Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Save this PDF as:

Size: px
Start display at page:

Download "Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo."


1 Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from a region in layer 2/3 of the frontal cortex and representative activity traces from neurons (1 3), neuropil and the entire image frame (integral).

2 Supplementary Figure 2 Correlations across brain regions. (a) Schematic representation of the cortical area that was stained with fluorescent calcium indicator OGB-1 AM (left panel). The cortical subregions were identified by using a mouse brain atlas (right panel). Note that midline structures (cingulate and retrosplenial cortex) were not labeled by the calcium indicator. (b) Regions of interest for cortical imaging. (c) Regions for simultaneous recordings from cortex and contra-lateral hippocampus. (d) Regions for simultaneous recordings from cortex and contra-lateral thalamus.

3 Supplementary Figure 3 Average correlation matrix from all calcium imaging experiments. Mean correlation coefficient plotted for all pairs of cortical areas in wild-type (WT, black) and APP23 x PS45 (Tg, red) mice. Occ. = occipital, som. = somatosensory, mot. = motor and fro. = frontal cortex. Error bars correspond to one standard error of the mean. Note that pairs of areas that have the same distance from each other (e.g. occipital and somatosensory vs. motor and frontal, both being adjacent pairs, or occipital and motor vs. somatosensory and frontal, both pairs having one intervening area between them) also have about the same correlation values (the correlation matrices have approximately constant diagonals).

4 Supplementary Figure 4 Impairment of the correlation between brain areas occurs predominantly in the slow wave and delta range, but is present in all frequency bands. (a-d) The mean correlation coefficients of the fluorescent calcium signals are plotted as a function of cortical distance in wild-type (WT, black) and APP23 x PS45 (Tg, red) mice. Panel a presents the same data as in Supplementary Fig. 3 (the correlations calculated from the broadband signal). Instead of plotting the data in 3-d, the correlation coefficients from the four areas (six coefficients in total) are plotted separated by the cortical distance between the areas (these are the diagonal of the correlation matrix), demonstrating the dependence of the correlation on cortical distance. Near = two nearby cortical domains (e.g., occipital and somatosensory cortex), mid = two domains separated by one region (e.g., occipital and motor cortex), far = two domains separated by two regions (always occipital and frontal cortex). Panels b-d show the correlations, plotted in the same way, for the different frequency bands. The slow wave and delta correlation values (0.1 3 Hz, b) are essentially the same as the broadband ( Hz, a) values, because this is the frequency range with the highest power (see also Supplementary Fig. 12). However, in all frequency bands, the correlations are higher in the WT than in the Tg animals.

5 Supplementary Figure 5 Impairment of correlation between brain areas is reflected in phase consistency in all frequency bands. The average pairwise phase consistency (PPC; Vinck, M., et al. (2010) NeuroImage 51, ) is plotted in the format as in Supplementary Fig. 4. The PPC was calculated for 32 s long segments of calcium recording, as elsewhere in the paper, using a multitaper method (Mitra, P.P. & Pesaran, B. (1999) Biophys. J. 76, ) with NW = 16 (32 tapers). The PPC was averaged over frequency bands in order to be comparable to the correlation coefficients displayed in the other figures. For all anatomical distances and all frequency bands, the PPC in the WT animals (black) is larger than in the Tg animals (red). The PPC was analyzed using a linear mixed effect model with anatomical distance and genetic background as fixed factors, and with mouse and hemisphere within mouse as random factors. The effect of transgenic background was highly significant in all frequency bands. Effect of genetic background on PPC in the slow-wave frequency range was highly significant: F(1,450) = 65.8, P = 4.8e-15. In the theta range, the effect of genetic background was not significant. In the alpha range, there was a significant interaction between genetic background and anatomical distance, with phase consistency decreasing faster with distance in the Tg animals: F(2,450) = 6.09, P = The lack of significance of genetic background in the theta band, and its presence in the alpha band, were also found for LFP recordings in unanesthetized animals (see Supplementary Fig. 18).

6 Supplementary Figure 6 Similar impairment of long-range coherence of slow waves in APP23 PS45 and APP23 mice. (a) Summary graph displaying the average cross-correlation coefficients and standard errors plotted against the cortical distance (near = two nearby cortical domains, mid = two cortical domains separated by one region, far = two domains separated by two regions) in wild-type (WT, black, n = 9), APP23 (blue, n = 3) and APP23 x PS45 (red, n = 9) mice, respectively. (b) Bar graph shows the average correlation coefficients between cortical and hippocampal activity for WT (n = 5), APP23 (n = 3) and APP23 x PS45 (n = 5) mice, respectively. WT and APP23 x PS45: two-sample t-test, t(108) = 17, P = 2.7e-32 (these are the same data as shown in Fig. 3i of the main text); WT and APP23: t(75) = 21.6, P = 5.7e-34. Error bars denote SEM.

7 Supplementary Figure 7 LFP recordings in anesthetized animals yielded results that were similar to those obtained with calcium fluorescence imaging. (a) Scheme illustrating the positions of the LFP electrodes. (b) Examples of LFP recordings in a wild-type (WT, top panel) and an APP23 x PS45 (Tg, bottom panel) mouse. Superimposed traces are from the shaded areas. (c) Bar graph shows the mean correlation coefficient between occipital and frontal cortex (ctx-ctx), frontal cortex and hippocampus (ctx-hc) as well as frontal cortex and thalamus (ctx-thl) for WT (gray bars) and Tg (green bars) mice (n = 18 animals), respectively. Two-way ANOVA on genotype (WT vs. Tg) and correlation type (ctx-ctx, ctx-hc and ctx-thl): main effect of genotype F(1,14) = 197, P = 1.2e-9; main effect of correlation type: F(2,14) = 0.27, P = 0.77; interaction: F(2,14) = 0.09, P = Thus, all three correlation types are equally depressed in Tg relative to WT mice. Error bars denote SEM.

