Ischemia-Induced Neuronal Damage: A Role for Calcium/Calmodulin-Dependent Protein Kinase II

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Ischemia-Induced Neuronal Damage: A Role for Calcium/Calmodulin-Dependent Protein Kinase II"

Transcription

1 Journal of Cerebral Blood Flow and Metabolism 16: The International Society of Cerebral Blood Flow and Metabolism Published by Lippincott-Raven Publishers, Philadelphia Rapid Communication Ischemia-Induced Neuronal Damage: A Role for Calcium/Calmodulin-Dependent Protein Kinase II M. Neal Waxham, *James C. Grotta, talcino J. Silva, *Roger Strong, and *Jaroslaw Aronowski Departments of Neurobiology and Anatomy and * Neurology, University of Texas Medical School at Houston, Texas; and tcold Spring Harbor Laboratory, Cold Spring Harbor, New York, U.S.A. Summary: Calcium/calmodulin-dependent protein kinase II (CaM-kinase) is a central enzyme in regulating neuronal processes. Imbalances in the activity and distribution of this enzyme have been reported following in vivo ischemia, and sustained decreases in activity correlate with subsequent neuronal death. In this report, mice that had been rendered deficient in the alpha subunit of CaMkinase using gene knock-out technology were utilized to determine whether this enzyme is causally related to ischemic damage. Using a focal model of cerebral ischemia, we showed that homozygous knock-out mice lacking the alpha subunit exhibited an infarct volume almost twice that of wild-type litter mates. Heterozygous mice exhibited slightly less damage following ischemia than did homozygous mice, but infarct volumes remained significantly larger than those of wild-type litter mates. We conclude that reduced amounts of the alpha subunit of CaM-kinase predisposes neurons to increased damage following ischemia and that any perturbation that decreases the amount or activity of the enzyme will produce enhanced susceptibility to neuronal damage. Key Words: Kinase-Protein phosphorylation-ischemia-excitotoxicity-transgenic-gene knock-out. Increased intracellular calcium is a common signaling mechanism essential for regulating many neuronal processes. Under normal physiological conditions, the concentration of intracellular calcium is stringently controlled. However, during energy compromised states, such as follows cessation of blood flow to the brain (ischemia), the concentration of intracellular calcium rises and remains elevated, sometimes initiating a chain of events that leads to irreversible neuronal damage (Siesjo and Bengtsson, 1989; Tymianski et ai., 1993). How sustained increases in calcium leads to neuronal toxicity is a matter of much speculation. Several current hypotheses suggest that an increased concentration Received August 16, 1995; final revision received September II, 1995; accepted October II, Address correspondence and reprint requests to Dr. M. N. Wax ham at The Department of Neurobiology and Anatomy, University of Texas Medical School at Houston, P. O. Box 20708, Houston, TX 77225, U.S. A. Abbreviations used: ANOY A, analysis of variance; CaMkinase, calcium/calmodulin-dependent protein kinase II; NMDA; N-methyl-D-aspartate; PCR, polymerase chain reaction; SD, standard deviation. of intracellular calcium leads to excessive activation of calcium-dependent enzyme systems (Choi, 1990; Siesjo and Bengtsson, 1989). Enzyme hyperactivation can then produce damage either directly by intracellular breakdown (e.g., calciumdependent proteases, lipases, and nucleases) or indirectly by producing an imbalance in neuronal homeostasis (e.g., through alterations in calciumdependent protein kinases). Protein phosphorylation plays a major role in adapting a neuron's enzymatic machinery in response to environmental changes (Hanson and Schulman, 1992); thus, irreversible losses in protein kinase activity would be expected to significantly compromise a neuron's capacity to survive, particularly under extreme conditions such as cerebral ischemia. We and others described that an irreversible loss of calcium/calmodulin-dependent protein kinase II (CaM-kinase) activity was correlated with neuronal damage following in vivo ischemia (Taft et ai., 1988; Churn et ai., 1990; Aronowski et ai., 1992; Hanson et ai., 1994; Shackelford et ai., 1995). Based on these results, we postulated that decreased CaM- 1

2 2 M. N. WAXHAM ET AL. kinase activity leads to neuronal damage. Experimental attempts to address this question using administration of broad spectrum protein kinase inhibitors (e.g., staurosporine and H-7) have met with controversial results. Both increases (Madden et ai., 1990) and decreases (Hara et ai., 1990) have been reported for neuronal damage following in vivo ischemia after administration of these inhibitors. The reasons for these discrepancies are probably manifold; however, the lack of the inhibitors' efficacy or specificity may be a major factor. Such discrepancies can now be resolved using gene knock-out technology, an approach used recently to show that mice deficient in neuronal nitric oxide synthase exhibited increased resistance to damage following focal cerebral ischemia (Huang et al., 1994). Recently, mice lacking the alpha subunit of CaM-kinase (the alpha subunit is a neuron-specific isoform of this enzyme) were constructed using knock-out technology (Silva et ai., 1992a; 1992b), thus providing a unique opportunity to investigate CaM-kinase's role in mediating neuronal damage following ischemia. Results presented in this report provide the first direct indication that targeted disruption of a single protein kinase, CaM-kinase, leads to increased neuronal damage following ischemia. Mice METHODOLOGY Offspring bred from heterozygous CaM-kinase knockouts were used for all of these studies. The original mutant mice in the 129 cvj background were backcrossed in the C57B1I6J strain to minimize complications of heterogeneous background. Every animal was genotyped using polymerase chain reaction (PCR) of a DNA sample from the tail. The ( + / + ) mice exhibited a fragment of 290 bp, the (-/ -) mice exhibited a product of 320 bp, and the ( + / -) mice exhibited a product at both lengths (data not shown). Focal cerebral ischemia Focal ischemia was induced in mice by a modification of a protocol established in rats (Aronowski et ai., 1994). Between 5 and 7 weeks of age, animals were anesthetized with an intraperitoneal injection of chloral hydrate (0.35 g/kg), the skull exposed, and a small burr hole made over the middle cerebral artery. Body temperature was monitored using a rectal thermometer and maintained at 36.5 ± 0.35 C through use of a warming blanket for the entire period of occlusion and the first hour of reperfusion. Occlusion of the left middle cerebral artery was produced by sliding a in diameter stainless steel wire under the exposed middle cerebral artery just distal to its origin from the internal carotid artery. When slightly elevated, the wire visibly occluded the lumen of the artery. The ipsilateral common carotid artery was then occluded by clamping with an atraumatic aneurysm clip. Cerebral per- fusion at the surface of the cortex was measured 2 mm distal from the site of middle cerebral artery occlusion using a laser Doppler flowmeter (Model BPM 2, Vesamedic, St. Paul, MN, U.S.A.). After 150 min of occlusion, reperfusion was established by reversing the procedure. Infarct volume measurements At -21 h following re-establishment of blood flow, mice were anesthetized with chloral hydrate and perfused with saline through the left ventricle. The brain was removed, sectioned into 1 mm coronal sections, and stained with 2% 2, 3,5-triphenyltetrazolium chloride for 30 min at room temperature. Sections were then fixed in 10% buffered formalin. Total infarct volume was measured by capturing still video images of each section and outlining the unstained (infarcted) surface of each slice. Total volume was reconstructed by summing the surface areas of infarcted tissue from each 1 mm section. This process is almost identical to that described for analyzing infarct volumes in the rat model of focal ischemia (Aronow ski et ai., 1994). Both the investigator accomplishing the surgeries and the investigator measuring infarct volumes were blinded as to the genotype of the animals. Statistical significance was determined by analysis of variance (ANOV A) and the Newman-Keuls test; variability in the values reported in the text are as standard deviations (SDs). SDS-PAGE and Western blot analysis of brain extracts After 150 min of focal ischemia, mice were anesthetized with ether and decapitated. The brain was removed rapidly (within 15 s) and immersed in ice cold phosphatebuffered saline. The two hemispheres were separated, the cortexes isolated, and each cortex was extracted into 1 ml of homogenization buffer [50 mm HEPES (ph 7.4), 0.1% Triton X-lOO, 4 mm EGTA, 10 mm EDTA, 15 mm Na4P 2 07, 100 mm I)-glycerophosphate, 25 mm NaF, 0.1 mm leupeptin, 75 f.lm pepstatin, and 0.1 mg/ml aprotinin] with 15 strokes of a glass/teflon homogenizer. Equal amounts of homogenate protein were solubilized in SDS-sample buffer and separated on a 10% SDSpolyacrylamide gel. After electrophoresis, the gel was transferred to nitrocellulose as described (Kolb et ai., 1995) and stained with either monoclonal antibody 2D5 (specific to the alpha subunit of CaM-kinase), CB-1)1 (specific to the beta subunit of CaM-kinase and supplied by Dr. Howard Schulman), or C4 (a monoclonal antibody specific to all isoforms of actin and supplied by Dr. Jim Lessard). Immunostained bands were visualized with alkaline-phosphatase conjugated goat anti-mouse (Promega, Madison, WI, U.S.A.), followed by 5-bromo- 1-chloro-indolyl phosphate and nitro-blue tetrazolium (Promega). RESULTS To select a duration of ischemia for this comparative study, a dose-response curve was constructed of duration of ischemia versus infarct volume using wild-type C57Bl/6J mice (the parent strain to the knock-outs) and employing an adaptation of the reversible left middle cerebral artery and ipsilateral common carotid artery (MCA/CCA) occlusion J Cereb Blood Flow Metab, Vol. 16, No. I, 1996

