MB Juckett 1, EP Cohen 1, CA Keever-Taylor 1, Y Zheng 1, CA Lawton 2, JE Moulder 2 and J Klein 3

Transcription

1 (21) 27, Nature Publishing Group All rights reserved /1 $15. Post-transplant complications Loss of renal function following bone marrow transplantation: an analysis of angiotensin converting enzyme D/I polymorphism and other clinical risk factors MB Juckett 1, EP Cohen 1, CA Keever-Taylor 1, Y Zheng 1, CA Lawton 2, JE Moulder 2 and J Klein 3 Departments of 1 Medicine, 2 Radiation Oncology, and 3 Biostatistics, Medical College of Wisconsin, Milwaukee, WI, USA Summary: Chronic renal failure is an acknowledged late complication of BMT. It is related to the intensive chemotherapy, radiation and supporting medications. Polymorphism in the angiotensin converting enzyme (ACE) gene is associated with progression of nephropathy caused by diabetes and IgA nephropathy. We sought to determine whether ACE genotype and other clinical factors were associated with loss of renal function after BMT. We determined the genotype of 16 adult allogeneic BMT recipients, who received a similar preparative regimen, survived 1 year, and had assessment of renal function up to 3 years after BMT. We found that the distribution of genotypes was similar to the general population; 29%, 51%, and 2% for the DD, DI, and II genotypes, respectively. There was no statistical difference in patient survival between the three groups. Among all patients, the average creatinine clearance declined from 124 (95% CI 117, 131) to 89 (95% CI 78, 1) ml/min over the 36 months after BMT. Decline in renal function over time was less for patients with the DD compared to the II genotype (P =.4). Renal function in patients with the DD genotype was also better than those with the DI genotype, but this was of borderline statistical significance (P =.55). Renal shielding reduced decline in renal function compared to no shielding (P =.26). We conclude that the ACE genotype does not seem to influence survival, but the DD genotype may be protective against renal injury after BMT. Furthermore, we confirm that renal shielding during TBI reduces the renal injury after BMT. (21) 27, Keywords: angiotensin-converting enzyme; renal function; genetic polymorphism; hematopoietic stem cell transplantation; radiation shielding The late occurrence of chronic renal failure is a known complication of allogeneic bone marrow transplantation. 1 The combined effects of intensive radiation and chemotherapy are implicated in the pathogenesis of acute and chronic renal insufficiency. Factors contributing to acute renal failure include hypotension, sepsis and the administration of nephrotoxic medications such as aminoglycoside antibiotics, cyclosporine, tacrolimus and amphotericin. A distinct syndrome of chronic renal failure after BMT termed bone marrow transplant nephropathy has been described that consists of azotemia, disproportionate anemia, and hypertension. 2,3 This syndrome is thought to be due to either microvascular or renal parenchymal damage from the preparative regimen and in its most severe form resembles hemolytic uremic syndrome (HUS). Studies using animal models of BMT nephropathy have shown that angiotensin converting enzyme (ACE) inhibitors can effectively prevent and treat the syndrome. 4,5 This finding implicates the renin-angiotensin axis in the pathogenesis of the disorder. ACE is responsible for the cleavage of angiotensin I to angiotensin II, which has potent effects on vascular tone, growth and repair. The ACE gene contains a polymorphism based on the presence or absence of a 287-base pair intron. 6 The presence of the intron has been termed the insertion or I allele, and the absence of the intron the deletion or D allele. The combination of these alleles results in three genotypes (DD and II homozygotes, and DI heterozygotes). One study showed that individuals with DD, DI and II genotypes have 494, 392, and 299 g/l of immunoreactive ACE in plasma, respectively. 6 Several studies have shown that the DD genotype is associated with more rapid progression and severity of diabetic and immunoglobulin A nephropathy (reviewed in Ref. 7). The observed beneficial effects of ACE inhibitors in experimental BMT nephropathy and the association of ACE genotype with progression of other renal diseases led us to ask whether ACE genotype is associated with loss of renal function after BMT. The purpose of this study was to examine the association between ACE genotype and change in renal function after BMT. Correspondence: Dr MB Juckett, Medical College of Wisconsin, 92 W Wisconsin Ave, Milwaukee, WI 53226, USA Received 17 July 2; accepted 28 October 2