8 Supplementary Figure 8 Correlation between calcium transients and local field potentials in the hippocampus. Simultaneous recording of the local field potential (LFP was inverted, blue) and camera-fluorescence signals (black) in the dorsal hippocampus.

9 Supplementary Figure 9 Correlation between calcium transients and local field potentials in the thalamus. Simultaneous recording of the local field potential (LFP was inverted, blue) and camera-fluorescence signals (black) in the thalamus.

10 Supplementary Figure 10 Cortico-thalamic correlation maps. Correlation maps using a seed-pixel in cortical regions (top and middle) or in the thalamus (bottom) in a wild-type (WT, left panel) and an APP23 x PS45 (Tg, right panel) mouse, respectively. The white asterisks denote the location of the seed pixel.

11 Supplementary Figure 11 Histological identification of local field potential electrode position. (a, b) Example sections showing the electrode location in the hippocampus (a, top panel) and in the thalamus (b, bottom panel). Red: DiI-labeled electrode track. White arrows indicate the inferred location of the electrode tip.

12 Supplementary Figure 12 Power spectra of calcium imaging data. Power spectra of cortical calcium fluorescence time series in wild-type (WT) and APP23 x PS45 (Tg) mice. While all power spectra show clear peaks at 0.3 Hz, the peak bandwidth increased substantially in the Tg mice, reflecting the higher rates of calcium transients in the Tg animals (see Fig. 2h of the main text). Note that, in the Tg mice, there is a greater increase in bandwidth in the frontal cortex (solid red line) compared to the occipital cortex (solid blue line). This finding is consistent with the relatively larger increase in the calcium wave rate in these areas (see Fig. 2h of the main text).

13 Supplementary Figure 13 The glutamate receptor antagonist APV has no effect on impaired slow-wave activity in APP23 PS45 mice. Superimposed traces of slow-wave activity in the frontal (red) and the occipital (black) cortex of an APP23 x PS45 mouse before (control), during and after (wash-out) application of 50 µm APV.

14 Supplementary Figure 14 Correlation maps of the pharmacological experiments. (a-d) Correlation maps of the pharmacological experiments shown in Figs. 5 and 6 of the main text (topical midazolam application in Fig. 5a, topical gabazine application in Fig. 5b, topical Aβ application in Fig. 6a and rescue of topical Aβ application with midazolam in Fig. 6b). White asterisks mark the seed pixel that was used for the generation of the maps.

15 Supplementary Figure 15 Aβ 1 40 and Aβ 1 42 lead to similar impairments of coherent activity. (a, b) Summary graph showing the average cross-correlation coefficients and standard errors plotted against the cortical distance (near = two nearby cortical domains, mid = two cortical domains separated by one region, far = two domains separated by two regions) before (black), during (red) and after (gray) wash-in of amyloid-β (Aβ) 1-40 in a or Aβ 1-42 in b in WT mice (n = 6 animals). For statistics see Supplementary Table 1.

16 Supplementary Figure 16 Determination of sleep and wake states in unanesthetized animals. (a, b) Representative traces of surface EMG (top), cortical LFP (middle) and power spectral density of the LFP (bottom) under sleep (left) and wake (right) states in a wild-type (WT, a) and APP23 x PS45 (Tg, b) mouse, respectively. Sleep was defined as the prolonged periods with immobility of the animal, absence of EMG activity, closed eyes, and large-amplitude, low frequency activity in the LFP recordings. Wakefulness was characterized by periods with high EMG activity, occasional locomotion, opened eyes, as well as lower amplitude and higher frequency LFP activity. (c,d) Median power spectra of 200-sec LFP traces during sleep (left) and waking (right) in WT (c) and Tg (d) mice (n = 8 animals). Shaded error bands represent upper and lower quartile of the power spectra.

17 Supplementary Figure 17 Impairment of long-range coherence of slow-wave activity in naturally sleeping APP23 PS45 mice. (a, b) Example traces of LFP recordings from the frontal (red) and the occipital (black) cortex in unanesthetized wild-type (WT, a) and APP23 x PS45 (Tg, b) mice, respectively. (c) Example traces of LFP recordings from the frontal (red) and occipital (black) cortex in a Tg mouse before and 10 min after intraperitoneal injection of a low-dose of clonazepam. (d) Bar graph shows that the mean correlation between frontal and occipital cortex in the slow wave and delta range was significantly lower in Tg compared to WT mice (n = 10 animals; t(10) = 2.69, P = 0.023, two-sample t-test), and that, in the Tg mice, treatment with clonazepam increased this correlation (t(5) = 4.83, P = , two-sample t-test).

18 Supplementary Figure 18 Impairment of long-range coherence in non-anesthetized animals extends to higher frequency bands. Bar graph displays the mean correlation coefficients between LFP recordings from frontal and occipital cortex at different frequency bands in naturally sleeping wild-type (WT) and APP23 x PS45 (Tg) mice. Note that in the Tg mice (red bars) the correlation coefficients are considerably smaller compared to WT mice (gray bars), and that a low-dose of clonazepam (blue bars) increased the correlations. For the differences between WT and Tg, one-way nested ANOVA with animals nested within genotype, F(1,3) = 40.7, 11.6, 7.23, 13.2, 10.2 (P = , 0.042, 0.074, 0.036, 0.049) for the broadband, slow wave and delta, theta, alpha and beta ranges. For the differences before and after clonazepam, two-sample t-test, t(5) = 4.07, 4.83, 0.35, 3.82, 4.30 (P = , , 0.74, 0.012, ) in the same ranges. The data in the slow wave and delta range is the same as in Supplementary Fig. 17. Error bars indicate SEM.