3 FOCAL ISCHEMIA IN CAM-KINASE KNOCK-OUT MICE 3 model (data not shown). A 150 min occlusion with 21 h of reperfusion in 5-6 week old wild-type mice provided a just submaximal infarct volume [21.9 ± 6.4 mm 3 (n = 6)] and was selected for the comparative analysis. The lesion involves primarily cortical layers; however, some minor involvement of subcortical areas was also evident. All measurements reported in this study included only cortical infarct volumes. Heterozygous CaM-kinase knock-out parents were mated and the resulting off-spring genotyped using PCR amplification of DNA isolated from the tail. At 5-7 weeks of age, animals were randomly grouped and subjected to 150 min of occlusion followed by 21 h of reperfusion. Littermate control mice ( + / + ) exhibited approximately the same volume of infarct [18.8 ± 5. 1 mm 3 (n = 6)] as the wild-type C57B1I6 mice. In contrast, significantly larger infarct volumes were found in the (+/ -) mice (n = 5) (32.0 ± 8. 1 mm 3 p < 0.05) (Fig. IA). Even larger infarct volumes were found in the mutant (-/-) mice (n = 5) (38.28 ± 11.0 mm 3 p < 0.01) (Fig. IA). Plotting the volume differences of (+/+), (+/ -) and (-/-) mice over the rostral to caudal extent of the brain indicated that the volume differences were not significant until the fourth mm from the rostral pole (Fig. 1B). This is consistent with the extent of tissue supplied by the middle cerebral artery covering the lateral aspects of the cortex. Preocclusion cerebral blood flow was not different between any of the groups and occlusion produced 93-95% reductions in every animal. Carbon black fills of the cerebrovasculature also indicated there was no macroscopic differences between the groups (data not shown). There was also no evidence of overt seizure activity before, during, or after induction of ischemia in any of these 5-7- week-old mice tested in our study. Cortical tissue from the ipsilateral and contralateral cortex of a ( + / +), ( + / -), and ( -/ - ) animal following 150 min of ischemia was analyzed by Western blot and is shown in Fig. 2. The cortex of each animal was separated into ipsilateral, I, (the side of the occlusion) and contralateral, C, (the side opposite occlusion) and processed as described in Methods. Constant amounts of homogenate protein were analyzed by SDS-PAGE and immunostaining using monoclonal antibodies specific to the alpha and beta subunits of CaM-kinase and actin. There was no detectable alpha subunit of CaM-kinase in ( - / -) animals, while the ( + / -) animals exhibited about half of the amount present in wild-type animals ( + / + ). These same extracts were also probed with a monoclonal antibody specific for the beta C') E.s 40 w :ie ::::> --l 0 30 > I- U a:: 20 «LL z 10 N E E «LU a: «6.0 LU U «5.0 LL a: 4.0 :::> (f) f- 3.0 U a: «2.0 LL r--- p<0.01 Ir-- p<0.05 I (6) (5) (5) (+ /+) ( +/-) (+1+) 0 (+1-) 0 (-1-) GENETIC ISOTYPE (-/-) DISTANCE FROM ROSTRAL POLE OF CORTEX (mm) FIG. 1. A: Wild-type (+ / +), heterozygous (+ / - ), and homozygous ( - / - ) CaM-kinase alpha subunit knock-outs were subjected to transient tandem left middle cerebral artery and common carotid artery occlusion for 150 min using a slight adaptation of our previously described protocol (see Methods). Infarct volumes were determined 21 h after induction of ischemia. Averaged infarct volumes ±SD for animals are shown. Cortical infarct volumes from individual animals are indicated as black dots within each group. The number of animals in each group is shown in parentheses above the bars. Significance was determined by ANOVA followed by Newman-Keuls test. B: Plot of rostral to caudal extent of infarction in wild-type and mutant mice. The infarct area is plotted against the distance from the rostral pole (0 mm) to the caudal pole (8 mm) of the cortex at 1 mm intervals. Black circles and white squares represent the infarct areas of the homozygous and heterozygous knock-out mice, respectively. White circles represent the infarct volumes for wildtype littermates. Occlusion was for 150 min and reperfusion for 22 h. Animal surgeries and infarct volume measurements were as described in Methods. Error bars indicate SDs. Significance was determined by AN OVA followed by Newman Keuls test. Volumes indicated by an asterisk were significantly different from control at p < (A) (B) J Cereb Blood Flow Metab, Vol. 16, No.1, 1996