2 452 Methods Patients The patient population consisted of all adults who underwent allogeneic bone marrow transplantation at the Medical College of Wisconsin between November 1985 and September Adult patients were selected for analysis if they survived for 1 year, had DNA available for genotyping, and follow-up assessment of renal function and weight. There were 786 patients who received an allogeneic BMT during the time period, 327 of whom had cryopreserved mononuclear cells available for genotyping. Among the 327 patients, there were 231 adults (18 years of age or older), 121 of whom survived for 1 year. Among these 121 patients, 111 were treated by our standard BMT protocol (described below), and we were able to obtain complete follow-up information pertaining to renal function in 16 patients. These 16 patients are the subjects of this study. The serum creatinine concentration and weight were collected at the following times: pre-bmt (within 3 days), 6 months, 1 year, 18 months, 2 years and 3 years. The creatinine clearance of each patient was calculated using the Cockcroft and Gault formula and is reported as milliliters per min. 8 Creatinine clearance (ml/min) = (14 age) (weight (kg)) 72 (serum creatinine) A multivariate analysis was conducted using factors that may be associated with loss of renal function over time. The factors considered in the analysis are listed in Table 1. Patient diagnoses were categorized as acute (AML, ALL, lymphoblastic lymphoma) or chronic (low grade lymphoma, CLL, CML, multiple myeloma, aplastic anemia) to reflect the general intensity of prior treatment. The incidence of extensive chronic GVHD was low (14%) and not included in the multivariate analysis. Determination of ACE genotypes The D and I alleles were identified on the basis of polymerase chain reaction (PCR) amplification of a fragment in intron 16 of the ACE gene as described. 9 One microliter of peripheral blood mononuclear cells was used for DNA collection with GeneReleaser (Bioventures, Murfreesboro, TN, USA) according to the manufacturer s instructions. The PCR reagents (SuperMix by Life Technologies, Rockville, MD, USA) were layered over the resulting DNA pellet and primers were added. The primers amplify either a 319-bp or 597-bp fragment from the D and I alleles, respectively (hace3s, 5 GCCCTGCAGGTGTCTGCAGCA TGT3 ; hace3as, 5 GGATGGCTCTCCCCGCCTTGT CTC3 ). The thermocycling procedure consisted of denaturation at 94 C for 3 s, annealing at 56 C for 45 s, and extension at 72 C for 1 min, repeated for 35 cycles, followed by a final extension at 72 C for 7 min. The entire sample was examined on a 1.5% agarose slab with ethidium bromide staining. The D allele in heterozygous samples is preferentially amplified due to the size differences between the I and D products. 1 Each sample that was found to have the DD genotype underwent a confirmatory second, PCR amplification with a primer pair that recognized an insertionspecific sequence. The PCR reaction was performed as above except the annealing temperature was 67 C (hace5a, 5 TGGGACCACAGCGCCCGCCACTAC3 ; hace5cm 5 TCGCCAGCCCTCCCATGCCCATAA3 ). The reaction yields a 335-bp fragment only in the presence of at least one I allele. A typical gel electrophoresis is shown in Figure 1. Conditioning regimen All patients received a standard conditioning regimen consisting of intravenous cytarabine (3 g/m 2 every 12 h for six doses days 7, 6, 5, 4), cyclophosphamide (45 mg/kg given 6 h after the second and fourth doses of cytarabine, methylprednisolone (1 g/m 2 every 12 h for days 2, 1), and total body irradiation. 11 At the discretion of the attending physician, the cytarabine dose was reduced 25 5% for those patients over the age of 4 years. TBI was begun 48 h after the last dose of cytarabine and was delivered at dose rates of 8 to 25 cgy/min in nine fractions over 3 days (TID group) to a total of 14 Gy, or six fractions over 3 days (BID group) to a total of 13.2 Gy. Beginning Table 1 Clinical characteristics of patients Characteristics Number of patients 16 Median age 36 years Gender M:F 62:44 (58:42) Genotype DD 31 (29) DI 54 (51) II 21 (2) Disease type Acute 47 (44) Chronic 59 (56) Donor Unrelated 24 (23) Related 82 (77) Renal shielding No 28 (26) Yes 78 (74) TBI schedule TID 83 (78) BID 23 (22) I D Marker DD II DI Figure 1 A representative agarose gel electrophoresis of PCR products as described in Materials and methods.