19 Mouse strain/treatment Anatomical distance/brain area Interaction Fig. 2g F(1,390)=406 P=0 F(2,390)=20.5 P=3.4e- 9 F(2,390)=11 P=2.2e- 5 Suppl. Fig. 4 (a) Same data as Fig. 2g (b) F(1,390)=931 (c) F(1,390)=29.6 (d) F(1,390)=17.1 P=0 P=9.4e- 8 P=4.3e- 5 (b) F(2,390)=163 (c) F(2,390)=220 (d) F(2,390)=39.5 P=0 P=0 P=2.2e- 16 (b) F(2,390)=79.3 (c) F(2,390)=0.42 (d) F(2,390)=0.29 P=0 P=0.65 P=0.75 Suppl. Fig. 6a F(2,216)=227 P=0 F(2,216)=142 P=0 F(2,216)=21.6 P=2.8e- 9 Fig. 3h F(1,290)=356 P=2.4e- 52 F(4,290)=160 P=3.5e- 72 F(4,290)=38.6 P=6.7e- 26 Fig. 4c F(1,112)=280 P=2.7e- 32 F(3,112)=87.9 p=2.6e- 29 F(3,112)=12.7 P=3.2e- 7 Suppl. Fig. 13 F(2,51)=1.9 P=0.16 F(2,51)=44.7 P=6.1e- 12 F(4,51)=0.13 P=0.97 Fig. 5c F(2,81)=93 P=0 F(2,81)=75 P=0 F(4,81)=6.3 P=1.8e- 4 Fig. 5d F(1,276)=47.2 P=4.2e- 11 F(2,276)=15.1 P=6.0e- 7 F(2,276)=0.01 P=0.99 Fig. 5e F(2,123)=137 P=0 F(2,123)= e- 9 F(4,123)=12 2.9e- 8 Fig. 6c F(2,99)=414 P=8.4e- 49 F(2,99)=64.2 P=1.3e- 18 F(4,99)=33.5 P=1.2e- 17 Fig. 6d F(2,108)=12 2.0e- 5 F(2,108)=153 P=0 F(2,108)= e- 4 Suppl. Fig. 15a F(2,57)=131 P=0 F(2,57)= e- 8 F(4,57)= e- 6 Suppl. Fig. 15b F(2,81)=142 P=0 F(2,81)= e- 15 F(4,81)= e- 10 Reverse peptide F(1,24)=3 P=0.096 F(2,24)=76 P=4.1e- 11 F(4,24)=0.08 P=0.99 Supplementary Table 1

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary

More information

Matrix Energetics Research Brainwaves and Heart waves Research on Matrix Energetics in Action

Matrix Energetics Research Brainwaves and Heart waves Research on Matrix Energetics in Action Matrix Energetics Research Brainwaves and Heart waves Research on Matrix Energetics in Action QEEG (quantitative electroencephalography) and HRV (heart rate variability analysis) tests revealed Dr. Richard

More information

Informationsverarbeitung im zerebralen Cortex

Informationsverarbeitung im zerebralen Cortex Informationsverarbeitung im zerebralen Cortex Thomas Klausberger Dept. Cognitive Neurobiology, Center for Brain Research, Med. Uni. Vienna The hippocampus is a key brain circuit for certain forms of memory

More information

Testing the Accuracy of ECG Captured by Cronovo through Comparison of ECG Recording to a Standard 12-Lead ECG Recording Device

Testing the Accuracy of ECG Captured by Cronovo through Comparison of ECG Recording to a Standard 12-Lead ECG Recording Device Testing the Accuracy of ECG Captured by through Comparison of ECG Recording to a Standard 12-Lead ECG Recording Device Data Analysis a) R-wave Comparison: The mean and standard deviation of R-wave amplitudes

More information

SLEEP STAGING AND AROUSAL. Dr. Tripat Deep Singh (MBBS, MD, RPSGT, RST) International Sleep Specialist (World Sleep Federation program)

SLEEP STAGING AND AROUSAL. Dr. Tripat Deep Singh (MBBS, MD, RPSGT, RST) International Sleep Specialist (World Sleep Federation program) SLEEP STAGING AND AROUSAL Dr. Tripat Deep Singh (MBBS, MD, RPSGT, RST) International Sleep Specialist (World Sleep Federation program) Scoring of Sleep Stages in Adults A. Stages of Sleep Stage W Stage

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

Resistance to forgetting associated with hippocampus-mediated. reactivation during new learning

Resistance to forgetting associated with hippocampus-mediated. reactivation during new learning Resistance to Forgetting 1 Resistance to forgetting associated with hippocampus-mediated reactivation during new learning Brice A. Kuhl, Arpeet T. Shah, Sarah DuBrow, & Anthony D. Wagner Resistance to

More information


Physiology Unit 2 CONSCIOUSNESS, THE BRAIN AND BEHAVIOR Physiology Unit 2 CONSCIOUSNESS, THE BRAIN AND BEHAVIOR In Physiology Today What the Brain Does The nervous system determines states of consciousness and produces complex behaviors Any given neuron may

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic

Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic Neuron, Volume 89 Supplemental Information Memory-Relevant Mushroom Body Output Synapses Are Cholinergic Oliver Barnstedt, David Owald, Johannes Felsenberg, Ruth Brain, John-Paul Moszynski, Clifford B.

