Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI"

Transcription

1 a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v KD fl/fl Rabbit IgG DAPI fl/fl Mouse IgG DAPI 40KD fl/fl c -/- fl/fl c -/- 20 µm Supplementary Fig. 1. Effect of overexpression or deletion on Na v 1.5 expression. (a & b) Effect of adenoviral overexpression of on expression of Na v 1.5 at protein (a) or mrna (b) level in rat neonatal cardiac myocytes. n = 4 for Ad-LacZ and Ad-. (c) expression in hearts of c -/- mouse with conditional deletion of cardiomyocyte. (d) Representative photomicrographs showing immunostaining for in the cardiomyocytes isolated from fl/fl and c -/- mouse. (e) Immunoblots showing Na v 1.5 expression in fl/fl and c -/- mouse hearts. (f) Negative controls for immunofluorescence using non-immune mouse (red) and rabbit (green) IgGs. Ad-: adenovirus expressing ; Ad-LacZ: control adenovirus expressing E. Coli LacZ. Uncropped blots are shown in supplementary figure 8. Independent sample t-test was used. For box-and-whiskers plots, center line shows median end of box shows IQR and whiskers show minima and maxima within 1.5 IQR. 1

2 a b Relative currents Na v 1.5 Na v 1.5+S irt1 Na v 1.5+ (H363Y) Relative conductance Relative currents Ex-242 Ex Relative conductance c d Relative currents Na v 1.5 Na v 1.5K 1479A Na v 1.5K 1479A + S irt1 Na v 1.5K 1479A +(H363Y) Relative conductance Relative currents Na v 1.5-W T Na v 1.5-K 1479R Na v 1.5-K 1479Q Relative conductance Membrane potential (mv) Membrane potential (mv) Supplementary Fig. 2. Activation and inactivation plots for wild type, mutant, and native Na v 1.5 with overexpression or inhibition. (a) Effect of and dominant negative (H363Y) expression on steady state activation and inactivation of Na v 1.5 expressed in HEK 293 cells. n =10 cells for Na v 1.5 and Na v 1.5+ (H363Y), n= 11 cells for Na v (b) Effect of inhibitor Ex-243 on steady state activation and inactivation of native Na v 1.5 in rat neonatal cardiac myocytes. n =6 cells for Ex-242, n= 5 cells for Ex-243. (c) Effect of and (H363Y) expression on steady state activation and inactivation currents in HEK 293 cells expressing K1479A-Na v 1.5. n= 8 cells for Na v 1.5, n = 6 cells for Na v 1.5+, and n=7 cells for Na v 1.5-K1479A and Na v 1.5-K1479A+ (H363Y). (d) Effect of K1479R and K1479Q mutations on steady state activation and inactivation currents in HEK 293 cells expressing Na v 1.5-WT, Na v 1.5-K 1479R or Na v 1.5-K 1479Q. n= 8 cells for Na v 1.5-WT, n = 9 cells for Na v 1.5- K 1479R, and n=10 cells for Na v 1.5-K 1479Q. Independent sample t-test was used. In the XY scatter plot data shown as mean and error bar represents s.e.m. Ex-242: inactive isomer of Ex-243. For XY scatter plots data is shown as mean and error bar represents s.e.m. 2

3 a 150 ms b Normalized current 50 ms 50 ms 0.2 mv 0.05 mv fl/fl c -/- 150 ms Late current (I Na, t150ms / I Na, peak ) p = 0.89 fl/fl c -/- c V max (V/s) * APD (ms) * fl/fl c -/- 0 d fl/fl * * c -/- APD 25 APD 50 APD 75 APD 90 * e Resting membrane potential (mv) p = 0.19 fl/fl c -/- Supplementary Fig. 3. Effect of cardiomyocyte deletion on late I Na, V max, cardiac action potential duration, and resting membrane potential. Late sodium current was measured in response to a 200 ms voltage steps to 20 mv from a holding potential of 120 mv. (a) Representative whole-cell I Na in ventricular cardiomyocytes isolated from fl/fl and c -/- mice (Normalized to the peak I Na ). Lower panel shows voltage-expanded view of the I Na. (b) Mean I Na at 150 ms. n = 7 cells for fl/fl and n = 5 cells for c -/-. (c & d) Maximum velocity (V max ) of upstroke of the action potential (AP) (c) and action potential duration (APD) (d) in ventricular myocytes isolated from c -/- compared to control fl/fl mice. P < 0.05, * vs. fl/fl. n = 7 cells for fl/fl and n = 6 cells for c -/-. (e) Resting membrane potential in cardiomyocytes isolated from c -/- and fl/fl mice. n = 11 cells for fl/fl and n = 8 cells for c -/-. Independent sample t-test was used. Data shown as mean and error represents s.e.m. For box-and-whiskers plots, center line shows median, end of box shows IQR, and whiskers show minima and maxima within 1.5 IQR. 3