3 in September 1988, renal shielding was initiated to reduce the renal dose of TBI to 11.9 Gy (15% reduction). Beginning in 1992, the renal shielding was increased to 3% for a resulting renal dose of 9.8 Gy. 12 All patients received GVHD prophylaxis consisting of T cell depletion of the donor marrow and cyclosporine as described previously. 13 There is approximately a log 1 depletion of functional T lymphocytes from the donor marrow. Cyclosporine was administered as an intravenous infusion beginning the day before marrow infusion at 3 mg/kg per day and eventually changed to a corresponding oral dose when tolerated. Statistics Creatinine clearance (CrCl) was calculated at each time point for each patient as described above. For each subject, a linear regression model was fitted to the CrCl values available during the 36 months after BMT and the slope was calculated for the change in CrCl over time (ml/min/month). A multivariate regression analysis was used to test if the ACE genotype or other clinical factors in question were associated with the observed differences in the slope of the CrCl. The models were built by a forward stepwise selection criterion. A 5% significance level was used for inclusion. If a patient died during the followup period (between 1 and 3 years), the available CrCl data prior to death were used in the analysis. Survival analysis was performed using Kaplan Meier methods, 14 and the survival between groups was compared using the log-rank test. The percent survival is reported as percent standard error. The survival time is reported as mean (95% confidence interval). 15 Results Clinical characteristics of the patients are listed in Table 1. Median age was 36 years with a range of 18 to 59 years. Patients were evenly distributed by gender and disease type (acute vs chronic). There were approximately twice as many patients who received related vs unrelated donor BMT, renal shielding vs no shielding and TBI in a three fraction per day vs two fraction per day schedule. The frequencies of DD, II, and DI genotypes (29, 51, and 2 percent, respectively) were virtually identical to those predicted by the Hardy Weinberg equilibrium (3, 5, and 21%). The frequency of the D and I alleles (.55 and.45, respectively) is not different from that reported for the general population (.5 to.63 and 37 to.5, respectively. 16 Median follow-up for the entire group was 6.8 years (range 1.2 to 13. years), and overall survival at 7 years was %. The mean survival times are 9. (95% CI ), 7.7 (95% CI ), and 9. (95% CI ) years for genotypes DD, DI, and II respectively. The overall survival did not differ by ACE genotype. At 7 years, the overall survival was , , and % for DD, DI, and II genotype, respectively (P =.37, log-rank test). The survival curve for the patients according to genotype is shown in Figure 2. The CrCl values for the entire cohort of patients are Proportion surviving Figure 2 2 II DI DD Years after BMT Survival according to ACE genotype. reported in Table 2. The baseline CrCl was ml/min and fell to by 36 months. A multivariate analysis was performed to determine whether ACE genotype or other factors (listed in Table 1) were associated with the decline in CrCl over time. A linear model was fitted to the CrCl data over the entire 36 month period and a multivariate analysis was used to test whether a given variable was associated with differences in the slope of the CrCl. The results of this analysis are listed in Table 3. The decline of renal function over time was significantly greater in those patients who did not receive renal shielding compared to those who were shielded (P =.26). Difference in the decline of renal function between those who were and were not shielded was 1. ml/min/month. The use of renal shielding was associated with a 62% higher CrCl at the 36 month time point compared to no shielding. Patients who did not receive renal shielding appeared to experience a continual decline in CrCl over time compared to the shielded group, who displayed a plateau in the CrCl after approximately 1 year (Figure 3). The decline of renal function over time was significantly greater for the II than the DD genotype group (P =.4). The difference between the slopes of renal function for the DD and II groups was 1.13 ml/min/month. Also, the DI group had a faster decline of renal function (.85 ml/min/month) compared to the DD group, but this was of borderline statistical significance (P =.55). When analyzed by genotype, all groups appeared to have a plateau in CrCl between 12 and 36 months; however, the patients with the II genotype stabilized at a lower CrCl than the DD or DI groups. For the time period between 12 and 36 months, CrCl was ml/min for the patients with II genotype compared to for the combined DD and DI patient groups (P =.3, two-sided t-test). The CrCl data are presented according to genotype in Figure 4. We further analyzed the relationship between genotype