More information

Retinotopy & Phase Mapping

Retinotopy & Phase Mapping Retinotopy & Phase Mapping Fani Deligianni B. A. Wandell, et al. Visual Field Maps in Human Cortex, Neuron, 56(2):366-383, 2007 Retinotopy Visual Cortex organised in visual field maps: Nearby neurons have

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different

More information

Spectral fingerprints of large-scale neuronal interactions

Spectral fingerprints of large-scale neuronal interactions Nature Reviews Neuroscience AOP, published online 11 January 212; doi:1.138/nrn3137 REVIEWS Spectral fingerprints of large-scale neuronal interactions Markus Siegel 1 *, Tobias H. Donner 2 * and Andreas

More information

Beyond the Basics in EEG Interpretation: Throughout the Life Stages

Beyond the Basics in EEG Interpretation: Throughout the Life Stages Beyond the Basics in EEG Interpretation: Throughout the Life Stages Steve S. Chung, MD, FAAN Chairman, Neuroscience Institute Director, Epilepsy Program Banner University Medical Center University of Arizona

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Characterization of Sleep Spindles

Characterization of Sleep Spindles Characterization of Sleep Spindles Simon Freedman Illinois Institute of Technology and W.M. Keck Center for Neurophysics, UCLA (Dated: September 5, 2011) Local Field Potential (LFP) measurements from sleep

More information

An acetylcholine-activated microcircuit drives temporal dynamics of cortical activity

An acetylcholine-activated microcircuit drives temporal dynamics of cortical activity An acetylcholine-activated microcircuit drives temporal dynamics of cortical activity Naiyan Chen, Hiroki Sugihara, & Mriganka Sur Nature America, nc. All rights reserved. Cholinergic modulation of cortex

More information

LORETA Coherence and Phase Differences

LORETA Coherence and Phase Differences LORETA Coherence and Phase Differences Robert W. Thatcher, Ph.D. 4/25/12 Example from the Neuroguide Demo from a high functioning business professional prior to right hemisphere brain damage by being struck

More information

Introduction to Physiological Psychology

Introduction to Physiological Psychology Introduction to Physiological Psychology Vision This class n Sensation vs. Perception n How light is translated into what we see n Structure

More information

Areas of the visual cortex are arranged hierarchically, with

Areas of the visual cortex are arranged hierarchically, with Alpha and gamma oscillations characterize feedback and feedforward processing in monkey visual cortex Timo van Kerkoerle a,1, Matthew W. Self a, Bruno Dagnino a, Marie-Alice Gariel-Mathis a, Jasper Poort

More information

Effects of Light Stimulus Frequency on Phase Characteristics of Brain Waves

Effects of Light Stimulus Frequency on Phase Characteristics of Brain Waves SICE Annual Conference 27 Sept. 17-2, 27, Kagawa University, Japan Effects of Light Stimulus Frequency on Phase Characteristics of Brain Waves Seiji Nishifuji 1, Kentaro Fujisaki 1 and Shogo Tanaka 1 1

More information

The Temporal Structures and Functional Significance of Scale-free Brain Activity

The Temporal Structures and Functional Significance of Scale-free Brain Activity Viewpoint The Temporal Structures and Functional Significance of Scale-free Brain Activity Biyu J. He, 1, * John M. Zempel, 2 Abraham Z. Snyder, 1,2 and Marcus E. Raichle 1,2,3,4 1 Department of Radiology

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014

More information

Scope. EEG patterns in Encephalopathy. Diffuse encephalopathy. EEG in adult patients with. EEG in diffuse encephalopathy

Scope. EEG patterns in Encephalopathy. Diffuse encephalopathy. EEG in adult patients with. EEG in diffuse encephalopathy Scope EEG patterns in Encephalopathy Dr.Pasiri Sithinamsuwan Division of Neurology Department of Medicine Phramongkutklao Hospital Diffuse encephalopathy EEG in specific encephalopathies Encephalitides

More information

The Sonification of Human EEG and other Biomedical Data. Part 3

The Sonification of Human EEG and other Biomedical Data. Part 3 The Sonification of Human EEG and other Biomedical Data Part 3 The Human EEG A data source for the sonification of cerebral dynamics The Human EEG - Outline Electric brain signals Continuous recording

More information

13 Electroencephalography

13 Electroencephalography 13 Electroencephalography 13.1 INTRODUCTION The first recording of the electric field of the human brain was made by the German psychiatrist Hans Berger in 1924 in Jena. He gave this recording the name

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Influenza A Virus Transmission Bottlenecks Are Defined by Infection Route and Recipient Host

Influenza A Virus Transmission Bottlenecks Are Defined by Infection Route and Recipient Host Cell Host & Microbe, Volume 16 Supplemental Information Influenza A Virus Transmission Bottlenecks Are Defined by Infection Route and Recipient Host Andrew Varble, Randy A. Albrecht, Simone Backes, Marshall

More information

Genetic variation in EEG activity during sleep in inbred mice

Genetic variation in EEG activity during sleep in inbred mice Genetic variation in EEG activity during sleep in inbred mice PAUL FRANKEN, ALAIN MALAFOSSE, AND MEHDI TAFTI Biochemistry and Neurophysiology Unit, Department of Psychiatry, University of Geneva, CH-1225

More information

Exploratory Investigation into Mild Brain Injury and Discriminant Analysis with High Frequency Bands (32-64 Hz)

