Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Size: px
Start display at page:

Download "Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition"

Transcription

1 SUPPLEMENTARY INFORMATION Articles In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition Luye Qin 1, Kaijie Ma 1, Zi-Jun Wang 1, Zihua Hu 2, Emmanuel Matas 1, Jing Wei 1 and Zhen Yan 1 * 1 Department of Physiology and Biophysics, Jacobs School of Medicine and Biomedical Sciences, State University of New York at Buffalo, Buffalo, NY, USA. 2 Center for Computational Research, New York State Center of Excellence in Bioinformatics & Life Sciences, State University of New York at Buffalo, Buffalo, NY, USA. These authors contributed equally: Luye Qin and Kaijie Ma. * zhenyan@buffalo.edu Nature Neuroscience Nature America Inc., part of Springer Nature. All rights reserved.

2 Supplementary Figure 1 Romidepsin treatment leads to the sustained increase of social interaction time and social preference in young Shank3- deficient mice. (a) Box plots showing the time spent investigating either the social (Soc) or nonsocial (NS) stimulus during sociability testing in young (5-6 weeks old) male Shank3 +/ΔC mice with a brief treatment of romidepsin (RMD, 0.25 mg/kg, i.p., 3x, n=10) or saline (n=10) prior to and at different days after the injection. F 3,36(treatment) =137.4, P<0.0001; +++ P<0.001, (Soc vs. NS), ** P<0.01, *** P<0.001 (saline vs. romidepsin), two-way rmanova. (b) Representative heat maps illustrating the time spent in different locations of the 3 chambers from the social preference tests in Shank3 +/ΔC mice treated with RMD or saline. Locations of Soc and NS stimuli are labeled with the circles. (c) Bar graphs (mean ± SEM) and scatter plots showing the preference index of the sociability testing in adult (10-11 weeks old) Shank3 +/ΔC (n=13) or WT (n=10) mice before and after romidepsin (0.25 mg/kg, i.p., 3x) treatment. F 3,45 =10.5, P<0.0001; * P<0.05,*** P<0.001, one-way ANOVA. (d) Bar graphs (mean ± SEM) and scatter plots showing the social preference index in Shank3 +/ΔC mice (n=9, ~10 weeks old) before and after the second-round romidepsin treatment. F 2,24 =2.6, ^ P=0.09, one-way ANOVA.

3 Supplementary Figure 2 Current antipsychotics fail to increase social interaction time, while the pan-hdac inhibitor trichostatin A (TSA) transiently improves social behaviors in Shank3-deficient mice. (a-e) Box plots showing the time spent investigating either the social (Soc) or nonsocial (NS) stimulus during sociability testing in young (5-6 weeks old) male Shank3 +/ΔC mice treated with fluoxetine (10 mg/kg, i.p., 14x, a, n=9), clozapine (5 mg/kg, i.p., 3x, b, n=11), valproic acid (VPA, 100 mg/kg, 3x, c, n=11), aripiprazole (1 mg/kg, 3x, d, n=9) or risperidone (0.1 mg/kg, 3x, e, n=10). In (c), F 2,40(treatment) =0.71, P=0.5; +++ P<0.001 (Soc vs. NS), two-way rmanova. (f, g) Plots showing the preference index (f) and the time spent investigating either the Soc or NS stimulus (g) during sociability testing in Shank3 +/ΔC mice before and after TSA treatment (0.5 mg/kg, i.p., 3x, n=8). In (f), F 2,21 =19.7, P<0.0001, one-way ANOVA. In (g), F 2,28(treatment) =4.15, P=0.026; ++ P<0.01, +++ P<0.001 (Soc vs. NS), ### P<0.001 (pre- vs. post-injection), two-way rmanova. Inset (d,e,g): Representative heat maps illustrating the time spent in different locations of the 3 chambers (blue: 0 sec; red: ~20 sec) from the social preference tests of drug-treated Shank3 +/ΔC mice.

4 Supplementary Figure 3 Histone acetylation sites are identified on Grin2a and Grin2b promoters. (a) PCR images showing the ChIP (AcetyH3-occupied DNA), input (total DNA) and no-template control (NTC) signals with 3 primers (P1, P2, P3) designed against the promoter regions of Grin2a and Grin2b. The expected sizes of PCR products are labeled on the gels. The final primers used in the quantitative ChIP experiments are labeled by red circles. Top: diagram showing the primer locations on the 5' upstream sequence of Grin2a and Grin2b. TSS, transcriptional start site. (b) The amplification curve and melt curve for AcetyH3- ChIP, input, and IgG control samples.