4 4 M. N. WAXHAM ET AL. beta alpha actin (+/+) I c (+/-) c ( -/-) FIG. 2. Western blot of cortical homogenates from knock-out mice and wild-type mice. Homogenates from wild-type (+ / + ), heterozygous (+ / - ), and homozygous ( - / -:- ) mice were prepared as described in Methods. These animals all received 150 min of unilateral focal ischemia, and the brains were harvested without reperfusion. I and C represent homogenates prepared from the ipsilateral and contralater 1 cortexes to the ischemic site, respectively. Beta subunit staining was accomplished with monoclọnal antibody CB-.1, the alpha subunit with monoclonal antibody 205, and aclin with monoclonal antibody C4. Beta staining was accomplished with 10 f.lg of total protein per lane and the alpha and actin immunostaining with 2.5 f.lg of total protein per lane. subunit of CaM-kinase The results show qualitatively (this colorimetric technique for visualizing immunostained proteins does not lend itself to accurate quantitation) that there was neither a large increase nor decrease in the amount of beta subunit in the ( + 1-) or ( -1-) animals relative to the ( ) animal. Finally, a monoclonal antibody specific to actin was used as an internal control, and no observable differences were found in actin levels among (+1+), (+1 -), or (-1-) mice. Additionally, there was no detectable difference in the overall pattern of proteins on the Western blot, as revealed by Ponceau S staining (data not shown). Immunostaining for the alpha and beta subunits of CaM-kinase and actin was not appreciably different between the ipsilateral and contralateral sides of each animal's cortex after 150 min of ischemia (Fig. 2). These results are consistent with those from studies of the rat model of ischemia (Aronowski et ai., 1992; Hanson et ai., 1994) that indicate there is little loss in the amount of CaM-kinase enzyme due to proteolysis, at least up to 2 h of ischemia, in these mice. Our data are also consistent with previous reports (Silva et ai., 1992b) indicating that (-1-) and (+1-) animals exhibit -50 and 71% of CaMkinase activity relative to (+ 1 +) mice, respectively. DISCUSSION Previous data provided strong correlative evidence that CaM-kinase might play a role in neuronal c damage following ischemia (Taft et al., 1988; Churn et ai., 1990; Aronowski et ai., 1992; Hanson et ai., 1994; Shackelford et ai., 1995). A loss of CaMkinase activity was detected immediately after ischemia in all brain regions studied; however, only in regions where the loss of activity was permanent was damage eventually manifest (Aronowski et ai., 1992; Hanson et ai., 1994). Congruent with these in vivo studies are two recent reports that showed that activation of the N-methyl-D-aspartate (NMDA) subtype of glutamate receptor in neuronal culture models also produced decreased CaM-kinase activity (Chum et ai., 1995; Morioka et ai., 1995) that further correlated with neuronal death (Chum et ai., 1995). In the present study, mice engineered to be deficient in the alpha subunit of CaM-kinase were utilized to directly test the hypothesis that decreased CaM-kinase content and/or activity leads to increased neuronal damage following ischemia. Mutant mice exhibited no detectable alpha subunit mrna or protein (Silva et ai., 1992b); however, there remains significant CaMkinase activity in brain homogenates of the (-1-) mice due to contribution from other CaM-kinase isoforms. This decreased activity is consistent with the immunostaining of the alpha subunit presented in Fig. 2. Apparently, the CaM-kinase activity remaining in the ( + 1-) and ( -1-) animals is either quantitatively or qualitatively different than that in ( ) animals and is insufficient to provide protection from ischemic damage. However, we cannot eliminate the possibility that other compensatory mechanisms (for example, up-regulation of another isoform of CaM-kinase) might influence the outcome to ischemia in these animals. Light (Silva et ai., 1992b) and electron microscopy (Comery et ai., 1994) failed to find measurable differences in the cell number, morphology or synaptic organization in the hippocampus of ( -1 - ) or ( + 1-) CaM-kinase knock-out mice relative to ( ) leaving little evidence to support the hypothesis that structural differences in the neurons cause the increased susceptibility to ischemic damage. While we do not yet have quantitative data describing the light level morphology of the cortices of these animals, no gross morphologic differences were detected in the brains of any of the animals included in this study and we have no a priori reason to believe that synaptic connections will be different in the cortex than they are in the hippocampus. Finally, no apparent differences were detected in electrophysiologically measured synaptic responses of hippocampal slices prepared from ( ) or ( -1-) animals, suggesting basal excitatory and inhibitory synaptic transmission is intact in these animals (Silva et ai., 1992b; Chapman et ai., 1995). In par- J Cereb Blood Flow Metab. Vol. 16. No