Exploratory Investigation into Mild Brain Injury and Discriminant Analysis with High Frequency Bands (32-64 Hz) Exploratory Investigation into Mild Brain Injury and Discriminant Analysis with High Frequency Bands (32-64 Hz), Brain Injury, August,1999, 477-488 Exploratory Investigation into Mild Brain Injury and

More information

EEG History. Where and why is EEG used? 8/2/2010

EEG History. Where and why is EEG used? 8/2/2010 EEG History Hans Berger 1873-1941 Edgar Douglas Adrian, an English physician, was one of the first scientists to record a single nerve fiber potential Although Adrian is credited with the discovery of

More information

Brain Computer Interface. Mina Mikhail

Brain Computer Interface. Mina Mikhail Brain Computer Interface Mina Mikhail Introduction Ways for controlling computers Keyboard Mouse Voice Gestures Ways for communicating with people Talking Writing Gestures Problem

More information

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin Molecular Cell, Volume 64 Supplemental Information 3D-CLEM Reveals that a Major Portion of Mitotic Chromosomes Is Not Chromatin Daniel G. Booth, Alison J. Beckett, Oscar Molina, Itaru Samejima, Hiroshi

More information

Coding of Information in the Phase of Local Field Potentials within Human Medial Temporal Lobe

Coding of Information in the Phase of Local Field Potentials within Human Medial Temporal Lobe Article Coding of Information in the Phase of Local Field Potentials within Human Medial Temporal Lobe Beth A. Lopour, 1, * Abtine Tavassoli, 1 Itzhak Fried, 2 and Dario L. Ringach 1,3 1 Department of

More information

Strick Lecture 3 March 22, 2017 Page 1

Strick Lecture 3 March 22, 2017 Page 1 Strick Lecture 3 March 22, 2017 Page 1 Cerebellum OUTLINE I. External structure- Inputs and Outputs Cerebellum - (summary diagram) 2 components (cortex and deep nuclei)- (diagram) 3 Sagittal zones (vermal,

More information



More information

Combining microstimulation and fmri in an awake behaving monkey

Combining microstimulation and fmri in an awake behaving monkey NEAAPM Peter Neurath Symposium Combining microstimulation and fmri in an awake behaving monkey Presented by: Leeland B. Ekstrom April 2006 Advisors: Wim Vanduffel & Bruce Rosen MGH / MIT / HMS Martinos

More information



More information

The Central Nervous System I. Chapter 12

The Central Nervous System I. Chapter 12 The Central Nervous System I Chapter 12 The Central Nervous System The Brain and Spinal Cord Contained within the Axial Skeleton Brain Regions and Organization Medical Scheme (4 regions) 1. Cerebral Hemispheres

More information

Nervous System and Brain Review. Bio 3201

Nervous System and Brain Review. Bio 3201 Nervous System and Brain Review Bio 3201 Dont worry about: glial cells Oligodendrocytes Satelite cells etc Nervous System - Vital to maintaining homeostasis in organisms - Comprised of : brain, spinal

More information


AUXILIARIES AND NEUROPLASTICITY AUXILIARIES AND NEUROPLASTICITY Claudio Babiloni, Ph.D. Department of Biomedical Sciences, University of Foggia (UNIFG), Italy UNIFG structured personnel involved Prof. Claudio Babiloni (Coordinator),

More information

Early Learning vs Early Variability 1.5 r = p = Early Learning r = p = e 005. Early Learning 0.

Early Learning vs Early Variability 1.5 r = p = Early Learning r = p = e 005. Early Learning 0. The temporal structure of motor variability is dynamically regulated and predicts individual differences in motor learning ability Howard Wu *, Yohsuke Miyamoto *, Luis Nicolas Gonzales-Castro, Bence P.

More information



More information

Supporting Online Material for

Supporting Online Material for Supporting Online Material for Astrocytes Potentiate Transmitter Release at Single Hippocampal Synapses Gertrudis Perea and Alfonso Araque* *To whom

More information

Dysfunctional FINDINGS IN EEG. About 18 Cases were Seen in Consultation in our Hospital

Dysfunctional FINDINGS IN EEG. About 18 Cases were Seen in Consultation in our Hospital Cronicon OPEN ACCESS NEUROLOGY Clinical Images Angel Molina Leon* Dysfunctional FINDINGS IN EEG. About 18 Cases were Seen in Consultation in our Hospital Clinical Neurophysiology Service. Centro medico

More information

Alterations in Synaptic Strength Preceding Axon Withdrawal

Alterations in Synaptic Strength Preceding Axon Withdrawal Alterations in Synaptic Strength Preceding Axon Withdrawal H. Colman, J. Nabekura, J.W. Lichtman presented by Ana Fiallos Synaptic Transmission at the Neuromuscular Junction Motor neurons with cell bodies

More information

Using Multi-electrode Array Recordings to detect unrecognized electrical events in epilepsy

Using Multi-electrode Array Recordings to detect unrecognized electrical events in epilepsy Using Multi-electrode Array Recordings to detect unrecognized electrical events in epilepsy December 1, 2012 Catherine Schevon, MD, PhD Columbia University New York, NY American Epilepsy Society Annual

More information

Carlson (7e) PowerPoint Lecture Outline Chapter 9: Sleep and Biological Rhythms

Carlson (7e) PowerPoint Lecture Outline Chapter 9: Sleep and Biological Rhythms Carlson (7e) PowerPoint Lecture Outline Chapter 9: Sleep and Biological Rhythms This multimedia product and its contents are protected under copyright law. The following are prohibited by law: any public

More information


SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

2 Summary of Part I: Basic Mechanisms. 4 Dedicated & Content-Specific

2 Summary of Part I: Basic Mechanisms. 4 Dedicated & Content-Specific 1 Large Scale Brain Area Functional Organization 2 Summary of Part I: Basic Mechanisms 2. Distributed Representations 5. Error driven Learning 1. Biological realism w = δ j ai+ aia j w = δ j ai+ aia j

More information

EEG SPIKE CLASSIFICATION WITH TEMPLATE MATCHING ALGORITHM. Çamlık Caddesi No:44 Sarnıç Beldesi İZMİR 2 Elektrik ve Elektronik Müh.