5 Supplementary Figure 4 Romidepsin treatment restores NMDAR synaptic function and global histone acetylation at d, but not d, postinjection. (a,b) Input-output curves of NMDAR-EPSC in PFC pyramidal neurons from Shank3 +/ΔC mice (Het, male) receiving treatment of romidepsin (RMD, i.p., 0.25 mg/kg, 3x) or saline. Recordings were performed at days (a) or days (b) post-injection. n=12 cells/3 mice each group. In (a), F 1,22(treatment) =13.56, P=0.0013; * P<0.05, *** P<0.001, two-way rmanova. Data are mean ± SEM. Inset: representative NMDAR-EPSC traces. (c,d) Immunoblots and quantification analysis of the level of acetylated H3 and total H3 in the nuclear fraction of cortical slices from WT or Shank3 +/ΔC mice (male) treated with saline or romidepsin at days or days post-injection. n=6 each group. In (d), F 2,15 =12.55, P= (16-18 days); F 2,15 =27.72, P< (30-32 days); ** P<0.01, *** P<0.001, ns, not significant, one-way ANOVA.

6 Supplementary Figure 5 Histone acetylation sites are identified on Arhgef7 and Limk1 promoters. (a,b) PCR images showing the ChIP (AcetyH3-occupied DNA), input (total DNA) and no-template control (NTC) signals with 3 primers (P1, P2, P3) designed against the promoter regions of Arhgef7 and Limk1. The expected sizes of PCR products are labeled on the gels. Top Inset: diagram showing the primer locations on the 5' upstream sequence of Arhgef7 and Limk1. TSS, transcriptional start site. Right Inset: The amplification curve and melt curve for AcetyH3-ChIP, input, and NTC samples. The final primers used in the quantitative ChIP experiments are labeled by red circles.

7 Supplementary Figure 6 Romidepsin treatment restores actin filaments in PFC of Shank3-deficient mice. (a) High magnification confocal images (40x) of F-actin staining with phalloidin (co-stained with PSD-95 and DAPI) in PFC slices of WT vs. Shank3 +/ΔC mice (5-6 weeks old, male) with i.p. injections of saline or romidepsin (0.25 mg/kg, 3x). (b) Quantification of PSD-95 levels (integrated densities) in PFC slices of different animal groups. n=27 images/3 mice each group.

8 Supplementary Figure 7 Romidepsin treatment has no effect on the expression of genes encoding NMDAR subunits or actin regulators in other brain regions and peripheral organs of Shank3-deficient mice. (a,b) Quantitative real-time RT-PCR data on the mrna level of Grin1, Grin2a, Grin2b, Arhgef7 and Limk1 in striatum, VTA, kidney and heart from WT or Shank3 +/ΔC mice (5-6 weeks old, male) injected with saline or romidepsin (0.25 mg/kg, i.p., 3x). n=6 each group.

9 Supplementary Figure 8 Full blots for Figures 1, 3 and 4. -

10

11 Supplementary Figure 9 Full blots for Figures 5 and 6 and Supplementary Figure 4. -

Amelioration of autism-like social deficits by targeting histone methyltransferases EHMT1/2 in Shank3-deficient mice

Amelioration of autism-like social deficits by targeting histone methyltransferases EHMT1/2 in Shank3-deficient mice Molecular Psychiatry https://doi.org/1.138/s4138-19-351-2 ARTICLE Amelioration of autism-like social deficits by targeting histone methyltransferases EHMT1/2 in Shank3-deficient mice Zi-Jun Wang 1 Ping

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles

More information

Two distinct mechanisms for experiencedependent

Two distinct mechanisms for experiencedependent SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0150-0 In the format provided by the authors and unedited. Two distinct mechanisms for experiencedependent homeostasis Michelle C.