5 FOCAL ISCHEMIA IN CAM-KINASE KNOCK-OUT MICE 5 ticular, non-nmda and NMDA mediated synaptic responses were indistinguishable from controls (Silva et ai., 1992b). Therefore, the increased damage we observe is not likely due to a difference in basal glutamate receptor function. Recently, Chapman et ai. (1995) showed that hippocampal slices from CaM-kinase knock-out mice exhibit greater posttetanic potentiation relative to their litter mates, suggesting that normal amounts of CaMkinase alpha subunit restricts the amount of glutamate released after a tetanizing stimulus. It is possible that the increased damage detected in ( + / - ) and ( - / - ) animals following an ischemic insult is due to a similar excessive release of glutamate. This hypothesis is currently under investigation. Earlier contentions suggested that plasticity and pathology might have underlying mechanistic similarities (Lynch and Seibert, 1989; Westgate et ai., 1994). Interestingly, CaM-kinase knock-out animals also exhibit defects in neuronal plasticity, specifically long-term potentiation (Silva et ai., 1992b), and the induction of long-term potentiation was shown earlier to be prevented by CaM-kinase inhibitors (Malenka et ai., 1989; Malinow et ai., 1989). These animals also show deficits in certain spatial memory tasks (Silva et ai., 1992a), have abnormal fear responses and exhibit aggressive behavior (Chen et ai., 1994). Most recently, Butler et ai. (1995) showed that these mice exhibited spontaneous seizure activity in late adulthood (>6 months of age). Apparently, as these mice age, an imbalance in the brain occurs favoring neuronal hyperexcitability that is eventually expressed as spontaneous seizure activity. Whether this spontaneous seizure activity complicates interpretations of the earlier studies demonstrating learning deficits in these mice is difficult to ascertain and is reviewed in Butler et ai. (1995). However, seizure activity does not always lead to learning impairments (Holmes, 1991). Also unclear at this time is a mechanistic explanation for these observations. As cited above (see Chapman et ai., 1995 for discussion), hippocampal slices from these animals appear deficient in their ability to control the release of glutamate suggesting CaM-kinase plays some role in downregulating the release process under conditions of repetitive firing. An inherent difference in neuronal excitability, an imbalance in local feedback inhibition, or an alteration in the presynaptic release machinery itself could explain these results. In any case, for the first time, a single genetic abnormality (a deficiency in the alpha subunit of CaM-kinase) can be attributed to 1) a deficiency in learning and memory, 2) the production of spontaneous seizure activity and 3) enhanced susceptibility to ischemia. We suggest that CaM-kinase is one of the key molecules underlying yet to be defined mechanisms of both plasticity and pathology. From results presented in this report, we conclude that CaM-kinase activity plays some neuroprotective role and when lost after ischemia (Churn et ai., 1990; Aronowski et ai., 1992; Hanson et ai., 1994; Shackelford et ai., 1995) or when inhibited by treatment with kinase inhibitor (Madden et ai., 1990) or gene knock-outs, neuronal damage is manifest. These results further suggest that if losses of CaM-kinase activity could be prevented during ischemia, or induced to return following ischemia, neurons might recover. Determining the mechanism of the irreversible loss of the enzyme will likely provide new therapeutic avenues for future treatment of cerebral ischemia and possibly other neurodegenerative diseases. Acknowledgment: We thank Tara Vicknair for help with photography and Dr. Howard Schulman (Stanford University) and Dr. Jim Lessard (Children's Hospital Research Foundation, Cincinnati, OH, U.S.A.) for their generous gifts of beta subunit specific and actin specific monoclonal antibodies. This work was supported by grants from the National Institutes of Health (J.C.O. and M.N.W.) and the Whitehall, Klingenstein and Beckman Foundations (A.J.S.). M.N.W. is also supported by a Research Career Development Award from the National Institutes of Health. REFERENCES Aronowski J, Grotta JC, Waxham MN (1992) Ischemia-induced translocation of Ca2 + /calmodulin-dependent protein kinase II: Potential role in neuronal damage. J Neurochem 58: Aronowski J, Ostrow P, Samways E, Strong R, Zivin JA, Grotta JC (1994) Graded bioassay for demonstration of brain rescue from experimental acute ischemia in rats. Stroke 25: Butler LS, Silva AC, Abeliovich A, Watanabe Y, Tonegawa S, McNamara JO (1995) Limbic epilepsy in transgenic mice carrying a Ca2 + /calmodulin-dependent kinase II a-subunit mutation. Proc Natl Acad Sci USA 92: Chapman PF, Frenguelli BG, Smith A, Chen C-M, Silva AJ (1995) The alpha-calcium-calmodulin kinase II: A bidirectional modulator of pre-synaptic activity. Neuron 14: Chen e, Rainnie DG, Greene RW, Tonegawa S (1994) Abnormal fear response and aggressive behavior in mutant mice deficient for alpha-calcium-calmodulin kinase II. Science 266: Choi DW (1990) Cerebral hypoxia: Some new approaches. and unanswered questions. J Neurosci 11: Churn SB, Taft we, Billingsley MS, Blair RE, DeLorenzo RJ (1990) Temperature modulation of ischemic neuronal death and inhibition of calcium/calmodulin-dependent protein kinase II in gerbils. Stroke 21: Churn SB, Limbrick D, Sombati S, DeLorenzo RJ (1995) Excitotoxic activation of the NMDA receptor results in inhibition of calcium/calmodulin kinase II activity in cultured hippocampal neurons. J Neurosci 15: Comery TA, Kleim JA, Silva A, Greenough WT (1994) Hippocampal anatomy and ultrastructural morphology of alpha- J Cereb Blood Flow Metab, Vol. 16, No. 1, 1996

6 6 M. N. WAXHAM ET AL. calcium-calmodulin kinase II deletion mice. [Abstract] Soc Neurosci Abs 20: 1506 Hanson P, Schulman H (1992) Neuronal Ca2+/calmodulindependent protein kinases. Ann Rev Biochem 61 : Hanson SK, Grotta JC, Waxham MN, Aronowski J, Ostrow P (1994) Calcium/calmodulin-dependent protein kinase II activity in focal ischemia with reperfusion in rats. Stroke 25: Hara H, Onodera H, Yoshidomi M, Matsuda Y, Kogure K (1990) Staurosporine, a novel protein kinase C inhibitor, prevents postischemic neuronal damage in the gerbil and rat. J Cereb Blood Flow Metab 10: Holmes GL (1991) The long-term effects of seizures on the developing brain: clinical and laboratory issues. Brain Devel 13: Huang Z, Huang PL, Panahian N, Dalkara T, Fishman MC, Moskowitz MA (1994) Effects of cerebral ischemia in mice deficient in neuronal nitric oxide synthase. Science 265: Kolb SJ, Hudmon A, Waxham MN (1995) Ca2" /calmodulin kinase II translocates in a hippocampal slice model of ischemia. J Neurochem 64: Lynch G, Seybert P (1989) Links between long-term potentiation and neuropathology. Ann NY Acad Sci 568: Madden KP, Clark WM, Kochhar A, Zivin JA (1990) Effects of protein kinase C modulation on outcome of experimental CNS ischemia. Brain Res 547: Malenka RC, Kauer JA, Perkel DJ, Mauk MD, Kelly PT, Nicoll RA, Wax ham MN (1989) An essential role for postsynaptic calmodulin and protein kinase activity in long-term potentiation. Nature 340: Malinow R, Schulman H, Tsien RW (1989) Inhibition of postsyn- aptic PKC or CaMKII blocks induction but not expression of LTP. Science 245: Morioka M, Fukunaga K, Nagahiro S, Kurino M, Ushio Y, Miyamoto E (1995) Glutamate-induced loss of Ca2+ / calmodulin-dependent protein kinase II activity in cultured rat hippocampal neurons. J Neurochem 64: Shackelford DA, Yeh RY, Hsu M, Buzsaki G, Zivin JA (1995) Effect of cerebral ischemia on calcium/calmodulin-dependent protein kinase II activity and phosphorylation. J Cereb Blood Flow Metab 15: Siesjo BK, Bengtsson F (1989) Calcium fluxes, calcium antagonists, and calcium-related pathology in brain ischemia, hypoglycemia, and spreading depression: A unifying hypothesis. J Cereb Blood Flow Metab 9: Silva AJ, Paylor R, Wehner JM, Tonegawa S (1992a) Impaired spatial learning in alpha-calcium-calmodulin kinase II mutant mice. Science 257: Silva AJ, Stevens CF, Tonegawa S, Wang Y (1992b) Deficient hippocampal long-term potentiation in ex-calcium-calmodulin kinase II mutant mice. Science 257: Taft WC, Tennes-Rees KA, Blair RE, Clifton GL, DeLorenzo RJ (1988) Cerebral ischemia decreases endogenous calciumdependent protein phosphorylation in gerbil brain. Brain Res 447: Tymianski M, Uno M, Wallace MC, Spige1man L, Carlen PL, Tator CH, Charlton MP (1993) Cell permeant Ca2 + chelators reduce early excitotoxic and ischemic neuronal injury in vitro and in vivo. Neuron 11: Westage SA, Brown J, Aronowski J, Waxham MN (1994) Activity of Ca2 + /calmodulin-dependent protein kinase II following ischemia: A comparison between CAl and dentate gyrus in a hippocampal slice model. J Neurochem 63: J Cereb Blood Flow Metab, Vol. 16, No. 1, 1996