EEG SPIKE CLASSIFICATION WITH TEMPLATE MATCHING ALGORITHM. Çamlık Caddesi No:44 Sarnıç Beldesi İZMİR 2 Elektrik ve Elektronik Müh. EEG SPIKE CLASSIFICATION WITH TEMPLATE MATCHING ALGORITHM Selim BÖLGEN 1 Gülden KÖKTÜRK 2 1 Pagetel Sistem Müh. San. Tic. Ltd. Şti. Çamlık Caddesi No:44 Sarnıç Beldesi İZMİR 2 Elektrik ve Elektronik Müh.

More information

Supporting Online Material for

Supporting Online Material for Supporting Online Material for Internally Generated Cell Assembly Sequences in the Rat Hippocampus Eva Pastalkova, Vladimir Itskov, Asohan Amarasingham,

More information

Disparity- and velocity- based signals for 3D motion perception in human MT+ Bas Rokers, Lawrence K. Cormack, and Alexander C. Huk

Disparity- and velocity- based signals for 3D motion perception in human MT+ Bas Rokers, Lawrence K. Cormack, and Alexander C. Huk Disparity- and velocity- based signals for 3D motion perception in human MT+ Bas Rokers, Lawrence K. Cormack, and Alexander C. Huk Supplementary Materials fmri response (!% BOLD) ).5 CD versus STS 1 wedge

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Neural Strategies for Selective Attention Distinguish Fast-Action Video Game Players

Neural Strategies for Selective Attention Distinguish Fast-Action Video Game Players Neural Strategies for Selective Attention Distinguish Fast-Action Video Game Players - Online First - Springer 7/6/1 1:4 PM Neural Strategies for Selective Attention Distinguish Fast-Action Video Game

More information

QEEG, ERPs in ADHD Assessment, Diagnosis & Treatment by Kropotov Juri D. Saint Petersburg, Russia

QEEG, ERPs in ADHD Assessment, Diagnosis & Treatment by Kropotov Juri D. Saint Petersburg, Russia QEEG, ERPs in ADHD Assessment, Diagnosis & Treatment by Kropotov Juri D. Saint Petersburg, Russia Introduction Definition HBI (Human Brain Index) methodology is a set of standardized methods for recording,

More information

Rhythm and Rate: Perception and Physiology HST November Jennifer Melcher

Rhythm and Rate: Perception and Physiology HST November Jennifer Melcher Rhythm and Rate: Perception and Physiology HST 722 - November 27 Jennifer Melcher Forward suppression of unit activity in auditory cortex Brosch and Schreiner (1997) J Neurophysiol 77: 923-943. Forward

More information


NEURAL MECHANISMS OF SLEEP (p.1) (Rev. 3/21/07) NEURAL MECHANISMS OF SLEEP (p.1) (Rev. 3/21/07) 1. Revisitation of Bremer s 1936 Isolated Brain Studies Transected the brain: a. Cut between the medulla and the spinal cord ( encephale isole ) Note: recall

More information

Supplemental Information. A 4 Hz Oscillation Adaptively Synchronizes. Prefrontal, VTA, and Hippocampal Activities

Supplemental Information. A 4 Hz Oscillation Adaptively Synchronizes. Prefrontal, VTA, and Hippocampal Activities Neuron, Volume 72 Supplemental Information A 4 Hz Oscillation Adaptively Synchronizes Prefrontal, VTA, and Hippocampal Activities Shigeyoshi Fujisawa and György Buzsáki SUPPEMENTAL FIGURES Figure S1. (A)

More information

Protocol for Rat Sleep EEG

Protocol for Rat Sleep EEG Protocol for Rat Sleep EEG Subjects Male Spraue Dawley rats weihin 250-300 rams at the time of surery are used. Food and water are available ad libitum throuhout the experiment. Rats are roup housed prior

More information

Synchrony and the attentional state

Synchrony and the attentional state Synchrony and the attentional state Ernst Niebur, Dept. of Neuroscience & Krieger Mind/Brain Institute Johns Hopkins University Collaborators Arup Roy monkey monkey Peter monkey Steven monkey

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD ? Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Christian S Lobsiger & Don W Cleveland (2007) Nature Neuroscience 10, 1355-1360 Astrocytes: interlinked gatekeepers of glutamate astrocytes

More information


ENTROPY OF ELECTROENCEPHALOGRAM (EEG) SIGNALS CHANGES WITH SLEEP STATE University of Kentucky UKnowledge University of Kentucky Master's Theses Graduate School 2006 ENTROPY OF ELECTROENCEPHALOGRAM (EEG) SIGNALS CHANGES WITH SLEEP STATE Blesy Anu Mathew University of Kentucky,

More information

Different Neural Frequency Bands Integrate Faces and Voices Differently in the Superior Temporal Sulcus

Different Neural Frequency Bands Integrate Faces and Voices Differently in the Superior Temporal Sulcus J Neurophysiol : 773 788, 29. First published November 26, 28; doi:.52/jn.9843.28. Different Neural Frequency Bands Integrate Faces and Voices Differently in the Superior Temporal Sulcus Chandramouli Chandrasekaran

