P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl
|
|
- Shannon Stafford
- 5 years ago
- Views:
Transcription
1 P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis of phosphorylated P- and Thr38 expression in human fetal islet cells following 24 hours of cell culture on collagen I/IV upon anti-α3, 1 or treatment or without treatment []. Representative blots are shown. Data are normalized to the untreated controls and expressed as M+SEM (n=3 experiments/group). p<1.
2 Cell adhesion (Fold Change) A Anti-α3 IgG Cell spreading (Fold Change) Anti-α3 IgG V IgM IgM Fig 2 : 3 or 1 integrin blockade decreases INS-1 cell adhesion and spreading on collagens I and IV. INS-1 cell adhesion (A) and spreading () after 3 hours of culture on collagen I or IV and treated with anti-a3, anti- 1, IgG, IgM or without treatment (). Data are normalized to the untreated controls. M±SEM, n=5-6 experiments/group. p<1, p<1 vs. or untreated controls.
3 A V immunopositive cells (%) Anti-α3 IgG Insulin immunopositive cells (%) Anti-α3 IgG IgM IgM Fig 3 : 3 or 1 integrin blockade decreases and insulin expression in INS-1 cells on collagens I and IV. Quantitative analysis of (A) and () insulin expression following anti-α3, anti- 1, IgG or IgM treatment or without treatment [] and 24 hours of cell culture on collagen I or IV. Data are expressed as M±SEM (n=5-6 experiments/group). p<5, p<1, p<1 vs. or untreated controls.
4 A Relative phosphorylated ERK1/2 expression (normalized to total ERK) U126 P- ERK T- ERK V U126 P- ERK T- ERK C Relative cleaved caspase 3 expression (normalized to total caspase 3) Relative expression (normalized to ) U126 U126 C-Casp 3 T-Casp U126 U126 C-Casp 3 T-Casp 3 Fig. 4 : MEK inhibitor effects on INS-1 cell signaling and expression. Western blot analyses of (A) ERK1/2 phosphorylation, () caspase3 cleavage and (C) expression following 24 hour culture on collagen I or IV and treatment with the MEK inhibitor, U126. Representative blots are shown. Data are normalized to untreated controls and expressed as M+SEM (n=3 experiments/group). p<5, p<1.
5 P-AktThr 38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG IgM P-AktThr 38 Anti-α3 IgG IgM P-AktThr 38 V Fig or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis of phosphorylated P- and Thr38 expression in INS-1 cells following 24 hours of cell culture on collagen I/IV upon anti-α3, 1 or treatment or without treatment []. Representative blots are shown. Data are normalized to the untreated controls and expressed as M+SEM (n=3 experiments/group). p<5, p<1.
6 Relative phosphorylated Akt expression (normalized to total Akt) A P- AktSer 473 T- Akt P- AktThr 38 T- Akt V P- AktSer 473 T- Akt P- AktThr 38 T- Akt Relative phosphorylated GSK3-β protein expression (normalized to total GSK3-β) Relative cleaved caspase 3 protein expression (normalized to total caspase 3) C D V P- GSK3-β T- GSK3-β C-Casp 3 T-Casp P- GSK3-β T- GSK3-β C-Casp 3 T-Casp 3 XIAP XIAP E Relative XIAP expression (normalized to ) Relative expression (normalized to ) Fig. 6 : PI3K inhibitor effects on INS-1 cell signaling and expression. Western blot analyses of (A) phosphorylated (P) and total (T) Akt Ser473, phosphorylated (P) and total (T) Akt Thr38, () XIAP, (C) phosphorylated (P) and total (T) GSK3-, (D) cleaved (C) and total (T) caspase 3 (Casp 3) and (E) expression following 24 hours of culture on collagen I or IV and treatment with the PI3K inhibitor,. Representative blots are shown. Data are normalized to the untreated controls and expressed as M+SEM (n=3 experiments/group). p<5, p<1, p<1.
7 A P-FAK P-FAK P-ERK1/2 P-ERK1/2 T-FAK T-FAK T-ERK1/2 T-ERK1/2 Relative pfak expression (normalized to total FAK) Relative perk1/2 expression (normalized to total ERK1/2) C C-Casp3 C-Casp3 D Relative Caspase 3 Cleavage (normalized to total Caspase 3) T-Casp T-Casp3 Relative expression (normalized to ) V V Fig. 7 : α3β1 integrin blockade decreases FAK, ERK1/2 phosphorylation, reduces expression and increases caspase 3 cleavage. Western blotting analysis of phosphorylated [P] and total [T] FAK (A), P- and T-ERK1/2 (), cleaved [C] and total [T] caspase (Casp) 3 (C) and expression (D) following 24 hours of cell culture on collagen I/IV upon anti-α3 1, treatment or without treatment []. Representative blots are shown. Data are normalized to the untreated controls and expressed as M+SEM (n=3 experiments/group). p<1.