9.01 Introduction to Neuroscience Fall 2007

9.01 Introduction to Neuroscience Fall 2007 MIT OpenCourseWare http://ocw.mit.edu 9.01 Introduction to Neuroscience Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. Declarative memory conscious,

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Abstracts and affiliations

Abstracts and affiliations Dopamine Discovery Day August 30, 2012 Rikshospitalet Store auditorium, Oslo, Norway Organized by Linda H. Bergersen & Vidar Gundersen Institute of Basic Medical Sciences & Centre for Molecular Biology

More information

Protein serinelthreonine kinases (PKA, PKC and CaMKII) involved in ischemic brain pathology

Protein serinelthreonine kinases (PKA, PKC and CaMKII) involved in ischemic brain pathology Protein serinelthreonine kinases (PKA, PKC and CaMKII) involved in ischemic brain pathology Krystyna Domanska- Janik Laboratory of Molecular Neuropathology, Department of Neurochemistry, Medical Research

More information

Ethanol-mediated long-lasting adaptations of the NR2B-containing NMDA receptors in the dorsomedial striatum

Ethanol-mediated long-lasting adaptations of the NR2B-containing NMDA receptors in the dorsomedial striatum Article Addendum Channels 5:3, 205-209; May/June 2011; 2011 Landes Bioscience Article Addendum Ethanol-mediated long-lasting adaptations of the NR2B-containing NMDA receptors in the dorsomedial striatum

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Cognitive Enhancement Strategies. Florian Plattner, James A. Bibb

Cognitive Enhancement Strategies. Florian Plattner, James A. Bibb Cognitive Enhancement Strategies Florian Plattner, James A. Bibb A decline in memory and cognitive function is a natural aspect of aging. In addition, cognitive deficits are comorbid with many mental disorders

More information

IV. Cerebrovascular diseases

IV. Cerebrovascular diseases IV. Cerebrovascular diseases - Cerebrovascular disease denotes brain disorders caused by pathologic processes involving the blood vessels. - The three main pathogenic mechanisms are: 1. Thrombotic occlusion

More information

HYPERTENSIVE ENCEPHALOPATHY

HYPERTENSIVE ENCEPHALOPATHY HYPERTENSIVE ENCEPHALOPATHY Reversible posterior leukoencephalopathy syndrome Cause Renal disease Pheochromocytoma Disseminated vasculitis Eclampsia Acute toxemia Medications & illicit drugs (cocaine)

More information

Synaptic Transmission: Ionic and Metabotropic

Synaptic Transmission: Ionic and Metabotropic Synaptic Transmission: Ionic and Metabotropic D. Purves et al. Neuroscience (Sinauer Assoc.) Chapters 5, 6, 7. C. Koch. Biophysics of Computation (Oxford) Chapter 4. J.G. Nicholls et al. From Neuron to

More information

Ionotropic glutamate receptors (iglurs)

Ionotropic glutamate receptors (iglurs) Ionotropic glutamate receptors (iglurs) GluA1 GluA2 GluA3 GluA4 GluN1 GluN2A GluN2B GluN2C GluN2D GluN3A GluN3B GluK1 GluK2 GluK3 GluK4 GluK5 The general architecture of receptor subunits Unique properties

More information

SUPPLEMENTAL DATA. Lumen area ( m 2 )

SUPPLEMENTAL DATA. Lumen area ( m 2 ) Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental

More information

Pathophysiology and treatment of focal cerebral ischemia

Pathophysiology and treatment of focal cerebral ischemia J Neurosurg 77:337-354, 1992 Review Article Pathophysiology and treatment of focal cerebral ischemia Part 11: Mechanisms of damage and treatment Bo K. SIESJO, M.D. Laboratory for Experimental Brain Research,

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Neural stem cells and the neurobiology of ageing. Chen Siyun 1, Dawe G.S. 2

Neural stem cells and the neurobiology of ageing. Chen Siyun 1, Dawe G.S. 2 ABSTRACT Neural stem cells and the neurobiology of ageing Chen Siyun 1, Dawe G.S. 2 Department of Physics, Faculty of Science, National University of Singapore 10 Kent Ridge Road, Singapore 117546 The

More information

Following the seminal proposal of Hebb1 and many others, acquired learning

Following the seminal proposal of Hebb1 and many others, acquired learning Associative Learning and Long-Term Potentiation in Rodents: José M. Delgado-, MD, PhD Long-Term Potentiation (LTP) and Learning-Dependent Changes in Synaptic Strength Following the seminal proposal of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D. Chief Scientific Officer Trevigen, Inc. Gaithersburg, MD Poly(ADP-ribose) polymerases are promising therapeutic targets. In response

More information

VISUAL CORTICAL PLASTICITY

VISUAL CORTICAL PLASTICITY VISUAL CORTICAL PLASTICITY OCULAR DOMINANCE AND OTHER VARIETIES REVIEW OF HIPPOCAMPAL LTP 1 when an axon of cell A is near enough to excite a cell B and repeatedly and consistently takes part in firing

More information

Sample Lab Report 1 from 1. Measuring and Manipulating Passive Membrane Properties

Sample Lab Report 1 from  1. Measuring and Manipulating Passive Membrane Properties Sample Lab Report 1 from http://www.bio365l.net 1 Abstract Measuring and Manipulating Passive Membrane Properties Biological membranes exhibit the properties of capacitance and resistance, which allow

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/317/5841/183/dc1 Supporting Online Material for Astrocytes Potentiate Transmitter Release at Single Hippocampal Synapses Gertrudis Perea and Alfonso Araque* *To whom

More information

VS : Systemische Physiologie - Animalische Physiologie für Bioinformatiker. Neuronenmodelle III. Modelle synaptischer Kurz- und Langzeitplastizität

VS : Systemische Physiologie - Animalische Physiologie für Bioinformatiker. Neuronenmodelle III. Modelle synaptischer Kurz- und Langzeitplastizität Bachelor Program Bioinformatics, FU Berlin VS : Systemische Physiologie - Animalische Physiologie für Bioinformatiker Synaptische Übertragung Neuronenmodelle III Modelle synaptischer Kurz- und Langzeitplastizität