More information

Precise Spike Timing and Reliability in Neural Encoding of Low-Level Sensory Stimuli and Sequences

Precise Spike Timing and Reliability in Neural Encoding of Low-Level Sensory Stimuli and Sequences Precise Spike Timing and Reliability in Neural Encoding of Low-Level Sensory Stimuli and Sequences Temporal Structure In the World Representation in the Brain Project 1.1.2 Feldman and Harris Labs Temporal

More information

Improved patient outcomes. NeuroWave is proud to introduce the NeuroSENSE NS-701. The NeuroSENSE is a unique bilateral brain function monitor

Improved patient outcomes. NeuroWave is proud to introduce the NeuroSENSE NS-701. The NeuroSENSE is a unique bilateral brain function monitor 2 3 4 5! "! # $ $! $ %! " & & $ % " " & $ %! & & $ % '! $ ( &! )! % * +! $ $ +!, & - & $ ".! % * / " $ $ $ $ $ $ & $! $ " 0 $ * $ 1 NeuroWave is proud to introduce the NeuroSENSE NS-701 Monitor - the next

More information

Basics of Polysomnography. Chitra Lal, MD, FCCP, FAASM Assistant professor of Medicine, Pulmonary, Critical Care and Sleep, MUSC, Charleston, SC

Basics of Polysomnography. Chitra Lal, MD, FCCP, FAASM Assistant professor of Medicine, Pulmonary, Critical Care and Sleep, MUSC, Charleston, SC Basics of Polysomnography Chitra Lal, MD, FCCP, FAASM Assistant professor of Medicine, Pulmonary, Critical Care and Sleep, MUSC, Charleston, SC Basics of Polysomnography Continuous and simultaneous recording

More information

Atlas, rules, and recording techniques for the scoring of cyclic alternating pattern (CAP) in human sleep

Atlas, rules, and recording techniques for the scoring of cyclic alternating pattern (CAP) in human sleep Sleep Medicine 3 (2002) 187 199 Consensus Report Atlas, rules, and recording techniques for the scoring of cyclic alternating pattern (CAP) in human sleep Mario Giovanni Terzano a, *, Liborio Parrino a,

More information

EEG changes accompanying learned regulation of 12-Hz EEG activity

EEG changes accompanying learned regulation of 12-Hz EEG activity TNSRE-2002-BCI015 1 EEG changes accompanying learned regulation of 12-Hz EEG activity Arnaud Delorme and Scott Makeig Abstract We analyzed 15 sessions of 64-channel EEG data recorded from a highly trained

More information

A Study of Smartphone Game Users through EEG Signal Feature Analysis

A Study of Smartphone Game Users through EEG Signal Feature Analysis , pp. 409-418 A Study of Smartphone Game Users through EEG Signal Feature Analysis Jung-Yoon Kim Graduate School of Advanced Imaging Science, Multimedia &

More information

Circuits & Behavior. Daniel Huber

Circuits & Behavior. Daniel Huber Circuits & Behavior Daniel Huber How to study circuits? Anatomy (boundaries, tracers, viral tools) Inactivations (lesions, optogenetic, pharma, accidents) Activations (electrodes, magnets, optogenetic)

More information


BRAIN PART I (A & B): VENTRICLES & MENINGES BRAIN PART I (A & B): VENTRICLES & MENINGES Cranial Meninges Cranial meninges are continuous with spinal meninges Dura mater: inner layer (meningeal layer) outer layer (endosteal layer) fused to periosteum

More information

Validation of non- REM sleep stage decoding from resting state fmri using linear support vector machines

Validation of non- REM sleep stage decoding from resting state fmri using linear support vector machines Validation of non- REM sleep stage decoding from resting state fmri using linear support vector machines Altmann A. 1,2,7 *, Schröter M.S. 1,3 *, Spoormaker V.I. 1, Kiem S.A. 1, Jordan D. 4, Ilg R. 5,6,

More information



More information

COGNITIVE SCIENCE 107A. Motor Systems: Basal Ganglia. Jaime A. Pineda, Ph.D.

COGNITIVE SCIENCE 107A. Motor Systems: Basal Ganglia. Jaime A. Pineda, Ph.D. COGNITIVE SCIENCE 107A Motor Systems: Basal Ganglia Jaime A. Pineda, Ph.D. Two major descending s Pyramidal vs. extrapyramidal Motor cortex Pyramidal system Pathway for voluntary movement Most fibers originate

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Involvement of urinary bladder Connexin43 and the circadian clock in the coordination of diurnal micturition rhythm Hiromitsu Negoro, 1,2 Akihiro Kanematsu, 1,3 Masao Doi,

More information

Neurophysiologic Assessment

Neurophysiologic Assessment Neurophysiologic Assessment Electrophysiology is very helpful to detect whether myoclonus is cortical, subcortical or spinal/segmental. Polymyography is the first step in the neurophysiologic assessment

More information

DELSYS. Purpose. Hardware Concepts. Software Concepts. Technical Note 101: EMG Sensor Placement

DELSYS. Purpose. Hardware Concepts. Software Concepts. Technical Note 101: EMG Sensor Placement Technical Note 101: EMG Sensor Placement Purpose This technical note addresses proper placement technique for Delsys Surface EMG Sensors. The technique is demonstrated through an experiment in which EMG

More information

Spectral and brain mapping analysis of EEG based on Pwelch in schizophrenic patients