4 454 Table 2 Time Creatinine clearance (CrCl) after BMT CrCl (95% CI) (ml/min) (months) Baseline CrCl 124 (117, 131) 13 (95, 111) 9 (83, 97) 85 (77, 93) 9 (81, 99) 89 (78, 1) No. patients Table 3 Multivarate analysis Factor Difference in slope P value (ml/min/month) Age 35 vs 35 years Gender Female vs male CMV status Post vs neg Genotype DD vs II DD vs DI DI vs II Disease type Chronic vs acute Donor Related vs unrelated Renal shielding Yes vs no TBI schedule TID vs BID Table 4 Reduced multivariate model Factor Difference in slope P value (ml/min/month) Genotype DD vs other Renal shielding Yes vs no CrCl (ml/min) Months after BMT 3 None Single Double Figure 3 CrCl after BMT according to degree of renal shielding, CrCl was calculated for each patient as described in Materials and methods. None = no renal shielding; single = 15% transmission shield; double = 3% transmission shield and decline in renal function after BMT by reducing our multivariate model to include only genotype and renal shielding. We compared the DD patients to the combined DD and DI patients. Slope differences and associated P values are listed in Table 4. The effect of renal shielding remained highly significant with slope difference of 1.8 ml/min/month (P =.11). The effect of genotype, DD vs DI and II, was of borderline statistical significance (P =.51) with a slope difference of.79 ml/min/month. CrCl (ml/min) DD DI II Discussion Renal failure associated with BMT is well described and documented. 17,18 There are numerous treatment-related fac Months after BMT Figure 4 CrCl after BMT according to ACE genotyping. CrCl was calculated for each patient as described in Materials and methods.

5 tors that may cause or contribute to loss of renal function after BMT, including radiation, chemotherapy, cyclosporine, antibiotics and others. Our study was intended to determine whether a hereditary factor, ACE genotype, might predispose patients to renal insufficiency after BMT. We found that DD genotype was associated with slower decline of renal function compared to the II genotype during the first year after BMT. The difference between the DD and DI groups was of borderline statistical significance. In our reduced multivariate model that included only renal shielding and genotype, the DD group had a slower decline in renal function compared to the DI and II groups, but the statistical significance was again borderline (P =.51). The observation that the difference between the DD and II groups is greater than the DD and DI groups may be explained by a gene dosage or codominance effect. That is, the D allele may be protective against loss of renal function, and possessing two alleles results in greater protection than one. This hypothesis may explain the observation that at 1 year, the CrCl curve reached a plateau in all genotypic groups, but the II group fell significantly below the DI and DD groups. Homozygosity for the I allele may predispose to both a faster and greater loss of renal function after BMT. Taken together, these results suggest that the D allele of the ACE gene may be associated with protection from decline in renal function after BMT. Our study has also confirmed the previous observation described by Lawton et al 12 that shielding the kidneys during TBI reduces renal injury. At the end of the 3-year follow-up period, the shielded patients had a CrCl that was 62% higher than those who did not. In the reduced multivariate model, the effect of renal shielding remained highly statistically significant. Our conditioning regimen includes a higher TBI dose (14 Gy) than is used in most centers. 11 The higher dose of TBI needs to be considered in interpreting our results because models of transplantation have shown that the renal insufficiency after BMT appears to be a form of radiation nephritis. 3 Degree of renal injury observed in our patients who were not shielded is unlikely to be seen in patients who receive 12 Gy TBI, and the importance of renal shielding or genotype might not be apparent in subjects irradiated to 12 Gy TBI or less. ACE is a protein present in most human cells and body fluids. It is a polyfunctional enzyme with a broad dipeptidase activity. In general, plasma ACE levels are 6% higher in DD homozygous than in II homozygous with intermediate values in heterozygotes. 