4 a IP: Na V 1.5 Ace-K Na V 1.5 Myc- Ad-Lac-Z Ad-SIRT1 (H363Y) 220KD 220KD 110KD b Ace-K Na V 1.5(III-IV) NAM Ace-K Na V 1.5 Supplementary Fig. 4. Sirtuin1 and non-sirtuin HDACs regulate acetylation of Na v 1.5. (a) Effect of inhibition of by adenoviral overexpression of dominant negative (H363Y) on acetylation of endogenous Na v 1.5 in rat neonatal cardiac myocytes. (b) Effect of inhibition of with NAM, overexpression of, and activation of with resveratrol (Resv.) on acetylation of - Na v 1.5 (III-IV) peptide expressed in HEK 293 cells (c) Effect of Sirtuin inhibition with nicotinamide (NAM 10mM) and HDAC inhibition with trichostatin A (TSA 100nM) on K1479 acetylation of Na v 1.5 in HEK 293 cells expressing Na v 1.5. Uncropped blots are shown in supplementary figure 8. Resveratrol c Control NAM TSA 4

5 a Ace-K p Na V (III-IV) + + b Intensity (counts) c Na V 1.5(III-IV) p Relative peak intensity + d Fold specificity Antibody concentration (ng/ml) e Ace.-K Na V 1.5 Na V Na V (acetyl K 1479 ) 0.02 µg 0.20 µg 2.00 µg Antibody concentration (2.5 ng/ml) Amount of peptide Ace.-K Na V 1.5 IB: Na V 1.5(III/IV) pcdna p300/cbp + + Supplementary Fig. 5. Mass spectrometry identifying Lysine 1479 in Na v 1.5 as targeted for deacetylation by ; generation of acetyl-k1479 antibody (a) Effect of p300/cbp and on lysine acetylation of recombinant -Na v 1.5 (III-IV) peptide in vitro. (b) Representative annotated MS/MS fragmentation spectra of -Na v 1.5 (III-IV) peptide treated with p300/cbp. The acetylated K1479-containing peptide in Na v 1.5 identified with LC-MS/MS analysis was not observed in cells not treated with p300/cbp, or in cells which were sequentially treated with after being incubated with p300/cbp. (c) Relative quantities of ionized acetylated peptide in -Na v 1.5 (III-IV) peptide treated with p300 and p (d-f) Specificity and sensitivity of acetyl- K 1479 antibody for acetylated K1479 of Na v 1.5. (d) Fold specificity of acetyl-k1479 antibody by a quantitative immuno-adsorption assay of antibody binding to a membrane pre-coated with nonacetylated or acetylated peptide. Fold specificity = ratio of affinity of antibody to acetylated vs. non-acetylated peptide. Orange-bar represents the concentration range in which antibody was used for western blot and immunohistochemistry experiments. Dotted line indicates background reading. (e) Dot blot of the non-acetylated or K1479 acetylated peptide (a.a ) of Na v 1.5 with the acetyl-k 1479 antibody. (f) Western blot using acetyl-k1479 antibody on recombinant -Na v 1.5 (III-IV) peptide treated with p300/cbp in vitro. Uncropped blots are shown in supplementary figure 8. f + IP: + 5

6 a Connexin 43 b Connexin 43 fl/fl c -/- Vehicle Ex-527 c Ace-K Na V 1.5 d 80 32KD 18KD 45KD Bip Chop Vehicle Ex-527 Vehicle Ex-527 Supplementary Fig. 6. Effect of deletion or inhibition of cardiomyocyte on connexin 43, Na v 1.5 acetylation, and unfolded protein response. (a & b) Immunohistochemistry and immunoblotting for cardiac connexin 43 in hearts from -/- and fl/fl mice (a) or mice treated with the inhibitor Ex-527 (2mg/kg/day, 14 days) (b). (c) K1479 acetylation of Na v 1.5 in the hearts of mice with treated with Ex-527. (d) Bip and Chop expression in the hearts of mice treated with Ex-527. Uncropped blots are shown in supplementary figure 8. 6