8 A P-AktSer 473 P-AktSer 473 P-Akt Thr38 P-Akt Thr38 Relative pakt Ser473 expression (normalized to total Akt) Relative pakt Thr38 expression (normalized to total Akt) C XIAP XIAP D P-GSK3β P-GSK3β T-GSK3 β T-GSK3β Relative XIAP expression (normalized to ) V Relative pgsk3β expression (normalized to total GSK3β) V Fig. 8 : α3β1 integrin blockade decreases Akt and GSK3β phosphorylation, reduces XIAP expression. Western blotting analysis of phosphorylated P- and Ser473 (A); P- and Thr38 (); XIAP (C) and P- and T-GSK3β (D) expression following 24 hours of cell culture on collagen I/IV upon anti-α3 1, treatment or without treatment []. Representative blots are shown. Data are normalized to the untreated controls and expressed as M+SEM (n=3 experiments/group). p<5, p<1, p<1.
9 Table 1: List of antibodies used for immunofluorescence and/or western blotting analysis Primary Antibody Dilution Company, Location Mouse anti-phosphorylated Akt (Ser 473) 1:2 a 2 or Rabbit anti-phosphorylated Akt (Thr 38) Rabbit anti-akt Rabbit anti-phosphorylated Thr22/Tyr24 ERK12 Rabbit anti-erk1/2 Rabbit anti-xiap Rabbit anti-cleaved Caspase 3 Rabbit anti-caspase 3 Rabbit anti-phosphorylated GSK3-β Rabbit anti-gsk3-β Rabbit anti- Mouse anti- Mouse anti-human Insulin Mouse anti-rdu Rabbit anti-ki67 1:2 1:2 a or 2 1:2 a or 2 1:2 a or 1 1:8 1:1 1:1 1:2 1:2 1:1 a or 5 1:2 1:1 a 1:5 a 1:2 Gift from Dr. Wright, Vanderbilt University, USA D iosciences, Mississauga, ON, Canada Sigma, Saint Louis, Missouri, USA Sigma, Saint Louis, Missouri, USA Abcam, Cambridge, MA, USA a dilution factor used for immunofluorescence
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationFigure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationContribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion
Contribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion Cécile Jacovetti 1, Veronica Jimenez 2, Eduard Ayuso 2#, Ross Laybutt 3, Marie-Line Peyot 4, Marc
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationPhospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationCHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES
CHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES 3.1 Introduction Developmental processes such as cell migration depend on signals from both the
More informationResponse and resistance to BRAF inhibitors in melanoma
Response and resistance to BRAF inhibitors in melanoma Keith T. Flaherty, M.D. Massachusetts General Hospital Cancer Center Disclosures Roche/Genentech: consultant GlaxoSmithKline: consultant BRAF mutations
More informationFigures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationVirus-Induced Ca 2 Influx Extends Survival of West Nile Virus-Infected Cells
JOURNAL OF VIROLOGY, Sept. 2010, p. 8721 8731 Vol. 84, No. 17 0022-538X/10/$12.00 doi:10.1128/jvi.00144-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. Virus-Induced Ca 2 Influx
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
More informationSupplementary Figure 1
CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationThe Role of Integrins in Support of Pancreatic Function, Survival and Maturation
Western University Scholarship@Western Electronic Thesis and Dissertation Repository June 2014 The Role of Integrins in Support of Pancreatic Function, Survival and Maturation Matthew Riopel The University
More informationSupplementary Fig. 1
PDK1-dependent quenching of TACE shedding activity in prion and Alzheimer s diseases Mathéa Pietri, Caroline Dakowski, Samia Hannaoui, Aurélie Alleaume-Butaux, Julia Hernandez-Rapp, Audrey Ragagnin, Sophie
More informationOverexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma
Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share
More informationSupplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression. through inhibition of Hsp90
Supplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression through inhibition of Hsp90 Dicoumarol-Sepharose co-precipitation. Hsp90 inhibitors can co-precipitate
More informationCombined SFK/MEK inhibition prevents metastatic outgrowth of dormant tumor cells
Combined SFK/MEK inhibition prevents metastatic outgrowth of dormant tumor cells Lara H. El Touny,, Mark J. Hoenerhoff, Jeffrey E. Green J Clin Invest. 2014;124(1):156-168. https://doi.org/10.1172/jci70259.
