Expanded View Figures
|
|
|
- Kenneth Parsons
- 5 years ago
- Views:
Transcription
1 Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old wild-type (WT; C57Bl/6J) or obese/diabetic monogenic (db/db; BKS.Cg-m +/+ Lepr DB/J; n = 4/group, A D), New Zealand Black (NZB) and polygenic obese/pre-diabetic New Zealand Obese (NZO; n = 4/group; E H), as well as young (i.e. 3 months) and aged (i.e.22 months; n = 5/group; I L), mice were fed ad libitum (fed) or fasted for 24 h (fasted). Blood glucose (BG, A, E, I) and serum acylcarnitine species including free carnitine (C0; B, F, J), acylcarnitine (C2; C, G, K) and short-chain acylcarnitines (SCAC; D, H, L) were measured. Data are mean SEM. n = 4/group. Effect of genotype, *P < 0.05, **P < 0.01, ***P < Effect of nutritional state: # P < 0.05, ## P < 0.01, ### P < The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV1
2 EMBO Molecular Medicine Liver GADD45b and metabolism Jessica Fuhrmeister et al A B C D E F G H I J Figure EV2. Systemic GADD45b deletion affects metabolic regulation under conditions of heightened lipid metabolism. A C Male GADD45b +/+ (WT) or GADD45b / (KO) were fed ad libitum (fed) or fasted for 24 h (fasted), and subsequently refed for 24 h(n = 4 6/group). Body weight (A), food intake (B) and physical activity (C) were measured. D J In a distinct cohort, male GADD45b +/+ (WT) or GADD45b / (KO) mice were fasted for 24 h (fasted) (n = 5 8/group) with blood samples taken before and during fasting. Liver mrna expression of Gadd45 family members (D). Body weight (E) before and after fasting and fasted tissue weights (F). Selected liver metabolites (G) as well as blood glucose (H) and serum glycerol (I) and acylcarnitines (J). Data information; Data are mean SEM. Effect of genotype, *P < 0.05, **P < 0.01, ***P < Effect of nutritional state: # P < 0.05, ## P < 0.01, ### P < The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV2 EMBO Molecular Medicine ª 2016 The Authors
3 A B C D E F G H I J K Figure EV3. Liver-restricted GADD45b manipulation affects systemic metabolic homoeostasis. A D Albumin (A), Cluster of differentiation 31 (B), desmin (C) and EGF-like module-containing mucin-like hormone receptor-like 1 (D) mrna expression were measured from fractionated parenchymal hepatocytes (Hepas) as well as non-parenchymal cells (NP) from C57Bl/6J mice fed ad libitum (fed) or fasted for 24 h (fasted) (n = 3/group). E Male C57Bl/6J mice with (AAV-G45b mir) or without (AAV-NC mir) liver/hepatocyte-restricted GADD45b silencing were fed or fasted for 24 h(n = 6/group). Liver Gadd45b mrna expression was measured. F H Male GADD45b +/+ (WT) or GADD45b / (KO) mice fasted for 24 h (fasted) with (AD-G45b OE) or without (AD-NC) liver-restricted Gadd45b over-expression (n = 7 8/group). Liver mrna expression of Gadd45b (F). Serum non-esterified fatty acids (G) and triglycerides (H) were measured. I K Male C57Bl/6J mice with (AAV-G45b mir) or without (AAV-NC mir) liver/hepatocyte-restricted GADD45b silencing were chronically fed a normal-fat diet (NFD) or high -fat diet (HFD) and were sacrificed in the ad libitum fed state (n = 6 8/group). Body (I), liver (J) and perigonadal white adipose tissue (K) masses. Data information: Data are mean SEM. Effect of genotype, *P < 0.05, **P < 0.01, ***P < Effect of nutritional state: # P < 0.05, ## P < 0.01, ### P < The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV3
4 EMBO Molecular Medicine Liver GADD45b and metabolism Jessica Fuhrmeister et al A B C D E Figure EV4. Liver GADD45b expression modulates metabolic control in type 2 diabetes. A D Male 12-weeks-old wild-type (WT; C57Bl/6J) or obese/diabetic (db/db; BKS.Cg-m +/+ Lepr DB/J) mice with (AD-G45b OE) or without (AD-NC) liver-restricted GADD45b over-expression were fasted for 24 h(n = 4 6/group). Liver mrna expression of Gadd45b (A). Body mass (B), the change in body mass during the experiment (C) and liver mass (D). Data are mean SEM. Effect of genotype, *P < 0.05, **P < 0.01, ***P < Effect of viral manipulation state: # P < 0.05, ## P < 0.01, ### P < E Fasting HOMA-IR in correlation with liver GADD45B mrna expression in men as in Fig 5 (n = 37). Inserts show r 2 values and P-values from Spearman s correlation test. Data information: The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV4 EMBO Molecular Medicine ª 2016 The Authors
5 A B C D E Figure EV5. Liver GADD45b controls liver fatty acid handling by cytosolic FABP1 retention. A, B Male 12-weeks-old wild-type (WT; C57Bl/6J) or obese/diabetic (db/db; BKS.Cg-m +/+ Lepr DB/J) mice with (Ad-G45b OE) or without (Ad-NC) prior liver-restricted GADD45b over-expression were fasted and insulin was injected with livers harvested shortly thereafter and subsequently liver proteins were subjected to immunoblotting for insulin signalling proteins including phosphoprotein kinase B (PKB/Akt; A) and glycogen synthase kinase beta (GSK3b; B). Inserts show representative blots (n = 6/group). C, D Representative immunoblots (C) and relative abundance quantifications (D; n = 6) of proteins and phosphoproteins including light chain 3 isoform B (LC3B), S6 kinase 1 (S6K1), p42/44 mitogen activated protein kinase (ERK1/2), eukaryotic initiation factor 2 alpha (eif2a), glucose regulated protein 78 (GRP78/HSPA5), fatty acid transport protein 2 (FATP2/SLC27A2), cluster determinant 36 (CD36/FAT) and fatty acid binding protein 1 (FABP1) from fasted GADD45b +/+ (WT) or GADD45b / (KO) mice. E Representative immunoblots of HNF4a (nuclear marker), BCKDE1A (mitochondrial marker), NTCP (microsomal marker) and ARG1 (cytosolic marker) from liver whole tissue lysate (W) as well as fractionated organelles/intraceuular structures including nuclei (N), mitochondria (MT), microsomes (MS) and cytoplasm (C), from GADD45b +/+ (WT) and GADD45b / (KO) mice. Data information: Data are mean SEM. The statistical test used and respective P-value outputs can be found in Appendix Table S1. EV5