7 Fig. 1a Fig. 1c Fig. 1d Fig. 2a IP: N-IgG IP: Na V 1.5 IP: N-IgG IP: Na V 1.5 cmyc IP: Na V 1.5 IB: Ace-K IP: Na V 1.5 IB: Ace-K Na V 1.5 Rat neonatal CM Na V 1.5 Mouse heart Na v 1.5 Na v 1.5+ Na v 1.5+ (H363Y) Rat neonatal CM IP: Na V 1.5 IB: Na V 1.5 Ex-242 Ex-243 Na V 1.5 (GFP) Control Resv. Fig. 2b Fig. 2c Fig. 2d Fig. 2e -Na V 1.5 (III-IV)+p300 Exp-2 -Na V 1.5(III-IV) -Na V 1.5 (III-IV)+p300 Exp-1 -Na V 1.5(III-IV) Ace-K Ace-K 1479 Na v 1.5 Ace-K 1479 Na v KD 110KD Na v KD Fig. 2f Ace-K 1479 Na v Na V 1.5(III-IV) Ace-CoA p SIRT1 NAD KD 40KD pcdna (H363Y) Fig. 2h Fig. 4f Ace-K 1479 Na v ETN Ace-K 1479 Na v 1.5 GAPDH 100KD 75KD 42KD 34KD SIRT1 Na v 1.5 (N-term) 250KD GAPDH c -/- WT ID No ID No GAPDH ID No Control samples Supplementary Fig. 7. Uncropped immunoblots of indicated figures. 7

8 Suppl. Fig. 1c 110KD Suppl. Fig. 1e Na v 1.5 (N-term) 250KD fl/fl Heart Lung Kidney Spleen c -/- fl/fl Suppl. Fig. 6b c -/- Connexin 43 Vehicle Suppl. Fig. 6c Ace-K 1479 Na v 1.5 Ex-527 Vehicle Ex-527 Suppl. Fig. 4a IP: Na V 1.5 IB: Ace-K IP: Na V 1.5 IB: Na V 1.5 Myc- Suppl. Fig. 4b IP: IB: Ace-K IP: IB: Suppl. Fig. 6d Bip Untreat. NAM Ad-Lac-Z Resveratrol Ad-SIRT1 (H363Y) 220KD 220KD 110KD Suppl. Fig. 5e Ace.-K Na V 1.5 Na V Na V (acetyl K 1479 ) Suppl. Fig. 4c IB: Ace.-K Na V µg 0.20 µg Suppl. Fig. 5a IP: IB: Ace-K IP: IB: -Na V 1.5 (III-IV) -Na V 1.5 (III-IV) Amount of peptide µg p Suppl. Fig. 5f IP: IB: Ace.-K Na V 1.5 IB: Chop 2.00 µg - Na V 1.5(III/IV) pcdna p300/cbp Vehicle Ex-527 Supplementary Fig. 8. Uncropped immunoblots of indicated figures. 8

9 Supplementary Table 1. Kinetics of I Na conducted by wild type or K1479A Na v 1.5 in HEK 293 cells expressing wild type or dominant negative (H363Y), and of I Na conducted by native Na v 1.5 in rat neonatal cardiac myocytes treated with Ex-242 or Ex-243. HEK 293 cells Steady State Activation (V 50, mv) Steady State Inactivation (V 50, mv) Development of Slow Inactivation (ms) Na v ± ± ± 35.2 Recovery from Slow & Fast Inactivation (ms) Slow;174.6 ± 18.6 Fast;10.4 ± 15.0 Mean cell Capacitance (pf) 9.36±0.58 Na v ± ± ± 41.0 Slow;208.9 ± 40.4 Fast;6.4 ± ±0.51 Na v (H363Y) ± ± ± 47.4 K1479A-Na v ± ± ± 41.7 K1479A-Na v K1479A-Na v (H363Y) ± ± ± ± ± ± 25.9 Slow; ± 23.5 Fast;13.9 ± 2.6 Slow;166.8 ± 28.3 Fast;12.8 ± 3.6 Slow;193.8 ± 15.4 Fast;18.3 ± 1.6 Slow;158.6 ± 32.7 Fast; 14.3 ± ± ± ± ±0.88 Rat neonatal cardiac myocytes Ex ± ± ±0.78 Ex ± ± ±0.91 Rat neonatal cardiac myocytes were treated with inhibitor Ex-243 or its inactive control isomer Ex-242. Data shown as mean and error bar represents s.e.m. 9