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationhuman epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)
GSK3β facilitates IFNγ signaling Supplementary Figure Legends Figure S1. The effects of inhibiting GSK3β on IFNγinduced TNFα expression. A, A549 human epithelial cells were pretreated with control sirna
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationAntitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationKaul 1. Kaul et al _Inventory of Supplemental Materials. Supplemental Figures and Figure Legends. Figure S1, related to Figure 1
Kaul 1 Kaul et al _Inventory of Supplemental Materials Supplemental Figures and Figure Legends Figure S1, related to Figure 1 Figure S2, related to Figure 2 Figure S3, related to Figure 3 Figure S4, related
More informationActivation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes
Nrf2 mediates induced CLEC5A and TNFα Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNFα production by mononuclear phagocytes YiLin Cheng 1,2, YeeShin Lin 1,2,3, ChiaLing
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,
More informationFigure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk
EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated
More informationStudying apoptosis in DT40 cells
Studying apoptosis in DT40 cells Sandrine Ruchaud E12.5! Acridine Orange! Role of apoptosis in sculpting the mouse paw E13.5! E14.5! gift of William Wood & Paul Martin! University College, London! Normal
More informationblood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific
Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationMuse Assays for Cell Analysis
Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
More informationE (orthotopic implantation)
in vitro, (2D) in vitro, Matrigel on-top (MoT; 3D) non-metastatic metastatic D2 proliferation (% Ki67-positive) 59 65 66 apoptosis (% TUNEL-positive) 3 2 E (orthotopic implantation) D2 tumor incidence
More informationThomas Jefferson University Annual Progress Report: 2008 Formula Grant
Thomas Jefferson University Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2012 December 31, 2012 Formula Grant Overview The Thomas Jefferson University received $3,455,597 in formula
More informationFigure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.
Figure 1 pβcat552 β-cat pgsk3β GSK3β 110 110 pgsk3β/du -cad/ TL 20 µm 20 µm pkt473 pankt pkt473 pankt (days) 0 1 2 3 4 (h) 0 1 3 6 9 12 pβ-cat552/nuclei ensitometricanalysis (Pixel intensity) F ensitometricanalysis
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationTransgenic Mice and Genetargeting
Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationPlanar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays
Planar Waveguides: How Nano Layers Enable to Detect Zepto Moles of Macro Molecules in Pico Liter Spots on Micro Arrays Dr. Markus Ehrat Zeptosens A Division of Bayer Schweiz AG SSOM Meeting March 16 /17
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationBio-Plex Pro Cell Signaling Assays
Acute Phase Response Cancer Cardiovascular Disease Diabetes Cytokines, Chemokines, Growth Factors Immunology/Inflammation Immunoglobulin Isotyping Cell Signaling Toxicology Bio-Plex Pro Cell Signaling
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More information5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant
More informationA Yersinia-Secreted Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System
Cell Host & Microbe, Volume 7 Supplemental Information A Yersinia-Secreted Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System Igor E. Brodsky, Noah
More informationLoss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
More informationYuan et al. Breast Cancer Research (2015) 17:69 DOI /s y
Yuan et al. Breast Cancer Research (2015) 17:69 DOI 10.1186/s13058-015-0579-y RESEARCH ARTICLE Open Access Acquisition of epithelial-mesenchymal transition phenotype in the tamoxifen-resistant breast cancer
More informationTrehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
More informationRobert Newman, Ph.D. and Peiying Yang, Ph.D.
Robert Newman, Ph.D. and Peiying Yang, Ph.D. Department of Experimental Therapeutics and General Oncology The University of Texas, M.D. Anderson Cancer Center Digitalis purpuria: Source of cardiac glycosides
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationCyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells
Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationCONTRACTING ORGANIZATION: Rush University Medical Center Chicago, IL 60612
AD Award Number: W81XWH-11-1-0302 TITLE: Yin and Yang of Heparanase in breast Tumor Initiation PRINCIPAL INVESTIGATOR: Xiulong Xu, Ph.D. CONTRACTING ORGANIZATION: Rush University Medical Center Chicago,
More informationTable S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
More informationIdentification of non-ser/thr-pro consensus motifs for Cdk1 and their roles in mitotic regulation of C2H2 zinc finger proteins and Ect2
SUPPLEMENTARY INFORMATION Identification of non-ser/thr-pro consensus motifs for Cdk1 and their roles in mitotic regulation of C2H2 zinc finger proteins and Ect2 Kazuhiro Suzuki, Kosuke Sako, Kazuhiro
More information