6 Immunostaining of kidneys in healthy DD homozygous shows more ACE positive glomeruli in kidneys of II or DI subjects. 19 The exact molecular mechanism for this variation of ACE levels is unknown. The ACE genotype distribution is in accord with the Hardy Weinberg equilibrium in a healthy population suggesting that there is no negative selection pressure with either allele. One study has shown an intriguing finding of an over-representation of the DD genotype among centenarians. 2 In contrast, the II genotype is associated with enhanced aerobic endurance and anabolic response to exercise. 21,22 ACE is responsible for the conversion of angiotensin I (AI) to angiotensin II (AII). AII is a vasoconstrictor, induces the secretion of aldosterone, and affects tissue growth and vascular remodeling. In general, higher AII levels are thought to hasten the decline of renal function in chronic renal disease because of deleterious effects on blood flow and remodeling in the kidney. The higher ACE level that is observed in the DD genotype might explain the more rapid loss of renal function and the greater benefit from treatment with ACE inhibitors observed in patients with diabetic and IgA nephropathy. Our finding that the II genotype was associated with worse renal function after BMT suggests that higher ACE levels may have separate beneficial effect for patients undergoing BMT. Among other possibilities, ACE might control certain signals of tissue growth and repair that are important after BMT. An alternative explanation is that the ACE levels affect responses to BMT-related medications such as cyclosporine and amphotericin. In recent years a vast amount of data has been published on the association between the ACE genotype and renal disease (reviewed in Ref. 7). Studies have found that the DD genotype is associated with a more rapid loss of renal function in diabetic nephropathy, 23 IgA nephropathy 24 and adult polycystic kidney disease, 25 when compared to the II or DI genotypes. The genotype does not appear to initiate or cause renal disease per se; rather it is associated with more rapid loss of renal function after disease development. Related studies have investigated the effect of ACE genotype on the renal protective efficacy of ACE inhibitors such as captopril. The results of these studies have shown conflicting results, but as a general trend, it appears that the II genotype is associated with a better renal protective response to ACE inhibition. 26 The mixed results appeared to depend on such uncontrolled for variables as ethnic background 27 and salt intake. 28 The importance of the renin angiotensin system in BMT nephropathy is demonstrated by an animal model of BMT in which ACE inhibition or AII receptor blockade preserved renal function, 5 and infusion of angiotensin II enhanced renal injury. 29 It is notable that these studies have shown that renal protection can be accomplished by the use of ACE inhibitors given after radiotherapy is completed. 3 5 This finding implies an effect of ACE and/or angiotensin II in propagation of the renal injury after radiotherapy. If true, it is conceivable that the variation of ACE level associated with the D and I alleles may influence renal injury after BMT. Our finding of the association between ACE genotype and renal dysfunction was of borderline statistical significance. The true significance would require perspective studies with much larger numbers of patients. In addition, any study examining renal function after BMT will need to account for the use of ACE inhibitors such as captopril. Patients after bone marrow transplantation frequently require treatment for hypertension due to the effects of cyclosporine and prednisone. In the post-bmt setting, our institution commonly uses ACE inhibitors for the treatment of hypertension because as a class they are well tolerated and effective, and they have a low potential for drug interaction. If ACE inhibition is protective after BMT, then there may be differences in the degree of protection due to ACE genotype. In conclusion, our study has confirmed a beneficial effect of renal shielding during TBI for BMT. We have found 455