10 Supplementary Table 2. Voltage-gating of I Na in cardiomyocytes isolated from c -/- and fl/fl mice. Mouse ventricular cardiomyocytes Steady State Inactivation (V 50, mv) Time Constants of the Decay Phase of I Na (ms) fl/fl ± 1.3 (n=7) 1.7 ± 0.1 (n=7) Recovery from Slow & Fast Inactivation (ms) Slow;137.6 ± 31.9 (n=4) Fast;5.6 ± 0.3 c -/ ± 1.8, (n=5) 1.3 ± 0.3 (n=4) Slow;165.1 ± 60.3 (n=4) Fast;4.6 ± 1.6 p ns ns ns ns; p > 0.05 vs. fl/fl. Independent sample t-test was used. Data shown as mean and error bar represents s.e.m. 10

11 Supplementary Table 3. Kinetic properties of wild type, K1479A, and K1479Q Na v 1.5 expressed in HEK 293 cells. Steady State Activation (V 50, mv) Steady State Inactivation (V 50, mv) Na v 1.5-WT (n) Na v 1.5-K 1479R (n) p value Na v 1.5-K 1479Q (n) p value ± 2.7 (8) ± 1.7 (10) ± 2.1(10) ± 2.0 (9) ± 2.0 (9) ± 1.5 (11)

12 Supplementary Table 4. EKG features of c -/- mice and fl/fl mice. Genotype Age (months) N Sex (% Male) HR (min -1 ) PR (msec) QRS (msec) QT (msec) QTc (msec) fl/fl 4.2 ± ± ± ± ± 3 59 ± 3 c -/- 4.4 ± ± ± ± ± 5 54 ± 3 fl/fl 8.3 ± ± ± ± ± 5 49 ± 3 c -/- 9.2 ± ± ± ± 1.0* 74 ± 4* 63 ± 3* * p < 0.05 vs. fl/fl. Independent sample t-test was used. Data shown as mean and error bar represents s.e.m. 12

13 Supplementary Table 5. Effect of inhibition with Ex-527 on EKG features in Scn5a +/+ and Scn5a +/- mice. Scn5a +/+ Mice Basal Ex-527 N 5 4 Age (months) 10.6 ± 0.4 p value RR interval (ms) PR interval (ms) QRS interval (ms) 121 ± ± ± ± ± ± QTc duration (ms) 50.9 ± ± Scn5a +/- Mice Basal Ex-527 N 8 8 Age (months) 11.1 ± 0.2 RR interval (ms) PR interval (ms) QRS interval (ms) 125 ± ± ± ± ± ± QTc duration (ms) 66.5 ± ±

14 Supplementary Table 6. Ambulatory telemetry of c -/- and fl/fl mice. Parameters fl/fl c -/- p value N Age (Months) 7.2 ± ± Sex (male/female) 3/7 8/ Maximum heart rate (beats/min) 751 ± ± Minimum heart rate (beats/min) 360 ± ± Mice with nonsustained VT Longest ventricular pause (msec) 331 ± ± Frequent sinus pauses (>5/hr) o Degree heart block (in 12 hrs) 1.3 ± ± Nonsustained VT, 3 consecutive ventricular beats; Sinus pause, cycle length increase of >50% to >150 msec. Independent sample t-test was used. Data shown as mean and error bar represents s.e.m. 14

15 Supplementary Table 7. General, gross, and echocardiographic features of male fl/fl and c -/- mice. General Parameters fl/fl c -/- p value n 5 6 Age (Months) 5.6 ± ± Heart weight (mg) 157 ± ± Lung weight (mg) 180 ± ± Body weight (grams) 32.7 ± ± Heart weight/body weight ± ± Lung weight/body weight ± ± Echocardiogram Parameters fl/fl c -/- p value n 5 7 Age (Months) 5.6 ± ± Heart rate (beats/minute) 612 ± ± End diastolic Volume (µl) 40 ± 4 51 ± End systolic Volume (µl) 8 ± 2 18 ± LV ejection fraction (%) 80 ± 4 63 ± Cardiac output (µl/minute) 19.4 ± ± Independent sample t-test was used. Data shown as mean and error bar represents s.e.m. 15