More information

Synaptic plasticity and addiction

Synaptic plasticity and addiction Synaptic plasticity and addiction Julie A. Kauer* and Robert C. Malenka Abstract Addiction is caused, in part, by powerful and long-lasting memories of the drug experience. Relapse caused by exposure to

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Diabetes Mellitus and Dementia. Andrea Shelton & Adena Zadourian

Diabetes Mellitus and Dementia. Andrea Shelton & Adena Zadourian Diabetes Mellitus and Dementia Andrea Shelton & Adena Zadourian Abstract Diabetes mellitus increases the risk for developing dementia...but there is inconsistency with the subtypes of dementia Diabetes

More information

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic

More information

E. Haritov, E. Angeleska and N. Boyadjieva Department of pharmacology and toxicology, Medical Faculty, Medical University So a

E. Haritov, E. Angeleska and N. Boyadjieva Department of pharmacology and toxicology, Medical Faculty, Medical University So a :.,..,, KETOGENIC DIET AND EPILEPSY: THE ROLE OF KETONE BODIES IN THE INFLUENCE N NEURONAL EXCITABILITY E. Haritov, E. Angeleska and N. Boyadjieva Department of pharmacology and toxicology, Medical Faculty,

More information

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed

More information

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype

More information

Rescue of neurological deficits in a mouse model for Angelman Syndrome by reduction of αcamkii inhibitory phosphorylation

Rescue of neurological deficits in a mouse model for Angelman Syndrome by reduction of αcamkii inhibitory phosphorylation Rescue of neurological deficits in a mouse model for Angelman Syndrome by reduction of αcamkii inhibitory phosphorylation Geeske M van Woerden 1, Karen D Harris 2, Mohammad Reza Hojjati 1, Richard M Gustin

More information

Blood Supply. Allen Chung, class of 2013

Blood Supply. Allen Chung, class of 2013 Blood Supply Allen Chung, class of 2013 Objectives Understand the importance of the cerebral circulation. Understand stroke and the types of vascular problems that cause it. Understand ischemic penumbra

More information

Inception, Total Recall, & The Brain: An Introduction to Neuroscience Part 2. Neal G. Simon, Ph.D. Professor Dept. of Biological Sciences

Inception, Total Recall, & The Brain: An Introduction to Neuroscience Part 2. Neal G. Simon, Ph.D. Professor Dept. of Biological Sciences Inception, Total Recall, & The Brain: An Introduction to Neuroscience Part 2 Neal G. Simon, Ph.D. Professor Dept. of Biological Sciences http://www.youtube.com/watch?v=wfmlgeh dije Summary from September

More information

Levels of Neurotransmitter Amino Acids in the Cerebrospinal Fluid of Patients with Acute Ischemic Insult

Levels of Neurotransmitter Amino Acids in the Cerebrospinal Fluid of Patients with Acute Ischemic Insult Neuroscience and Behavioral Physiology, Vol. 30, No. 5, 2000 Levels of Neurotransmitter Amino Acids in the erebrospinal Fluid of Patients with Acute Ischemic Insult V. I. Skvortsova, K. S. Raevskii, A.

More information

Teacher Memory Lanes. Memory Lanes. Lesson Overview

Teacher Memory Lanes. Memory Lanes.  Lesson Overview 1 Lesson Overview Students will be introduced to an online activity where they follow the routes different drivers in London and assess changes in their brain anatomy. Students will then research the various

More information

Long-Term Potentiation and Memory

Long-Term Potentiation and Memory Physiol Rev 84: 87 136, 2004; 10.1152/physrev.00014.2003. Long-Term Potentiation and Memory M. A. LYNCH Trinity College Institute of Neuroscience, Department of Physiology, Trinity College, Dublin, Ireland

More information

Abstract Introduction

Abstract Introduction Decreased colocalization of synapsin I and Munc13 within presynaptic axon terminals of the earthworm neuromuscular junction when stimulated could help determine how the two proteins interact during neurotransmitter

More information

1) Drop off in the Bi 150 box outside Baxter 331 or to the head TA (jcolas).

1) Drop off in the Bi 150 box outside Baxter 331 or  to the head TA (jcolas). Bi/CNS/NB 150 Problem Set 3 Due: Tuesday, Oct. 27, at 4:30 pm Instructions: 1) Drop off in the Bi 150 box outside Baxter 331 or e-mail to the head TA (jcolas). 2) Submit with this cover page. 3) Use a

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),

More information

DIET, AGING, and MIND Part II. Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University

DIET, AGING, and MIND Part II. Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University DIET, AGING, and MIND Part II Neal G. Simon, Ph. D. Dept. of Biological Sciences Lehigh University Outline: Diet, Aging, and Mind 1. Review 2. Brain Changes in Aging 3. Dementias 4. Dietary Interventions:

More information

Pathophysiology and treatment of focal cerebral ischemia

Pathophysiology and treatment of focal cerebral ischemia J Neurosurg 77: 169-184, 1992 Review Article Pathophysiology and treatment of focal cerebral ischemia Part I: Pathophysiology Bo K. SIESJO, M.D. Laborutory for Experimental Bruin Reseurch, Experrmc~ntul

More information

EXTRACELLULAR RECORDINGS OF SPIKES

EXTRACELLULAR RECORDINGS OF SPIKES EXTRACELLULAR RECORDINGS OF SPIKES Information about spiking is typically extracted from the high frequency band (>300-500Hz) of extracellular potentials. Since these high-frequency signals generally stem

More information

Michael Horowitz, MD Pittsburgh, PA

Michael Horowitz, MD Pittsburgh, PA Michael Horowitz, MD Pittsburgh, PA Introduction Cervical Artery Dissection occurs by a rupture within the arterial wall leading to an intra-mural Hematoma. A possible consequence is an acute occlusion

More information

Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy

Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Kavya Puchhalapalli CALS Honors Project Report Spring 2017 Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Abstract Malignant brain tumors including medulloblastomas and primitive neuroectodermal

More information

Dissecting the phenotypes of Dravet syndrome by gene deletion

Dissecting the phenotypes of Dravet syndrome by gene deletion doi:10.1093/brain/awv142 BRAIN 2015: 138; 2219 2233 2219 Dissecting the phenotypes of Dravet syndrome by gene deletion Moran Rubinstein, Sung Han, Chao Tai, Ruth E. Westenbroek, Avery Hunker, Todd Scheuer

