplementary Fig.S1

* * * * * liver kidney ileum. Supplementary Fig.S1 Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary CellSensor HSE-bla HeLa Cell Line Cat. no. K Pathway Description Activation of the heat shock response/unfolded protein response (HSR/UPR) occurs in response to a

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplemental Materials Molecular Biology of the Cell

Supplemental Materials Molecular Biology of the Cell Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).

More information

Preclinical Assessment of JTX-2011, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial

Preclinical Assessment of JTX-2011, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial Preclinical Assessment of JTX-211, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial Jennifer Michaelson, Ph.D. AACR Annual Meeting April 2, 217 Major Symposium Emerging

More information

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin

More information

Examining the Basis of Drug-Drug Interaction (DDI) Labeling Recommendations for Antiviral Approvals from 1998 to 2015

Examining the Basis of Drug-Drug Interaction (DDI) Labeling Recommendations for Antiviral Approvals from 1998 to 2015 Examining the Basis of Drug-Drug Interaction (DDI) Labeling Recommendations for Antiviral Approvals from 1998 to 2015 Tyler Shugg, PharmD PhD Candidate Department of Pharmacy Practice Purdue University

More information

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules

More information

TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE

TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE Benoît Melchior, C. Lai, K. Duong-Polk, A. Tjitro, D.C. Ince,

More information

Thyroid Screening in the Newborn: Utah Experience

Thyroid Screening in the Newborn: Utah Experience ANNALS OF CLINICAL AND LABORATORY SCIENCE, Vol. 13, No. 1 Copyright 1983, Institute for Clinical Science, Inc. Thyroid Screening in the Newborn: Utah Experience BRUCE A. BUEHLER. M.D.,* MELVIN J. GORTATOUSKI,

More information

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary

More information

The Effect of Metal Chelators on Lipid Peroxidation in Irradiated Erythrocytes

The Effect of Metal Chelators on Lipid Peroxidation in Irradiated Erythrocytes ANNALS OF CLINICAL AND LABORATORY SCIENCE, Vol. 22, No. 6 Copyright 1992, Institute for Clinical Science, Inc. The Effect of Metal Chelators on Lipid Peroxidation in Irradiated Erythrocytes JOSEPH A. KNIGHT,

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Disclosures for Prof D L Hay. Research funding: Alder Biopharmaceuticals Inc. Consulting arrangements: Intarcia Therapeutics Inc.

Disclosures for Prof D L Hay. Research funding: Alder Biopharmaceuticals Inc. Consulting arrangements: Intarcia Therapeutics Inc. Disclosures for Prof D L Hay Research funding: Alder Biopharmaceuticals Inc. Consulting arrangements: Intarcia Therapeutics Inc. CGRP & Its Receptors Debbie L Hay University of Auckland, New Zealand There

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication

Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication Oscar Blanch-Lombarte Rome, 7-9 June, 2017 European

More information

TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE

TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRKA INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE Benoît Melchior, Carolyn Lai, Karen Duong-Polk, Amanda Tjitro,

More information

Theme song for the 2018 Los Angeles Religious Education Congress Rise Up! Levántate! A/E. j œ. œ œ. Œ œ œ. Dios te. œ œ œ œ

Theme song for the 2018 Los Angeles Religious Education Congress Rise Up! Levántate! A/E. j œ. œ œ. Œ œ œ. Dios te. œ œ œ œ Theme sog for the 2018 Los Ageles Religious ducatio Cogress Up! vátate! ditio 0140629 Based o zekiel 7:1214; Romas 8:8 11; oh 11:1 45 stela GarcíaLópez ad Rodolfo López & & & & & & INTRO (q = ca 124) (o)

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Se le ctive C e rvica l Spina l M otionr e strictionpa tie ntse le ctionproce dure 1(B L S a nd A L S)

Se le ctive C e rvica l Spina l M otionr e strictionpa tie ntse le ctionproce dure 1(B L S a nd A L S) Section: EMS Page: 1 of 5 I. PURPOSE Mechanism of injury alone has not been shown to be a predictor for spinal injury. An appropriate patient assessment can be used to determine need for spinal motion

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Molecular assays in HIV-1 Dx and therapeutic monitoring

Molecular assays in HIV-1 Dx and therapeutic monitoring Molecular assays in HIV-1 Dx and therapeutic monitoring captodayonline.com/molecular-assays-in-hiv-1-dx-and-therapeutic-monitoring/ May 2014 CAP TODAY and the Association for Molecular Pathology have teamed

More information

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,

More information

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes

More information

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

I ve Participated in a Research Study. Now What? Oleg Shchelochkov, MD NIH/Venditti Lab

I ve Participated in a Research Study. Now What? Oleg Shchelochkov, MD NIH/Venditti Lab I ve Participated in a Research Study. Now What? Oleg Shchelochkov, MD NIH/Venditti Lab Natural History To understand the onset of ORGANIC ACIDEMIAS, progression and outcomes for each body system Biomarkers

More information

doi: /nature14508 Rappsilber et al.

doi: /nature14508 Rappsilber et al. SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa

More information

Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling

Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling Russell A. Miller,, Benoit Viollet, Morris J. Birnbaum J Clin Invest. 2011;121(6):2518-2528.

More information

Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin

Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin Abhi Saharia, Ph. D. Director of Marketing Bioassays in Biologics Development Research

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

A CD123-targeting Antibody-Drug Conjugate (ADC), IMGN632, designed to eradicate Acute Myeloid Leukemia (AML) cells while sparing normal bone marrow

A CD123-targeting Antibody-Drug Conjugate (ADC), IMGN632, designed to eradicate Acute Myeloid Leukemia (AML) cells while sparing normal bone marrow A CD123-targeting Antibody-Drug Conjugate (ADC), IMGN632, designed to eradicate Acute Myeloid Leukemia (AML) cells while sparing normal bone marrow Yelena Kovtun, Gregory Jones, Charlene Audette, Lauren

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

Food and Respiratory Allergy in Ghana Insights from population studies among children

Food and Respiratory Allergy in Ghana Insights from population studies among children Food and Respiratory Allergy in Ghana Insights from population studies among children Abena S. Amoah Parasitology Department, Noguchi Memorial Institute for Medical Research, Accra, Ghana Parasitology

More information