16 Supplementary Table 8. Demographic, gross, EKG, and echocardiographic features of hearts from normal donors and patients with idiopathic dilated cardiomyopathy. Normal Parameters Cardiomyopathy Donors Diagnosis Normal Idiopathic Dilated N 4 7 Conduction abnormality - 5 Heart rate ± 8.2 p value PR interval (ms) ± 15.9 Normal <200 QRS interval (ms) ± 13.8 Normal <120 QTc interval (ms) ± 16.3 Normal <450 Ethnicity (% Caucasian) Patient Weight (kg) 70.8 ± ± Patient Height (cm) ± ± Age (Y) 51.0 ± ± Heart Weight (g) ± ± LVEF % 66.3 ± ± 2.5 < CMP; Cardiomyopathy, LVEF%; left ventricular ejection fraction. Independent sample t-test was used. Data shown as mean and error represents s.e.m. 16

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary Figure 1. c Human

Supplementary Figure 1. c Human Supplementary Figure 1 a b c Human Mouse d Gapdh Amino acid sequence and baseline expression of MYDGF N-terminal signal peptides (S-scores) and signal peptide cleavage sites (C-scores) of (a) human MYDGF

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Minjia Tan, Ph.D Shanghai Institute of Materia Medica, Chinese Academy of Sciences

Minjia Tan, Ph.D Shanghai Institute of Materia Medica, Chinese Academy of Sciences Lysine Glutarylation Is a Protein Posttranslational Modification Regulated by SIRT5 Minjia Tan, Ph.D Shanghai Institute of Materia Medica, Chinese Academy of Sciences Lysine: the most frequently modified

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Mouse model of human Barth syndrome

Mouse model of human Barth syndrome Mouse model of human Barth syndrome Zaza Khuchua, PhD Cincinnati Children s Research Foundation Cincinnati, OH, USA Barry J. Byrne, MD, PhD University of Florida Department of Pediatrics Gainesville, FL,

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

How to Read an Athlete s ECG. Sanjay Sharma BSc (Hons), MD, FRCP, FESC

How to Read an Athlete s ECG. Sanjay Sharma BSc (Hons), MD, FRCP, FESC How to Read an Athlete s ECG Sanjay Sharma BSc (Hons), MD, FRCP, FESC Athlete s EKG Vagotonia Sinus bradycardia Sinus arrhythmia First degree AVB ST-elevation Tall T waves Increased chamber size Left ventricular

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Ca 2+ /calmodulin-dependent protein kinase II regulates cardiac Na + channels

Ca 2+ /calmodulin-dependent protein kinase II regulates cardiac Na + channels Research article Ca 2+ /calmodulin-dependent protein kinase II regulates cardiac Na + channels Stefan Wagner, 1 Nataliya Dybkova, 1 Eva C.L. Rasenack, 1 Claudius Jacobshagen, 1 Larissa Fabritz, 2 Paulus

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and

Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and SUPPLEMENTAL MATERIAL Supplemental Methods: Histology of Heart Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and serially sectioned into 5-µm slices. Standard hematoxylin

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

DECLARATION OF CONFLICT OF INTEREST

DECLARATION OF CONFLICT OF INTEREST DECLARATION OF CONFLICT OF INTEREST Disclosures: Research grants & clinical trials (Gilead), honoraria & clinical trials (Berlin-Chemie/Menarini) Ranolazine in Heart Failure with Preserved Ejection Fraction

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

APOLs with low ph dependence can kill all African trypanosomes

APOLs with low ph dependence can kill all African trypanosomes SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence

More information

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g.71598-?_71681+?del

More information

Epigenase HDAC Activity/Inhibition Direct Assay Kit (Fluorometric)

Epigenase HDAC Activity/Inhibition Direct Assay Kit (Fluorometric) Epigenase HDAC Activity/Inhibition Direct Assay Kit (Fluorometric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Epigenase HDAC Activity/Inhibition Direct Assay Kit (Fluorometric)

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Supplemental Figure I

Supplemental Figure I Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries

More information

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq

More information

Supplementary Material

Supplementary Material Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.

More information

Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically

Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically Supplementary Figures Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically synthesized polyubiquitin chains of different length. a, Differential scanning calorimetry traces

More information

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were

More information

PVCs: Do they cause Cardiomyopathy? Raed Abu Sham a, M.D.

PVCs: Do they cause Cardiomyopathy? Raed Abu Sham a, M.D. PVCs: Do they cause Cardiomyopathy? Raed Abu Sham a, M.D. Cardiologist and Electrophysiologist No conflict of interest related to this presentation Objectives 1. PVCs are benign. What is the Evidence?