More information

ETIOLOGY AND PATHOGENESIS OF HYPOXIC-ISCHEMIC ENCEPHALOPATHY

ETIOLOGY AND PATHOGENESIS OF HYPOXIC-ISCHEMIC ENCEPHALOPATHY ETIOLOGY AND PATHOGENESIS OF HYPOXIC-ISCHEMIC ENCEPHALOPATHY HYPOXIC-ISCHEMIC ENCEPHALOPATHY Hypoxic-İschemic Encephalopathy Encephalopathy due to hypoxic-ischemic injury [Hypoxic-ischemic encephalopathy

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Outline. Outline. Background Literature and Slides 10/23/2013. The Schizophrenia Research Forum online: Molecules, Neural Networks and Behavior

Outline. Outline. Background Literature and Slides 10/23/2013. The Schizophrenia Research Forum online: Molecules, Neural Networks and Behavior Background Literature and Slides Molecules, Neural Networks and Behavior Roberto Fernández Galán, PhD Assistant Professor of Neurosciences Mt. Sinai Health Care Foundation Scholar Alfred P. Sloan Research

More information

- Neurotransmitters Of The Brain -

- Neurotransmitters Of The Brain - - Neurotransmitters Of The Brain - INTRODUCTION Synapsis: a specialized connection between two neurons that permits the transmission of signals in a one-way fashion (presynaptic postsynaptic). Types of

More information

Cell, network and mouse modelling of genetic epilepsies for mechanism, diagnosis and therapy. December 7 th 2013

Cell, network and mouse modelling of genetic epilepsies for mechanism, diagnosis and therapy. December 7 th 2013 Cell, network and mouse modelling of genetic epilepsies for mechanism, diagnosis and therapy December 7 th 213 Steven Petrou, PhD Deputy Director, The Florey Institute Deputy Director, The Centre for Neural

More information

Modeling Excitatory and Inhibitory Chemical Synapses

Modeling Excitatory and Inhibitory Chemical Synapses In review, a synapse is the place where signals are transmitted from a neuron, the presynaptic neuron, to another cell. This second cell may be another neuron, muscle cell or glandular cell. If the second

More information

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell

More information

Excitatory/Inhibitory Synaptic Imbalance Leads to Hippocampal Hyperexcitability in Mouse Models of Tuberous Sclerosis

Excitatory/Inhibitory Synaptic Imbalance Leads to Hippocampal Hyperexcitability in Mouse Models of Tuberous Sclerosis Article Excitatory/Inhibitory Synaptic Imbalance Leads to Hippocampal Hyperexcitability in Mouse Models of Tuberous Sclerosis Helen S. Bateup, Caroline A. Johnson, Cassandra L. Denefrio, Jessica L. Saulnier,

More information

Portions from Chapter 6 CHAPTER 7. The Nervous System: Neurons and Synapses. Chapter 7 Outline. and Supporting Cells

Portions from Chapter 6 CHAPTER 7. The Nervous System: Neurons and Synapses. Chapter 7 Outline. and Supporting Cells CHAPTER 7 The Nervous System: Neurons and Synapses Chapter 7 Outline Neurons and Supporting Cells Activity in Axons The Synapse Acetylcholine as a Neurotransmitter Monoamines as Neurotransmitters Other

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

TECHNICAL REVIEW REPORT

TECHNICAL REVIEW REPORT TECHNICAL REVIEW REPORT Grant Agreement number: FP7 202167 Project Acronym: NeuroGLIA Project title: Molecular and cellular investigation of neuron-astroglia interactions: Understanding brain function

More information

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-18-095 Title: Insulin Receptor Substrate 2:A Bridge between Hippo and AKT Pathways Article Type: Perspective (Invited Only) Keywords:

More information

Disclosures. Mechanism of Action Importance. Advances in Epilepsy Management: Does Mechanism-of- Action Matter?

Disclosures. Mechanism of Action Importance. Advances in Epilepsy Management: Does Mechanism-of- Action Matter? Advances in Epilepsy Management: Does Mechanism-of- Action Matter? Barry E. Gidal, PharmD University of Wisconsin-Madison School of Pharmacy & Dept. of Neurology Disclosures Speaking honoraria: UCB, Eisai,

More information

Long-term Potentiation

Long-term Potentiation John Lisman, Brandeis University, Massachusetts, USA Long-term potentiation is an activity-dependent strengthening of synapses that is thought to underlie memory. Introduction One of the major unsolved

More information

Chapter 4. Estrogen receptor expression in human macrophages

Chapter 4. Estrogen receptor expression in human macrophages Chapter 4 Estrogen receptor expression in human macrophages 4.1. Introduction Macrophages respond to estrogen present in their microenvironment and hence should express functional estrogen receptors unless

More information

Objectives. Amanda Diamond, MD

Objectives. Amanda Diamond, MD Amanda Diamond, MD Objectives Recognize symptoms suggestive of seizure and what those clinical symptoms represent Understand classification of epilepsy and why this is important Identify the appropriate

More information

NERVOUS SYSTEM 1 CHAPTER 10 BIO 211: ANATOMY & PHYSIOLOGY I

NERVOUS SYSTEM 1 CHAPTER 10 BIO 211: ANATOMY & PHYSIOLOGY I BIO 211: ANATOMY & PHYSIOLOGY I 1 Ch 10 A Ch 10 B This set CHAPTER 10 NERVOUS SYSTEM 1 BASIC STRUCTURE and FUNCTION Dr. Lawrence G. Altman www.lawrencegaltman.com Some illustrations are courtesy of McGraw-Hill.

More information

Central dogma in modern neuroscience: Learning is mediated by changes in the strength of synaptic connections

Central dogma in modern neuroscience: Learning is mediated by changes in the strength of synaptic connections Central dogma in modern neuroscience: Learning is mediated by changes in the strength of synaptic connections Basic Problem: The human brain is composed of ~ 100 billion nerve cells (neurons), and each

More information

Neurons of the Bed Nucleus of the Stria Terminalis (BNST)

Neurons of the Bed Nucleus of the Stria Terminalis (BNST) Neurons of the Bed Nucleus of the Stria Terminalis (BNST) Electrophysiological Properties and Their Response to Serotonin DONALD G. RAINNIE a Harvard Medical School and Department of Psychiatry, Brockton

More information

Subject Index. Band of Giacomini 22 Benton Visual Retention Test 66 68

Subject Index. Band of Giacomini 22 Benton Visual Retention Test 66 68 Subject Index Adams, R.D. 4 Addenbrooke s Cognitive Examination 101 Alzheimer s disease clinical assessment histological imaging 104 neuroimaging 101 104 neuropsychological assessment 101 clinical presentation

More information

Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n):

Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n): Section: Chapter 5: Multiple Choice 1. The structure of synapses is best viewed with a(n): p.155 electron microscope. light microscope. confocal microscope. nissle-stained microscopic procedure. 2. Electron

More information

Evidence that associative interactions between synapses during the induction of long-term potentiation occur within local dendritic domains

Evidence that associative interactions between synapses during the induction of long-term potentiation occur within local dendritic domains Proc. Natl. Acad. Sci. USA Vol. 85, pp. 2368-2372, April 1988 Neurobiology Evidence that associative interactions between synapses during the induction of long-term potentiation occur within local dendritic

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

The Nervous System Mark Stanford, Ph.D.