More information

Supplementary Figure 1. mir124 does not change neuron morphology and synaptic

Supplementary Figure 1. mir124 does not change neuron morphology and synaptic Supplementary Figure 1. mir124 does not change neuron morphology and synaptic density. Hippocampal neurons were transfected with mir124 (containing DsRed) or DsRed as a control. 2 d after transfection,

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,

More information

Structural basis for the role of inhibition in facilitating adult brain plasticity

Structural basis for the role of inhibition in facilitating adult brain plasticity Structural basis for the role of inhibition in facilitating adult brain plasticity Jerry L. Chen, Walter C. Lin, Jae Won Cha, Peter T. So, Yoshiyuki Kubota & Elly Nedivi SUPPLEMENTARY FIGURES 1-6 a b M

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

Supplementary Information

Supplementary Information Supplementary Information D-Serine regulates cerebellar LTD and motor coordination through the 2 glutamate receptor Wataru Kakegawa, Yurika Miyoshi, Kenji Hamase, Shinji Matsuda, Keiko Matsuda, Kazuhisa

More information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors

Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Ka-Cheuk Liu, Gunter Leuckx, Daisuke Sakano, Philip A. Seymour, Charlotte L. Mattsson, Linn Rautio, Willem Staels, Yannick Verdonck,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)

Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) 1 Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) and CD45 (b) in fixed sections of binocular visual cortex

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre

More information

The subcortical maternal complex controls symmetric division of mouse zygotes by

The subcortical maternal complex controls symmetric division of mouse zygotes by The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Histone deacetylase inhibitor MS-275 restores social and synaptic function in a Shank3-deficient mouse model of autism

Histone deacetylase inhibitor MS-275 restores social and synaptic function in a Shank3-deficient mouse model of autism www.nature.com/npp ARTICLE Histone deacetylase inhibitor MS-275 restores social and synaptic function in a Shank3-deficient mouse model of autism Kaijie Ma 1, Luye Qin 1, Emmanuel Matas 1, Lara J. Duffney

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality. Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Ube3a is required for experience-dependent maturation of the neocortex

Ube3a is required for experience-dependent maturation of the neocortex Ube3a is required for experience-dependent maturation of the neocortex Koji Yashiro, Thorfinn T. Riday, Kathryn H. Condon, Adam C. Roberts, Danilo R. Bernardo, Rohit Prakash, Richard J. Weinberg, Michael

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior

Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior Supplementary Figure 1 Trial structure for go/no-go behavior a, Overall timeline of experiments. Day 1: A1 mapping, injection of AAV1-SYN-GCAMP6s, cranial window and headpost implantation. Water restriction

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Hormonal gain control of a medial preoptic area social reward circuit

Hormonal gain control of a medial preoptic area social reward circuit CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,

More information

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

Social transmission and buffering of synaptic changes after stress

Social transmission and buffering of synaptic changes after stress SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

mtorc2 controls actin polymerization required for consolidation of long-term memory

mtorc2 controls actin polymerization required for consolidation of long-term memory CORRECTION NOTICE Nat. Neurosci.; doi:1.138/nn.3351 mtorc2 controls actin polymerization required for consolidation of long-term memory Wei Huang, Ping Jun Zhu, Shixing Zhang, Hongyi Zhou, Loredana Stoica,

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Supplemental Materials Molecular Biology of the Cell

Supplemental Materials Molecular Biology of the Cell Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices 45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing

More information

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2. a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]

More information

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

Dopamine in Ube3a m-/p+ mice. Online Supplemental Material

Dopamine in Ube3a m-/p+ mice. Online Supplemental Material Online Supplemental Material S1 Supplemental Figure 1. Schematic of rate-dependent intracranial self-stimulation (ICSS) (A) Mice implanted with monopolar stimulating electrodes to the medial forebrain

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,

More information

Inhibition of DYRK1A stimulates human beta-cell proliferation

Inhibition of DYRK1A stimulates human beta-cell proliferation Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns

More information

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9! Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain

More information

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

More information

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

GABA from reactive astrocytes impairs memory in mouse models of Alzheimer disease

GABA from reactive astrocytes impairs memory in mouse models of Alzheimer disease SUPPLEMENTARY INFORMATION from reactive astrocytes impairs memory in mouse models of Alzheimer disease Seonmi Jo *, Oleg Yarishkin *, Yu Jin Hwang, Ye Eun Chun, Mijeong Park, Dong Ho Woo, Jin Young Bae,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

IgG3 regulates tissue-like memory B cells in HIV-infected individuals

IgG3 regulates tissue-like memory B cells in HIV-infected individuals SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-018-0180-5 In the format provided by the authors and unedited. IgG3 regulates tissue-like memory B cells in HIV-infected individuals Lela

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

Chromatin-Based Regulation of Gene Expression

Chromatin-Based Regulation of Gene Expression Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses

Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses Cell Reports, Volume 26 Supplemental Information Dorsal Raphe Dual Serotonin-Glutamate Neurons Drive Reward by Establishing Excitatory Synapses on VTA Mesoaccumbens Dopamine Neurons Hui-Ling Wang, Shiliang

More information

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain. Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,

More information