Spectral and brain mapping analysis of EEG based on Pwelch in schizophrenic patients Journal of Physics: Conference Series PAPER OPEN ACCESS Spectral and brain mapping analysis of EEG based on Pwelch in schizophrenic patients Related content - Experimental study of internal wave generation

More information


FATAL FAMILIAL INSOMNIA Azienda ASL 9 TREVISO Presidio Ospedaliero di Treviso Dipartimento di Medicina Unità Operativa di Medicina Interna Seconda Responsabile dr Ignazio Roiter FATAL FAMILIAL INSOMNIA Dr I. ROITER FATAL FAMILIAL

More information

Modelling corticothalamic feedback and the gating of the thalamus by the cerebral cortex

Modelling corticothalamic feedback and the gating of the thalamus by the cerebral cortex J. Physiol. (Paris) 94 (2000) 391 410 2000 Elsevier Science Ltd. Published by Éditions scientifiques et médicales Elsevier SAS. All rights reserved PII: S0928-4257(00)01093-7/FLA Modelling corticothalamic

More information

The EEG in focal epilepsy. Bassel Abou-Khalil, M.D. Vanderbilt University Medical Center

The EEG in focal epilepsy. Bassel Abou-Khalil, M.D. Vanderbilt University Medical Center The EEG in focal epilepsy Bassel Abou-Khalil, M.D. Vanderbilt University Medical Center I have no financial relationships to disclose that are relative to the content of my presentation Learning Objectives

More information

Supplemental Information. In Vivo Optogenetic Stimulation. of Neocortical Excitatory Neurons. Drives Brain-State-Dependent Inhibition

Supplemental Information. In Vivo Optogenetic Stimulation. of Neocortical Excitatory Neurons. Drives Brain-State-Dependent Inhibition Current Biology, Volume 21 Supplemental Information In Vivo Optogenetic Stimulation of Neocortical Excitatory Neurons Drives Brain-State-Dependent Inhibition Celine Mateo, Michael Avermann, Luc J. Gentet,

More information

SENSES: VISION. Chapter 5: Sensation AP Psychology Fall 2014

SENSES: VISION. Chapter 5: Sensation AP Psychology Fall 2014 SENSES: VISION Chapter 5: Sensation AP Psychology Fall 2014 Sensation versus Perception Top-Down Processing (Perception) Cerebral cortex/ Association Areas Expectations Experiences Memories Schemas Anticipation

More information

Differential Associations of Early- and Late-Night Sleep with Functional Brain States Promoting Insight to Abstract Task Regularity

Differential Associations of Early- and Late-Night Sleep with Functional Brain States Promoting Insight to Abstract Task Regularity Differential Associations of Early- and Late-Night Sleep with Functional Brain States Promoting Insight to Abstract Task Regularity Juliana Yordanova 1,3 *., Vasil Kolev 1,3., Ullrich Wagner 1,2,4, Rolf

More information

Processing of the incomplete representation of the visual world

Processing of the incomplete representation of the visual world Processing of the incomplete representation of the visual world Andrzej W. Przybyszewski, and Tomasz M. Rutkowski Dept Psychology McGill University Montreal, Canada Schepens Eye Res Institute, Harvard

More information

Hippocampal Offline Reactivation Consolidates Recently Formed Cell Assembly Patterns during Sharp Wave-Ripples

Hippocampal Offline Reactivation Consolidates Recently Formed Cell Assembly Patterns during Sharp Wave-Ripples Report Hippocampal Offline Reactivation Consolidates Recently Formed Cell Assembly Patterns during Sharp Wave-Ripples Highlights d Multi-neuron co-activations form space-coding assembly patterns in the

More information

Chapter 3 Biological Foundations and Neuroscience

Chapter 3 Biological Foundations and Neuroscience Chapter 3 Biological Foundations and Neuroscience Copyright 2001 by McGraw-Hill Ryerson Limited Heredity! Chromosomes! Threadlike structures that come in 23 pairs, one member of each pair coming from each

More information

Both ongoing alpha and visually-induced gamma oscillations. show reliable diversity in their across-site phase-relations

Both ongoing alpha and visually-induced gamma oscillations. show reliable diversity in their across-site phase-relations Articles in PresS. J Neurophysiol (December 10, 2014). doi:10.1152/jn.00788.2014 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Both ongoing alpha and visually-induced gamma oscillations show reliable diversity

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm. SKG-c SKG-A mm 1.4 1.2 1.. Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Chapter 3. Structure and Function of the Nervous System. Copyright (c) Allyn and Bacon 2004

Chapter 3. Structure and Function of the Nervous System. Copyright (c) Allyn and Bacon 2004 Chapter 3 Structure and Function of the Nervous System 1 Basic Features of the Nervous System Neuraxis: An imaginary line drawn through the center of the length of the central nervous system, from the

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Memory, Attention, and Decision-Making

Memory, Attention, and Decision-Making Memory, Attention, and Decision-Making A Unifying Computational Neuroscience Approach Edmund T. Rolls University of Oxford Department of Experimental Psychology Oxford England OXFORD UNIVERSITY PRESS Contents

More information

Mediodorsal and Visual Thalamic Connectivity Differ in Schizophrenia and Bipolar Disorder With and Without Psychosis History

Mediodorsal and Visual Thalamic Connectivity Differ in Schizophrenia and Bipolar Disorder With and Without Psychosis History Schizophrenia Bulletin vol. 40 no. 6 pp. 1227 1243, 2014 doi:10.1093/schbul/sbu100 Advance Access publication July 16, 2014 Mediodorsal and Visual Thalamic Connectivity Differ in Schizophrenia and Bipolar

More information