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

HDAC Assay Kit. (Fluorescent) (version B1) Catalog No

HDAC Assay Kit. (Fluorescent) (version B1) Catalog No HDAC Assay Kit (Fluorescent) (version B1) Catalog No. 56200 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax:

More information

Dialysis-Dependent Cardiomyopathy Patients Demonstrate Poor Survival Despite Reverse Remodeling With Cardiac Resynchronization Therapy

Dialysis-Dependent Cardiomyopathy Patients Demonstrate Poor Survival Despite Reverse Remodeling With Cardiac Resynchronization Therapy Dialysis-Dependent Cardiomyopathy Patients Demonstrate Poor Survival Despite Reverse Remodeling With Cardiac Resynchronization Therapy Evan Adelstein, MD, FHRS John Gorcsan III, MD Samir Saba, MD, FHRS

More information

Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer

Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Article Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Di Zhao, 1,2,5,9 Shao-Wu Zou, 6,9 Ying Liu, 4 Xin Zhou, 1,2,5 Yan Mo, 1,2,3 Ping Wang, 1,5

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

MCB130 Midterm. GSI s Name:

MCB130 Midterm. GSI s Name: 1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal

More information

The Patient with Atrial Fibrilation

The Patient with Atrial Fibrilation Assessment of Diastolic Function The Patient with Atrial Fibrilation Assoc. Prof. Adriana Ilieşiu, FESC University of Medicine Carol Davila Bucharest, Romania Associated Conditions with Atrial Fibrillation

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric)

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) ab156064 Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) Instructions for Use For the quantitative measurement of Histone Deacetylase activity in cell lysates This product is for research

More information

Blocking the Late Sodium Current

Blocking the Late Sodium Current Non-classical Targets in Antiarrhythmic Therapy Blocking the Late Sodium Current Luiz Belardinelli, MD SVP, Cardiovascular Therapeutics Gilead Sciences, CA, USA Madrid June 28, 2011 Disclosures: Full time

More information

REtrive. REpeat. RElearn Design by. Test-Enhanced Learning based ECG practice E-book

REtrive. REpeat. RElearn Design by. Test-Enhanced Learning based ECG practice E-book Test-Enhanced Learning Test-Enhanced Learning Test-Enhanced Learning Test-Enhanced Learning based ECG practice E-book REtrive REpeat RElearn Design by S I T T I N U N T H A N G J U I P E E R I Y A W A

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Quantitative Evaluation of the Effect of P-Glycoprotein on Oral Drug Absorption

Quantitative Evaluation of the Effect of P-Glycoprotein on Oral Drug Absorption Quantitative Evaluation of the Effect of P-Glycoprotein on Oral Drug Absorption -Assessment of Drug Permeability to Rat Small Intestine- College of Pharmacy, Setsunan University, Osaka, Japan Yoshiyuki

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

SUPPLEMENTARY MATERIALS. IL-4 as a Repurposed Biological Drug for Myocardial Infarction through. Augmentation of Reparative Cardiac Macrophages:

SUPPLEMENTARY MATERIALS. IL-4 as a Repurposed Biological Drug for Myocardial Infarction through. Augmentation of Reparative Cardiac Macrophages: 1 SUPPLEMENTARY MATERIALS IL-4 as a Repurposed Biological Drug for Myocardial Infarction through Augmentation of Reparative Cardiac Macrophages: Proof-of-Concept Data in Mice Yusuke Shintani MD PhD, Tomoya

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information

Case Demonstrations in Congenital and Acquired Long QT Syndrome

Case Demonstrations in Congenital and Acquired Long QT Syndrome Case Demonstrations in Congenital and Acquired Long QT Syndrome Can You Make A Correct ECG Interpretation? Li Zhang, MD; 1-2 G. Michael Vincent, MD 1 1. LQTS Studies, Department t of Medicine i LDS Hospital,

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C. N. Petrok, J.

Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C. N. Petrok, J. SUPPLEMENTARY INFORMATION Title: PIP 3 controls synaptic function by maintaining AMPA receptor clustering at the postsynaptic membrane Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C.

More information

SUPPLEMENTAL DATA. Lumen area ( m 2 )

SUPPLEMENTAL DATA. Lumen area ( m 2 ) Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

LABORATORY INVESTIGATION

LABORATORY INVESTIGATION LABORATORY INVESTIGATION Recording Electrocardiograms The taking of an electrocardiogram is an almost universal part of any complete physical examination. From the ECG record of the electrical activity

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information