The Nervous System Mark Stanford, Ph.D. The Nervous System Functional Neuroanatomy and How Neurons Communicate Mark Stanford, Ph.D. Santa Clara Valley Health & Hospital System Addiction Medicine and Therapy Services The Nervous System In response

More information

Nicolas Bianchi M.D. May 15th, 2012

Nicolas Bianchi M.D. May 15th, 2012 Nicolas Bianchi M.D. May 15th, 2012 New concepts in TIA Differential Diagnosis Stroke Syndromes To learn the new definitions and concepts on TIA as a condition of high risk for stroke. To recognize the

More information

Instructions for use

Instructions for use Title A neuroeconomic theory of bidirecti addiction Author(s) Takahashi, Taiki Citation edical Hypotheses, 75(4): 356-358 Issue Date 2010-10 Doc URLhttp://hdl.handle.net/2115/44260 Right Type article (author

More information

Theories of memory. Memory & brain Cellular bases of learning & memory. Epileptic patient Temporal lobectomy Amnesia

Theories of memory. Memory & brain Cellular bases of learning & memory. Epileptic patient Temporal lobectomy Amnesia Cognitive Neuroscience: The Biology of the Mind, 2 nd Ed., M. S. Gazzaniga, R. B. Ivry, and G. R. Mangun, Norton, 2002. Theories of Sensory, short-term & long-term memories Memory & brain Cellular bases

More information

BIOLOGICAL PROCESSES

BIOLOGICAL PROCESSES BIOLOGICAL PROCESSES CHAPTER 3 1 LEARNING GOALS Discuss how the nervous system communicates internally. Describe the structure and function of neurons Describe how the neuron transmits information Describe

More information

D1/D5 receptor agonists induce a protein synthesis-dependent

D1/D5 receptor agonists induce a protein synthesis-dependent Proc. Natl. Acad. Sci. USA Vol. 92, pp. 2446-245, March 1995 Neurobiology D1/D5 receptor agonists induce a protein synthesis-dependent late potentiation in the CAl region of the hippocampus YAN-You HUANG

More information

Dopamine modulation of prefrontal delay activity - Reverberatory activity and sharpness of tuning curves

Dopamine modulation of prefrontal delay activity - Reverberatory activity and sharpness of tuning curves Dopamine modulation of prefrontal delay activity - Reverberatory activity and sharpness of tuning curves Gabriele Scheler+ and Jean-Marc Fellous* +Sloan Center for Theoretical Neurobiology *Computational

More information

How genetic & biochemical alterations in brain tumors contribute to epileptogenesis

How genetic & biochemical alterations in brain tumors contribute to epileptogenesis How genetic & biochemical alterations in brain tumors contribute to epileptogenesis December 2 nd, 2012 Joon H. Uhm, MD FRCPC Departments of Neurology & Oncology Mayo Clinic, Rochester, MN American Epilepsy

More information

Systems Neuroscience November 29, Memory

Systems Neuroscience November 29, Memory Systems Neuroscience November 29, 2016 Memory Gabriela Michel http: www.ini.unizh.ch/~kiper/system_neurosci.html Forms of memory Different types of learning & memory rely on different brain structures

More information

Anatomy of the basal ganglia. Dana Cohen Gonda Brain Research Center, room 410

Anatomy of the basal ganglia. Dana Cohen Gonda Brain Research Center, room 410 Anatomy of the basal ganglia Dana Cohen Gonda Brain Research Center, room 410 danacoh@gmail.com The basal ganglia The nuclei form a small minority of the brain s neuronal population. Little is known about

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: MRI-negative PET-positive Temporal Lobe Epilepsy (TLE) and Mesial TLE differ with Quantitative MRI and PET: a case control study Authors: Ross P Carne (carnero@svhm.org.au)

More information

Health Sciences 1110 Module 8 Nervous System Part II LAB 8. Watch the Brain Surgery video and answer the questions on your worksheet.

Health Sciences 1110 Module 8 Nervous System Part II LAB 8. Watch the Brain Surgery video and answer the questions on your worksheet. Health Sciences 1110 Module 8 Nervous System Part II LAB 8 Watch the Brain Surgery video and answer the questions on your worksheet. Interactive Physiology o Open Internet Explorer and go to the Health

More information

1038 Biophysical Journal Volume 108 March

1038 Biophysical Journal Volume 108 March 1038 Biophysical Journal Volume 108 March 2015 1038 1046 Article Effect of the Initial Synaptic State on the Probability to Induce Long-Term Potentiation and Depression Michele Migliore, 1, * Giada De

More information

Defective glutamate and K+ clearance by cortical astrocytes in familial hemiplegic migraine type 2

Defective glutamate and K+ clearance by cortical astrocytes in familial hemiplegic migraine type 2 Defective glutamate and K+ clearance by cortical astrocytes in familial hemiplegic migraine type 2 Daniela Pietrobon Dept. of Biomedical Sciences, University of Padova CNR Institute of Neuroscience Migraine

More information

Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells

Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells Author's response to reviews Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells Authors: Ingvild J Brusevold (i.j.brusevold@medisin.uio.no) Ingun H Tveteraas

More information

Classification of Synapses Using Spatial Protein Data

Classification of Synapses Using Spatial Protein Data Classification of Synapses Using Spatial Protein Data Jenny Chen and Micol Marchetti-Bowick CS229 Final Project December 11, 2009 1 MOTIVATION Many human neurological and cognitive disorders are caused

More information

Insulin and Neurodegenerative Diseases: Shared and Specific Mechanisms. Cogs 163 Stella Ng Wendy Vega

Insulin and Neurodegenerative Diseases: Shared and Specific Mechanisms. Cogs 163 Stella Ng Wendy Vega Insulin and Neurodegenerative Diseases: Shared and Specific Mechanisms Cogs 163 Stella Ng Wendy Vega Overview A. Insulin and the Brain B. Alzheimer s Disease and Insulin C. Other neurodegenerative disease:

More information

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella

More information

SYNAPTIC COMMUNICATION

SYNAPTIC COMMUNICATION BASICS OF NEUROBIOLOGY SYNAPTIC COMMUNICATION ZSOLT LIPOSITS 1 NERVE ENDINGS II. Interneuronal communication 2 INTERNEURONAL COMMUNICATION I. ELECTRONIC SYNAPSE GAP JUNCTION II. CHEMICAL SYNAPSE SYNAPSES

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/3/e1600955/dc1 Supplementary Materials for Flexible and stretchable nanowire-coated fibers for optoelectronic probing of spinal cord circuits Chi Lu, Seongjun

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information