Fasting-induced liver GADD45b restrains hepatic fatty acid uptake and improves metabolic health
Research Article Fasting-induced liver GADD45b restrains hepatic fatty acid uptake and improves metabolic health Jessica Fuhrmeister 1, Annika Zota 1,2,3, Tjeerd P Sijmonsma 1, Oksana Seibert 1,Sßahika
Fasting-induced liver GADD45b restrains hepatic fatty acid uptake and improves metabolic health
Research Article Fasting-induced liver GADD45b restrains hepatic fatty acid uptake and improves metabolic health Jessica Fuhrmeister 1, Annika Zota 1,2,3, Tjeerd P Sijmonsma 1, Oksana Seibert 1,Sßahika
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Fasting-induced liver GADD45 restrains hepatic fatty acid uptake and improves metabolic health.
EMBO Molecular Medicine Peer Review Process File - EMM-2015-05801 Fasting-induced liver GADD45 restrains hepatic fatty acid uptake and improves metabolic health. Jessica Fuhrmeister, Annika Zota, Tjeerd
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Pathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis
Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
CHY2026: General Biochemistry. Lipid Metabolism
CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)
Oxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
Fatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders
Deficiency Disorders in Pediatrics Published online: December 9, 216 Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders Gary D. Lopaschuk Department of Pediatrics, University
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals
Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Tissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
Lehninger 5 th ed. Chapter 17
Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals
University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Table of Contents. Section 1 Glycolysis and Fermentation. Section 2 Aerobic Respiration
Table of Contents Section 1 Glycolysis and Fermentation Section 2 Aerobic Respiration Objectives Identify the two major steps of cellular respiration. Describe the major events in glycolysis. Compare lactic
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
Obesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
University of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher
MILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Mango Modulates Body Fat and Plasma Glucose and Lipids in Mice Fed High Fat Diet
Title of Study: Principal Investigator: Co-Investigators: Mango Modulates Body Fat and Plasma Glucose and Lipids in Mice Fed High Fat Diet Dr. Edralin A. Lucas Nutritional Sciences Department Oklahoma
Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Successful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Antibodies for Unfolded Protein Response
Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)
23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Metabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
Chapter 22, Fatty Acid Metabolism CH 3 (CH 2 ) 14 CO 2 R C C O2 CH 2 OH O R. Lipase + 3 H 2 O
hapter 22, Fatty Acid Metabolism Pages: 603-613 I. Introduction - Fatty acids have 4 major physiological roles: - omponents of phospholipids and glycolipids (membranes) - Attachment to Proteins targets
FADD is a key regulator of lipid metabolism
Research Article FADD is a key regulator of lipid metabolism Hongqin Zhuang 1, Xueshi Wang 1, Daolong Zha 1, Ziyi Gan 1, Fangfang Cai 1, Pan Du 1, Yunwen Yang 1, Bingya Yang 1, Xiangyu Zhang 1, Chun Yao
number Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Metabolic responses to leptin in obese db/db mice are strain dependent
Am J Physiol Regulatory Integrative Comp Physiol 281: R115 R132, 2001. Metabolic responses to leptin in obese db/db mice are strain dependent RUTH B. S. HARRIS, TIFFANY D. MITCHELL, XIAOLANG YAN, JACOB
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution
A liver stress-endocrine nexus promotes metabolic integrity during dietary protein dilution Adriano Maida, 1 Annika Zota, 1 Kim A. Sjøberg, 2 Jonas Schumacher, 3 Tjeerd P. Sijmonsma, 3,4 Anja Pfenninger,
IMMUNE FUNCTION AND METABOLIC STRESS DUE TO PRECALVING ENERGY LEVEL AND POSTCALVING MASTITIS CHALLENGE IN DAIRY COWS
IMMUNE FUNCTION AND METABOLIC STRESS DUE TO PRECALVING ENERGY LEVEL AND POSTCALVING MASTITIS CHALLENGE IN DAIRY COWS Daniel Graugnard, Massimo Bionaz, Erminio Trevisi, Manishi Mukesh, Mario Ordonez, Kasey
Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,