6 456 that the II genotype is associated with greater loss of renal function after TBI. However, this finding requires confirmation in a larger cohort of patients and with consideration for the use of ACE inhibitors. Acknowledgements This work was supported by NCI grant CA (MJ) and CA24652 (JM). References 1 Cohen EP. Radiation nephropathy after bone marrow transplantation. Kidney Int 2; 58: Lawton CA, Cohen EP, Barber-Derus SW et al. Late renal dysfunction in adult survivors of bone marrow transplantation. Cancer 1991; 67: Cohen EP, Lawton CA, Moulder JE. Bone marrow transplant nephropathy: radiation nephritis revisited. Nephron 1995; 7: Moulder JE, Fish BL, Cohen EP. Treatment of radiation nephropathy with ACE inhibitors. Int J Radiat Oncol Biol Phys 1993; 27: Moulder JE, Fish BL, Cohen EP. Angiotensin II receptor antagonists in the treatment and prevention of radiation nephropathy. Int J Radiat Biol 1998; 73: Rigat B, Hubert C, Alhenc-Gelas F et al. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 199; 86: Navis G, van der Kleij FG, de Zeeuw D, de Jong PE. Angiotensin-converting enzyme gene I/D polymorphism and renal disease. J Mol Med 1999; 77: Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine. Nephron 1976; 16: Lindpaintner K, Pfeffer MA, Kreutz R et al. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease. New Engl J Med 1995; 332: Shanmugam V, Sell KW, Saha BK. Mistyping ACE heterozygotes. PCR Meth Appl 1993; 3: Ash RC, Casper JT, Chitambar CR et al. Successful allogeneic transplantation of T-cell-depleted bone marrow from closely HLA-matched unrelated donors. New Engl J Med 199; 322: Lawton CA, Cohen EP, Murray KJ et al. Long-term results of selective renal shielding in patients undergoing total body irradiation in preparation for bone marrow transplantation. Bone Marrow Transplant 1997; 2: Kawanishi Y, Passweg J, Drobyski WR et al. Effect of T cell subset dose on outcome of T cell-depleted bone marrow transplantation. Bone Marrow Transplant 1997; 19: Kaplan EL, Meier P. Nonparametric estimation for incomplete observation. J Am Stat Assoc 1958; 53: Rothman KJ. Estimation of confidence limits for the cumulative probability of survival in life table analysis. J Chronic Dis 1978; 31: Barley J, Blackwood A, Carter ND et al. Angiotensin converting enzyme insertion/deletion polymorphism: association with ethnic origin. J Hypertens 1994; 12: Zager RA. Acute renal failure in the setting of bone marrow transplantation. Kidney Int 1994; 46: Cohen EP, Piering WF, Kabler-Babbitt C, Moulder JE. Endstage renal disease (ESRD) after bone marrow transplantation: poor survival compared to other causes of ESRD. Nephron 1998; 79: Mizuiri S, Yoshikawa H, Tanegashima M et al. Renal ACE immunohistochemical localization in NIDDM patients with nephropathy. Am J Kidney Dis 1998; 31: Schachter F, Faure-Delanef L, Guenot F et al. Genetic associations with human longevity at the APOE and ACE loci. Nat Genet 1994; 6: Williams AG, Rayson MP, Jubb M et al. The ACE gene and muscle performance. Nature 2; 43: Montgomery H, Clarkson P, Barnard M et al. Angiotensinconverting-enzyme gene insertion/deletion polymorphism and response to physical training. Lancet 1999; 353: Marre M, Jeunemaitre X, Gallois Y et al. Contribution of genetic polymorphism in the renin-angiotensin system to the development of renal complications in insulin-dependent diabetes: Genetique de la Nephropathie Diabetique (GENEDIAB) study group. J Clin Invest 1997; 99: Pei Y, Scholey J, Thai K et al. Association of angiotensinogen gene T235 variant with progression of immunoglobin A nephropathy in Caucasian patients. J Clin Invest 1997; 1: Baboolal K, Ravine D, Daniels J et al. Association of the angiotensin I converting enzyme gene deletion polymorphism with early onset of ESRF in PKD1 adult polycystic kidney disease. Kidney Int 1997; 52: Penno G, Chaturvedi N, Talmud PJ et al. Effect of angiotensin-converting enzyme (ACE) gene polymorphism on progression of renal disease and the influence of ACE inhibition in IDDM patients. Diabetes 1998; 47: Moriyama T, Kitamura H, Ochi S et al. Association of angiotensin I-converting enzyme gene polymorphism with susceptibility to antiproteinuric effect of angiotensin I-converting enzyme inhibitors in patients with proteinuria. J Am Soc Nephrol 1995; 6: van der Kleij FG, Schmidt A, Navis GJ et al. Angiotensin converting enzyme insertion/deletion polymorphism and short-term renal response to ACE inhibition: role of sodium status. Kidney Int 1997; 63 (Suppl.): S23 S Cohen EP, Fish BL, Moulder JE. Angiotensin II infusion exacerbates radiation nephropathy. J Lab Clin Med 1999; 134: