SUPPLEMENTARY INFORMATION
|
|
|
- Amanda Charles
- 5 years ago
- Views:
Transcription
1 DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3 p=.78 d f Reltive expression to Gpdh.2 Nnog.5 c-jun..5. Reltive expression to Gpdh.6 JunB Fos Fr.4 Fr ESCs: -LIF+RA (Dy).6 JunB Fos Fr.4 Fr mescs-->eb Formtion(Dy) g Reltive expression to Gpdh.5 c-jun h h 2h 4h 6h 2h Emryo development of Zer fish h Reltive expression to Gpdh% c-jun hescs(h)-->eb Formtion(Dy) Reltive expression to WT ESCs Nnog c-jun +/+ ES Sox2 c-jun +/- ES# c-jun +/- ES2# Rex Esrr Sll4 c-jun -/- ES# c-jun -/- ES2# Dpp5 Dnmt3l Reltive expression to Gpdh c-jun +/+ ES c-jun +/- ES# c-jun +/- ES2# c-jun -/- ES# c-jun -/- ES2# Nestin Sox Gt4 Gt6 Sox7 T Flk ESCs-->EB Formtion Dy6 Supplementry Figure Reltive expression of AP- fmily genes on ESCs nd somtic cells. () Immunostining of c-jun nd NANOG in MEFs nd ESCs. ESCs were cultured in feeder free (up pnel) or feeder (middle pnel) condition, respectively. Scre rs, μm. () Reltive expression of AP- fmily memers in MEFs, ipscs nd ESCs(Men±s.e.m., Twotiled, unpired t-test; n=3 independent experiments, Jun P=24, Fr P=.483, Fr P=.2). (c) Time course nlysis of AP- fmily memers during RA induced ESCs differentition y RT-qPCR. Mouse ESCs were cultured in mes+ra (μm). (Men±s.d., n=3 independent experiments). (d) Time course nlysis of the pluripotent genes nd AP- fmily memers during EB formtion y RT-qPCR (Men±s.d., n=3 independent experiments). (e-f) Time course nlysis of c-jun expression during emryo development of Zer fish (e), nd EB formtion of humn ESCs (f)(e-f, n=2 independent experiments). (g) Reltive expression of the pluripotent genes in WT nd Jun-deficient ESCs. Cells were culture in 2i+LIF medium (n=2 independent experiments). (h) Reltive expression of germ lyer mrkers during the EB genertion in WT nd Jun-deficient ESCs (Men±s.d., n=3 independent experiments). For source dt, see Supplementry Tle 3.
2 OKS+Ctrl OKS+c-Jun OKSM+Ctrl OKSM+c-Jun /GFP Phse d Dys of Dox Tretment -GFP colonies + 3 Dy Dy6 OKSM+Ctrl OKSM+c-Jun 2 -Dox Dox mes+vc OKS+ c-jun TetOn icd GFP colonies(dy2) c -GFP colonies(dy2) + 3 OKS mes+vc medium n=7 n=7 n=6 2 n=6 n=6 n=7 n=7 n=7 Mock VectorJunB Fos Fr Fr2 Atf2 Atf3 Supplementry Figure 2 The function of AP- fmily memers on somtic reprogrmming. () Phse nd GFP imges of ipsc colonies generted with OKS+Ctrl, OKS+c-Jun, OKSM+Ctrl, nd OKSM+c-Jun. Cells were culture in icd medium. Scle rs, 25 μm. () c-jun inhiit OKSM induced reprogrmming (Men±s.d., Two-tiled, unpired t-test, n=9 wells from 3 independent experiments,p<.) (c) The effect of AP- fmily memers to OKS induced reprogrmming in mes+vc medium (Men±s.d., Two-tiled, unpired t-test; n=7 wells (Mock, Vector, Fos, Fr, Fr2) or 6 wells (JunB, ATF2, ATF3) from 3 independent experiment, Vector-Fos p<., Vector-Fr2 P<., Vector-Fr P<.). (d) The effect of c-jun on reprogrmming t different time windows. OKS, Retrovirus; c-jun TetOn, lenti-virus crrying n inducile c-jun code sequence under the control of TetOn promoter. Reprogrmming cells were cultured in icd medium, Doxycycline (2μg/ml) ws dministrted t different time windows s indicted (n=4 wells from 2 independent experiments). The initil cell numer for reprogrmming is 2x 4 /well (p2) for OKS protocol, or.5x 4 /well (p2) for OKSM protocol. For source dt, see Supplementry Tle. 2
3 Reltive expression to Gpdh% Dox(h) Ets Smd3 Tgf Reltive expression to Gpdh Dox(h) q= Rex q= Sll4 q= Supplementry Figure 3 c-jun suppresses pluripotent genes nd ctives EMT reltive genes. () Time course nlysis the expression of EMT reltive genes Ets, Smd3 nd Tgf2 y RT-qPCR (men±s.d., Two-tiled, unpired t-test; n=3 independent experiments, Ets P=.4, Smd3 P=.6, Tgf2 P=.2). () Time course nlysis the expression of pluripotent relted genes, Rex nd Sll4 y RT-qPCR. c-jun TetOn ESCs were cultured in 2i+LIF medium with doxycycline (2μg/ml) tretment (men±s.d., One-wy ANOVA, Dunnett s multiple comprisons test; n=4 independent experiments, q=4.922, Rex q=6.844, Sll4 q=7.3). For source dt, see Supplementry Tle
4 4k 4k 4k Primers: Fold enrichment Primers: IgG c-jun Rex Sll c-jun Input 5k 5k Ze2 2k 5 2k Dusp5 5k k Smd3 5k c-jun Input Thy 5 Ets 5 Tgf2 5 Supplementry Figure 4 c-jun ctives EMT reltive genes directly. () The indings of c-jun on the, Rex nd Sll4 loci were determined y ChIP- PCR. Arrows indicte the predicted inding site contining the conserved AP inding motif (men±s.d., n=3 independent experiments). () ChIP-seq result of c-jun t EMT relted genes Ze2, Dusp5, Smd3, Thy, Ets nd Tgf2. For source dt, see Supplementry Tle
5 c-jun 3 OKS-induced reprogrmming(mes+vc) c Bsic Motif Trnsctivtion domin Leucine-Zipper d. -3 q= q= q= Ctrl GFP + colonies(dy2) JDP2 63 Bsic Motif Leucine-Zipper OKS-induced reprogrmming(mes+vc). -63 q= q= q= Ctrl GFP colonies(dy2) Supplementry Figure 5 c-jundn nd enhnce reprogrmming efficiency. () The construction of different c-jun mutnts. Bsic motif, Leucine-Zipper nd Trnsctivtion domin were shown s yellow rectngle, light green rectngle nd Red rectngle, respectively. () Effect of vrious c-jun mutnts on reprogrmming (men±s.d., One-wy ANOVA, Dunnett s multiple comprisons test; n=6 wells pooled from 3 independent experiments,.-3 q=2.35,.7-3 q=7.3, q=3.9). (c) The construction of different mutnts. (d) Effect of vrious mutnts on reprogrmming (men±s.d., One-wy ANOVA, Dunnett s multiple comprisons test; n=6 wells pooled from 3 independent experiments,.-63 q=7.9,.5-63 q=.29,.5-63 q=8.639). For ipsc genertion, the initil cell numer ws 2x 4 /well (p2), -GFP + colonies were quntified t post-infection Dy2 in mes+vc medium. For source dt, see Supplementry Tle
6 Supplementry Figure 6 KSM/c-JunDN-iPSCs KS/c-JunDN-iPSCs NANOG DAPI REX DAPI KSM/c-JunDN X Y KSM/-iPSCs X Y KS/-iPSCs KS/c-JunDN KSM/ X Y X Y KS/ c Nnog MEFs ESCs KSM/c-JunDN KSM/ d Sox2 Klf4 c-myc Gpdh KSM/-Chimer Mice Brin Eyes Hert Bone Pncres Stomch C57 ES plsmid Ctrl H2O e KSM/c-Jun shrna-ipscs X Y Supplementry Figure 6 c-jun ntgonists cn replce in somtic reprogrmming. () Norml kryotypes of representtive KSM/c-JunDN, KS/c-JunDN, KSM/, KSM/ ipscs colonies. () Immunofluorescence nlysis the expression of pluripotent mrkers of indicted ipscs colonies. Scre rs, μm. (c) Bisulfite genomic sequencing of the Nnog nd promoter regions in indicted ipscs colonies. (d) PCR nlysis show the KSM- ipsc colonies contriuted to ll three germ lyer in chimeric mice. (e) Norml kryotypes of representtive KSM/c-Jun shrna ipscs colonies. 6
7 regulted genes(fold chnge>2) n= Log2(fold chnge) Ctrl c-jundn 4 Cell numer( ) Ctrl c-junwt c-jundn D D2 D3 D4 D5 Supplementry Figure 7 c-jun ntgonists regulted different genes with in MEFs. () Hetmp for RNA-seq dt from MEFs infected with control,,c-jundn nd. MEFs, cultured in %FBS for 72 hours fter virus infection,were hrvested for nlysis. () c-junwt promotes, ut c-jundn, nd inhiit, the prolifertion of MEFs. Cells were cultured in %FBS (men±s.d., n=3 wells, this experiment were repeted twice, one of the represented experiment ws showed). For source dt, see Supplementry Tle 5 () nd Supplementry Tle 6 (). 7
8 c d GFP+ ips colonies Sox2 Klf4 c-myc JhdmB Id Sll4 Glis Lrh icd icd+bmp Ctrl Id Id3 /Sox2 OKSM OKS OK OS 6F- 6F-2 ESCs MEFs H2O e O/S/Id O/Jhdm/Id 6F-iPSCs X Y f GFP+ ips colonies Sox2 Klf4 c-myc Glis Lrh Id Gpdh F-Chimer Mice Brin Eyes Hert Bone +Id+Jhdm+ Ctrl Klf4 Sox2 Lrh Nnog Glis Sll4 Pncres Lung C57 ES Positive Ctrl H2O Supplementry Figure 8 non-ymnk fctors reprogrmming. () Id nd Id3 enhnce OS induced reprogrmming in icd or icd+bmp medium. The initil cell numer ws 2x 4 per well (p2), cells were cultured in icd or icd+bmp4 (ng/ml) medium. -GFP + colonies were quntitted t post-infection Dy6 (men±s.d., n=4 wells pooled from 2 independent experiments). () Phse nd GFP imges of ipsc colonies generted with /Sox2/Id nd /Jhdm/Id. Scle rs, 25 μm. (c) The replcement of y indicted genes. The initil cell numer ws 2x 4 per well (p2). Cells were cultured in icd medium. -GFP + colonies were quntitted t post-infection Dy6 (men±s.d., n=6 wells pooled from 2 independent experiments). (d) Retrovirl integrtions of 6F-iPSCs nlyzed y PCR with genomic DNA. (e) Norml kryotypes of representtive 6F ipscs. (f) Retrovirl integrtions of 6F-iPSCs nlyzed y PCR with genomic DNA. For source dt, see Supplementry Tle
9 Originl uncropped western lots Figure c Figure e c-jun c-jun OCT4 GAPDH GAPDH Figure g Figure 2 Figure 5f c-jun 72 c-jun 72 c-jun 72 GAPDH GAPDH 72 GAPDH Supplementry Figure 9 Uncropped western lot imges 9
10 Supplementry Tle legends Supplementry Tle List of the primers in this reserch. The primers of AP- fmily genes, pluripotent genes, MET reltive genes, germ lyer genes, c-jun trget genes, nd other primers for ChIP-PCR. Supplementry Tle 2 c-jun shrna. Sequence for constructing 3 c-jun shrna Supplementry Tle 3 Relted to Figure 3. Showing gene list in which gene hs low expression level in ESC nd high level in MEF, nd ws up regulted when overexpression Jun in ESCc, nd vice vers. Supplementry Tle 4 Relted to Figure 7. Showing gene list in which gene ws regulted on dy 3 during SKM + reprogrmming system, nd their expression pttern in SKM + JunDN nd SKM + reprogrmming systems. Supplementry Tle 5 Relted to Supplementry Figure 7. Showing gene list in which gene ws regulted when overexpression in MEF, nd their expression pttern when overexpression JunDN or in MEF. Supplementry Tle 6 Sttistics souse dt.
SUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
Supplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
SUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
TNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
SUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
SUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
SUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
Supplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
SUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
SUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
Supplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
SUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Supplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
supplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
SUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
SUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
SUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
SUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
Cos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
![NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]](/thumbs/92/110177253.jpg "NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]")
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
Supplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
D14 D 10 D 7. Untreated CYTOXAN 5-FU
Dipeptidylpeptidse Negtively Regultes Colony Stimulting Fctor Activity nd Stress Hemtopoiesis. Hl E. Broxmeyer, Jonthn Hoggtt, Hether A. O Lery, Chrlie Mntel, Brhmnnd R. Chitteti, Scott Cooper, Steven
Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
SUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Figure 1 a
% DAPI + Are Supplementry Figure 1 MOI 1 MOI.5 MOI.25 5 4 3 MOPC MOPC, LCMV reltive VL4 expression 2 1 d1 d2 d3 MOI.125 MOI.625 untreted Supplementry Figure 1: LCMV replictes in MOPC without ffecting cell
SUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
Unique roles of the unfolded protein response pathway in fungal. development and differentiation. Kwang Woo Jung, Yee Seul So, & Yong Sun Bahn *
Supplementry Informtion Unique roles of the unfolded protein response pthwy in fungl development nd differentition Kwng Woo Jung, Yee Seul So, & Yong Sun Bhn * Contents Supplementry Figure S1 Supplementry
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
Heparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
SUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
SUPPLEMENTARY INFORMATION
DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved logfc SUPPLEMENTARY INFORMATION
Molecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
Type II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Supplemental Figures and Legends
Supplementl Figures n Legens Epigeneti trgeting of Hegehog trnsriptionl output through BET romoomin inhiition Yujie Tng 1,2, Shrreh Gholmin 2, Simone Shuert 1,2, Mine I. Willrson 3, Alex Lee 4, Prtiti
SUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
Supplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
Hormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
Adipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Chow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
SUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
SUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
Supplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
SUPPLEMENTARY INFORMATION
doi:.38/nture99 Dy Dy Dy 3 Dy 4 Bleed INDO INDO INDO INDO INDO INDO INDO INDO 3 7 CFU-GM/ml lood 6 4 3 Indomethcin Biclein + Indo + Bcln c WBC PMN LYMPH MONO RBC PLT Ctrl 7.4±.9.4±.8.4±.39.37±.6 8.88±.
11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None
unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,
supplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplemental Figure 1 A
Supplemental Figure 1 1 2 3 4 2 FLG-ZFP89 endogenous ZFP89 CTIN 1. F9 2. F9 [S/FLG-Zfp89] 3. ESC 4. ESC [2lox/FLG-Zfp89]. Zfp89 ESC Flag-ZFP89 expression/endogenous ZFP89 expression 1 1 ECCs ESCs ChIP-seq
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature19360 Supplementary Tables Supplementary Table 1. Number of monoclonal reads in each sample Sample Number of cells Total reads Aligned reads Monoclonal reads
SUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
Supplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK