Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:

Size: px
Start display at page:

Download "Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:"

Transcription

1 Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli Liu,, Jue Wang,, Ying Peng, Haibao Shang,, Ning Hou,, Xiaomin Hu,, Yi Ding,, Yao Xiao,, Can Wang,, Fanxin Zeng,, Jiaming Mao,, Jun Zhang,, Dongwei Ma,, Xueting Sun,, Chuanyun Li,, Rui-Ping Xiao,, *, Xiuqin Zhang, * State Key Laboratory of Membrane Biology, Institute of Molecular Medicine, Peking University, Beijing 87, China. Peking-Tsinghua Center for Life Sciences, Beijing 87, China. Beijing Key Laboratory of Cardiometabolic Molecular Medicine, Peking University, Beijing 87, China. Department of Surgery, Third Affiliated Hospital of Peking University, Beijing 87, China. *Corresponding author: Xiuqin Zhang, M.D., Ph.D. Institute of Molecular Medicine, Peking University, Beijing 87, China. zhangxq@pku.edu.cn Tel: (86) Fax: (86) Rui-Ping Xiao, M.D., Ph.D. Institute of Molecular Medicine, Peking University, Beijing 87, China. xiaor@pku.edu.cn Tel: (86) Fax: (86)

2 Supplemental Material SUPPLEMENTAL FIGURES Supplemental Fig. Correlation between telemetric and cuff BP. Systolic blood pressure (a) and diastolic blood pressure (b) of monkeys with telemetric implants ( control normotensive and 7 metabolic syndrome hypertensive) measured simultaneously with a mercury sphygmomanometer (cuff) and telemetry min after anesthesia with ketamine ( mg/kg, i.m.). Supplemental Fig. Plasma concentrations of potassium (a), TCh (b), TG (c), ALT and AST (d), urea (e), and creatinine (f) of MetS hypertensive (n = 7) monkeys at baseline, treated with Eplerenone for days ( mg/kg/day, p.o., once a day) and washed out for days. Data are expressed as mean ± SEM. MetS, metabolic syndrome; TCh, total cholesterol, TG, Triglyceride; ALT, aspartate aminotransferase; AST, alanine aminotransferase. Supplemental Fig. Plasma concentrations of adiponectin (a), leptin (b), MCP- (c), and TNF-α (d) of the MetS hypertensive monkeys at baseline and after days of Eplerenone treatment. Data are expressed as mean ± SEM. MCP-, monocyte chemoattractant protein-; TNF-α, tumor necrosis factor α.

3 a Systolic Blood Pressure b Dias tolic Blood Pres sure Blood pressure by cuff (mmhg) y =.9x +.9 R =.967 Blood pressure by telemetry (mmhg) Blood pressure by cuff (mmhg) y =.88x +.78 R =.77 Blood pressure by telemetry (mmhg) Supplemental Figure

4 a b c Washout days Potassium (mmol/l)... TCh (mmol/l)... TG (mmol/l).... d e f Plasma concentration (U/L) ALT AST... Urea (mmol/l) 6... Creatine ( mol/l) 8... Supplemental Figure

5 a b Adiponectin (ng/ml) P =. Leptin (ng/ml) P =. c P =.89 d P =.6 MCP- (pg/ml) TNF- (pg/ml) Supplemental Figure

6 Supplemental Table. F value of the BP Circadian Rhythm in Control Normotension and MetS Hypertension Monkeys Group Animal ID# SBP DBP MBP HR.6 Control normotension.6.6 MetS hypertension MetS indicates metabolic syndrome; SBP, systolic blood pressure; DBP, diastolic blood pressure; MBP, mean blood pressure; HR, heart rate.

7 Supplemental Table. F value of the BP Circadian Rhythm before and after Eplerenone treatment in MetS Hypertension Monkeys Group Animal ID# SBP DBP MBP HR Eplerenone MetS indicates metabolic syndrome; SBP, systolic blood pressure; DBP, diastolic blood pressure; MBP, mean blood pressure; HR, heart rate.

Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic

Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li

More information

Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a

Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a Supporting information for Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based Metabolomics and Serum Amino Acid Profiles in Obese Women from a Randomized Controlled Study Shanshan

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Validation of the OMRON 705 IT blood pressure measuring device according to the International Protocol of the European Society of Hypertension

Validation of the OMRON 705 IT blood pressure measuring device according to the International Protocol of the European Society of Hypertension Validation of the OMRON 705 IT blood pressure measuring device according to the International Protocol of the European Society of Hypertension M. EL ASSAAD, J. TOPOUCHIAN, G. LABAKI, R. ASMAR L Institut

More information

Epidemiology of community pre-hypertensive patients and related risk factors in Chengdu city

Epidemiology of community pre-hypertensive patients and related risk factors in Chengdu city Family Medicine and Community Health ORIGINAL ORIGINAL Epidemiology of community pre-hypertensive patients and related risk factors in Chengdu city Xinyun Chen 1, Yafei Yan 1, Fang Qin, Xiaojing Jiang

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

University of Padova, Padua, Italy, and HARVEST Study Group, Italy

University of Padova, Padua, Italy, and HARVEST Study Group, Italy University of Padova, Padua, Italy, and HARVEST Study Group, Italy ISOLATED SYSTOLIC HYPERTENSION IN THE YOUNG DOES NOT IMPLY AN INCREASED RISK OF FUTURE HYPERTENSION NEEDING TREATMENT Mos L, Saladini

More information

290 Biomed Environ Sci, 2016; 29(4):

290 Biomed Environ Sci, 2016; 29(4): 290 Biomed Environ Sci, 2016; 29(4): 290-294 Letter to the Editor Prevalence and Predictors of Hypertension in the Labor Force Population in China: Results from a Cross-sectional Survey in Xinjiang Uygur

More information

24 (TUDCA) TUDCA TUDCA. [DOI] /j.issn

24 (TUDCA) TUDCA TUDCA. [DOI] /j.issn 968 2017 11 1 42 11 [ ] Wistar 56 6 50 10% 8 24 (TUDCA) (VFW) (FBG) (FINS) (HOMA-IR) (TC) (TG) (SBP) (DBP) N- - -D- (NAG) (m-alb) (BUN) (Scr) VFW FINS HOMA-IR TC TG SBP DBP NAG (P0.05)

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Validation of the SEJOY BP-1307 upper arm blood pressure monitor for home. blood pressure monitoring according to the European Society of Hypertension

Validation of the SEJOY BP-1307 upper arm blood pressure monitor for home. blood pressure monitoring according to the European Society of Hypertension Validation of the SEJOY BP-1307 upper arm blood pressure monitor for home blood pressure monitoring according to the European Society of Hypertension International Protocol revision 2010 Short title: Validation

More information

Depok-Indonesia STEPS Survey 2003

Depok-Indonesia STEPS Survey 2003 The STEPS survey of chronic disease risk factors in Indonesia/Depok was carried out from February 2003 to March 2003. Indonesia/Depok carried out Step 1, Step 2 and Step 3. Socio demographic and behavioural

More information

Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *

Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * 814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,

More information

Relationship between cardiovascular risk factors and traditional Chinese constitution in subjects with high-normal blood pressure

Relationship between cardiovascular risk factors and traditional Chinese constitution in subjects with high-normal blood pressure World Journal of Cardiovascular Diseases, 2013, 3, 234-238 http://dx.doi.org/10.4236/wjcd.2013.32036 Published Online April 2013 (http://www.scirp.org/journal/wjcd/) WJCD Relationship between cardiovascular

More information

300 Biomed Environ Sci, 2018; 31(4):

300 Biomed Environ Sci, 2018; 31(4): 300 Biomed Environ Sci, 2018; 31(4): 300-305 Letter to the Editor Combined Influence of Insulin Resistance and Inflammatory Biomarkers on Type 2 Diabetes: A Population-based Prospective Cohort Study of

More information

Thyroid Function and Risk of Non-Alcoholic Fatty Liver Disease in Euthyroid Subjects

Thyroid Function and Risk of Non-Alcoholic Fatty Liver Disease in Euthyroid Subjects Thyroid function and NAFLD., 2018; 17 (5): 779-788 ORIGINAL ARTICLE September-October, Vol. 17 No. 5, 2018: 779-788 779 The Official Journal of the Mexican Association of Hepatology, the Latin-American

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

Effect of urinary trypsin inhibitor on inflammatory cytokines and organ function in patients with cardiopulmonary bypass

Effect of urinary trypsin inhibitor on inflammatory cytokines and organ function in patients with cardiopulmonary bypass European Review for Medical and Pharmacological Sciences 2017; 21: 2220-2225 Effect of urinary trypsin inhibitor on inflammatory cytokines and organ function in patients with cardiopulmonary bypass H.-Y.

More information

A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... Monday, July 27, 2009

A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... Monday, July 27, 2009 A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... 1 At a dose of 600 mg twice a day... 2 Reduced coronary events by 37%... 3 Reduced death from coronary heart disease

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

Shihui Fu 1,2, Ying Lin 2, Leiming Luo 1* and Ping Ye 1*

Shihui Fu 1,2, Ying Lin 2, Leiming Luo 1* and Ping Ye 1* Fu et al. BMC Gastroenterology (2017) 17:49 DOI 10.1186/s12876-017-0607-8 RESEARCH ARTICLE Open Access The relationship of serum alanine aminotransferase normal-range levels to arterial stiffness and metabolic

More information

Sponsor / Company: Sanofi Drug substance(s): Insulin Glargine (HOE901) Insulin Glulisine (HMR1964)

Sponsor / Company: Sanofi Drug substance(s): Insulin Glargine (HOE901) Insulin Glulisine (HMR1964) These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company: Sanofi Drug substance(s):

More information

Relationship of Body Mass Index, Waist Circumference and Cardiovascular Risk Factors in Chinese Adult 1

Relationship of Body Mass Index, Waist Circumference and Cardiovascular Risk Factors in Chinese Adult 1 BIOMEDICAL AND ENVIRONMENTAL SCIENCES 23, 92-101 (2010) www.besjournal.com Relationship of Body Mass Index, Waist Circumference and Cardiovascular Risk Factors in Chinese Adult 1 SONG-MING DU *, #, GUAN-SHENG

More information

902 Biomed Environ Sci, 2014; 27(11):

902 Biomed Environ Sci, 2014; 27(11): 902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type

More information

ALKA VITA DIABETES TEST

ALKA VITA DIABETES TEST ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O

More information

BackBeat Cardiac Neuromodulation Therapy (CNT) for Immediate, Substantial and Sustained Lowering of Blood Pressure. Daniel Burkhoff MD PhD

BackBeat Cardiac Neuromodulation Therapy (CNT) for Immediate, Substantial and Sustained Lowering of Blood Pressure. Daniel Burkhoff MD PhD BackBeat Cardiac Neuromodulation Therapy (CNT) for Immediate, Substantial and Sustained Lowering of Blood Pressure Daniel Burkhoff MD PhD Director Heart Failure, Hemodynamics and Mechanical Support Research

More information

Conventional and Ambulatory Blood Pressure as Predictors of Retinal Arteriolar Narrowing

Conventional and Ambulatory Blood Pressure as Predictors of Retinal Arteriolar Narrowing Online Supplement and Ambulatory as Predictors of Retinal Arteriolar Narrowing Fang-Fei Wei 1, Zhen-Yu Zhang 1, Lutgarde Thijs 1, Wen-Yi Yang 1, Lotte Jacobs 1, Nicholas Cauwenberghs 1, Yu-Mei Gu 1, Tatiana

More information

SITA 100 mg (n = 378)

SITA 100 mg (n = 378) Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

More information

Plasma auto-antibodies to angiotensin II receptors are correlated with blood pressure and inflammatory factors in hypertension patients

Plasma auto-antibodies to angiotensin II receptors are correlated with blood pressure and inflammatory factors in hypertension patients European Heart Journal Supplements (2015) 17 (Supplement B), B65 B70 The Heart of the Matter doi:10.1093/eurheartj/suv016 Plasma auto-antibodies to angiotensin II receptors are correlated with blood pressure

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and

More information

Patient is healthy with no chronic disease or significant risk factors [16%].

Patient is healthy with no chronic disease or significant risk factors [16%]. AAFP Risk Level 1 Patient is healthy with no chronic disease or significant risk factors [16%]. Exclude the following chronic problems from active patient list o Depression o Diabetes Type I or Type II

More information

Research Article The Association of Retinopathy and Plasma Glucose and HbA1c: A Validation of Diabetes Diagnostic Criteria in a Chinese Population

Research Article The Association of Retinopathy and Plasma Glucose and HbA1c: A Validation of Diabetes Diagnostic Criteria in a Chinese Population Diabetes Research Volume 216, Article ID 434129, 7 pages http://dx.doi.org/1.1155/216/434129 Research Article The Association of Retinopathy and Plasma Glucose and HbA1c: A Validation of Diabetes Diagnostic

More information

Liver Enzymes Concentrations Are Closely Related to Pre diabetes: Findings of the Shanghai Diabetes Study II (SHDS II) *

Liver Enzymes Concentrations Are Closely Related to Pre diabetes: Findings of the Shanghai Diabetes Study II (SHDS II) * 30 Biomed Environ Sci, 2012; 25(1): 30 37 Original Article Liver Enzymes Concentrations Are Closely Related to Pre diabetes: Findings of the Shanghai Diabetes Study II (SHDS II) * GAO Fei 1, PAN Jie Min

More information

SUPPLEMENTAL DATA. Lumen area ( m 2 )

SUPPLEMENTAL DATA. Lumen area ( m 2 ) Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PROPRIETARY DRUG NAME / GENERIC DRUG NAME: Caduet / Amlodipine

More information

Effect of Salt Intake on Plasma and Urinary Uric Acid Levels in Chinese Adults: An Interventional Trial

Effect of Salt Intake on Plasma and Urinary Uric Acid Levels in Chinese Adults: An Interventional Trial www.nature.com/scientificreports Received: 9 October 2017 Accepted: 8 January 2018 Published: xx xx xxxx OPEN Effect of Salt Intake on Plasma and Urinary Uric Acid Levels in Chinese Adults: An Interventional

More information

Higher non-hdl-cholesterol to HDLcholesterol ratio linked with increased nonalcoholic steatohepatitis

Higher non-hdl-cholesterol to HDLcholesterol ratio linked with increased nonalcoholic steatohepatitis Wang et al. Lipids in Health and Disease (2018) 17:67 https://doi.org/10.1186/s12944-018-0720-x RESEARCH Open Access Higher non-hdl-cholesterol to HDLcholesterol ratio linked with increased nonalcoholic

More information

Todd S. Perlstein, MD FIFTH ANNUAL SYMPOSIUM

Todd S. Perlstein, MD FIFTH ANNUAL SYMPOSIUM Todd S. Perlstein, MD FIFTH ANNUAL SYMPOSIUM Faculty Disclosure I have no financial interest to disclose No off-label use of medications will be discussed FIFTH ANNUAL SYMPOSIUM Recognize changes between

More information

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio

More information

(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects

(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects Table 1. Distribution of baseline characteristics across tertiles of OPG adjusted for age and sex (n=6279). Continuous variables are reported as mean with 95% confidence interval and categorical values

More information

Validation Study Result Form

Validation Study Result Form Validation Study Result Form Please complete Section 1 to Section 3 of this form and return it to dabl Educational Trust with copies of the validation plots. The requirements for each of these sections

More information

HbA1c is Positively Associated with Serum Carcinoembryonic Antigen (CEA) in Patients with Diabetes: A Cross-Sectional Study

HbA1c is Positively Associated with Serum Carcinoembryonic Antigen (CEA) in Patients with Diabetes: A Cross-Sectional Study Diabetes Ther (2018) 9:209 217 https://doi.org/10.1007/s13300-017-0356-2 ORIGINAL RESEARCH HbA1c is Positively Associated with Serum Carcinoembryonic Antigen (CEA) in Patients with Diabetes: A Cross-Sectional

More information

Supplementary Table 1. Patient demographics and baseline characteristics (treated patients).

Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Placebo (n=188) 10 mg (n=186) 25 mg (n=189) Total (n=563) Gender, n (%) Male 75 (40) 97 (52) 84 (44) 256 (45)

More information

Research Article The Prevalence of Nonalcoholic Fatty Liver Disease and Relationship with Serum Uric Acid Level in Uyghur Population

Research Article The Prevalence of Nonalcoholic Fatty Liver Disease and Relationship with Serum Uric Acid Level in Uyghur Population e Scientific World Journal, Article ID 393628, 7 pages http://dx.doi.org/10.1155/2014/393628 Research Article The Prevalence of Nonalcoholic Fatty Liver Disease and Relationship with Serum Uric Acid Level

More information

Special Lecture 10/28/2012

Special Lecture 10/28/2012 Special Lecture 10/28/2012 HYPERTENSION Dr. HN Mayrovitz Special Lecture 10/28/2012 Arterial Blood Pressure (ABP) - Definitions ABP Review Indirect Oscillographic Method Resistance (R), Compliance (C)

More information

Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection

Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang

More information

Validation Study Result Form

Validation Study Result Form Validation Study Result Form Please complete Section 1 to Section 5 of this form and return it to dabl Educational Trust with copies of the validation Study Ref. plots. In Section 3 to Section 5, complete

More information

Adiponectin Level Predicts HDL-Cholesterol Level in Type 2 Diabetes

Adiponectin Level Predicts HDL-Cholesterol Level in Type 2 Diabetes The Open Atherosclerosis & Thrombosis Journal, 2012, 5, 1-5 1 Open Access Adiponectin Level Predicts HDL-Cholesterol Level in Type 2 Diabetes Chung-Hua Hsu 1,2, Ying-Li Liao 3, Su-Ching Lin 3 and Pesus

More information

6/10/2016. Hui-Chun Hsu

6/10/2016. Hui-Chun Hsu Hui-Chun Hsu PhD, RN, CDE Chief, Department of Diabetes Management Lee s Endocrinology Clinic Pingtung, Taiwan Disclosure to Participants Conflict of Interest (COI) and Financial Relationship Disclosures:

More information

Yuqing Zhang, M.D., FESC Department of Cardiology, Fu Wai Hospital. CAMS & PUMC, Beijing, China

Yuqing Zhang, M.D., FESC Department of Cardiology, Fu Wai Hospital. CAMS & PUMC, Beijing, China What Can We Learn from the Observational Studies and Clinical Trials of Prehypertension? Yuqing Zhang, M.D., FESC Department of Cardiology, Fu Wai Hospital. CAMS & PUMC, Beijing, China At ARIC visit 4

More information

How Low Do We Go? Update on Hypertension

How Low Do We Go? Update on Hypertension How Low Do We Go? Update on Beth L. Abramson, MD, FRCPC, FACC As presented at the University of Toronto s Saturday at the University Session (September 2003) Arecent World Health Organization report states

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

The Egyptian Journal of Hospital Medicine (Apr. 2017) Vol. 67(1), Page

The Egyptian Journal of Hospital Medicine (Apr. 2017) Vol. 67(1), Page The Egyptian Journal of Hospital Medicine (Apr. 2017) Vol. 67(1), Page 415-424 Assessment of Left Ventricular Diastolic Function in Nonalcoholic Fatty Liver Disease Mohamed Elhussein Mohamed Ali Elnahas

More information

Evolution of blood pressure from adolescents to youth in salt sensitivies: a 18-year follow-up study in Hanzhong children cohort

Evolution of blood pressure from adolescents to youth in salt sensitivies: a 18-year follow-up study in Hanzhong children cohort Mu et al. Nutrition Journal 2012, 11:70 RESEARCH Open Access Evolution of blood pressure from adolescents to youth in salt sensitivies: a 18-year follow-up study in Hanzhong children cohort Jianjun Mu

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia

More information

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,

More information

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu

More information

Nomogram of the Relation of Brachial-Ankle Pulse Wave Velocity with Blood Pressure

Nomogram of the Relation of Brachial-Ankle Pulse Wave Velocity with Blood Pressure 801 Original Article Nomogram of the Relation of Brachial-Ankle Pulse Wave Velocity with Blood Pressure Akira YAMASHINA, Hirofumi TOMIYAMA, Tomio ARAI, Yutaka KOJI, Minoru YAMBE, Hiroaki MOTOBE, Zydem

More information

Relations of body weight status in early adulthood and weight changes until middle age with metabolic syndrome in the Chinese population

Relations of body weight status in early adulthood and weight changes until middle age with metabolic syndrome in the Chinese population International Journal of Community Medicine and Public Health Zhao L et al. Int J Community Med Public Health. 2017 Nov;4(11):4011-4017 http://www.ijcmph.com pissn 2394-6032 eissn 2394-6040 Original Research

More information

Supporting information

Supporting information Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction

More information

Association Between High-density Lipoprotein Cholesterol and Renal Function in Elderly Hypertension

Association Between High-density Lipoprotein Cholesterol and Renal Function in Elderly Hypertension Association Between High-density Lipoprotein Cholesterol and Renal Function in Elderly Hypertension A Cross-sectional Study in Chinese Population Ya-Ping Zhang, MD, PhD, Ming-Gen Lu, PhD, Dayue Darrel

More information

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi;

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi; Evidence-Based Complementary and Alternative Medicine Volume 2016, Article ID 3743427, 6 pages http://dx.doi.org/10.1155/2016/3743427 Research Article The Score Model Containing Chinese Medicine Syndrome

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese

Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese Title page Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese Population Yan Wang 1, #,Wei peng 1,#, Hong-Yan Guo 3,4, Hui Li 3,4, Jie Tian 3,4, Yu-Jing Shi 3,4, Xiao

More information

Zhengtao Liu 1,2,3*, Shuping Que 4*, Lin Zhou 1,2,3 Author affiliation:

Zhengtao Liu 1,2,3*, Shuping Que 4*, Lin Zhou 1,2,3 Author affiliation: Dose-response Relationship of Serum Uric Acid with Metabolic Syndrome and Non-alcoholic Fatty Liver Disease Incidence: AMeta-analysis of Prospective Studies Zhengtao Liu 1,2,3*, Shuping Que 4*, Lin Zhou

More information

Yuliang Cui, Hemei Bu, Xianghua Ma, Sha Zhao, Xiaona Li, and Shan Lu

Yuliang Cui, Hemei Bu, Xianghua Ma, Sha Zhao, Xiaona Li, and Shan Lu Diabetes Research Volume 2016, Article ID 7184123, 6 pages http://dx.doi.org/10.1155/2016/7184123 Research Article The Relation between Serum Uric Acid and Is Dependent upon Hyperinsulinemia in Patients

More information

Serum leptin levels in psoriatic patients with non-alcoholic fatty liver disease

Serum leptin levels in psoriatic patients with non-alcoholic fatty liver disease Original Article Serum leptin levels in psoriatic patients with non-alcoholic fatty liver disease Zahra Hallaji, MD 1,2 Vahideh Lajevardi, MD 1,2 Robabeh Abedini, MD 1,2 Amir Soleymani, MD 1 Azadeh Goodarzi,

More information

THE PHARMA INNOVATION - JOURNAL

THE PHARMA INNOVATION - JOURNAL Received: 23-05-2013 Accepted: 25-06-2013 ISSN: 2277-7695 CODEN Code: PIHNBQ ZDB-Number: 2663038-2 IC Journal No: 7725 Vol. 2 No. 5 2013 Online Available at www.thepharmajournal.com THE PHARMA INNOVATION

More information

connections among resting heart rate, ambulatory blood pressure and left ventricular hypertrophy

connections among resting heart rate, ambulatory blood pressure and left ventricular hypertrophy Int J Clin Exp Med 2016;9(2):4467-4472 www.ijcem.com /ISSN:1940-5901/IJCEM0010035 Original Article The connections among resting heart rate, ambulatory blood pressure and left ventricular hypertrophy in

More information

Research Article Elevated Systemic Neutrophil Count Is Associated with Diabetic Macroalbuminuria among Elderly Chinese

Research Article Elevated Systemic Neutrophil Count Is Associated with Diabetic Macroalbuminuria among Elderly Chinese International Endocrinology Volume 2015, Article ID 348757, 6 pages http://dx.doi.org/10.1155/2015/348757 Research Article Elevated Systemic Neutrophil Count Is Associated with Diabetic Macroalbuminuria

More information

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.3748/wjg.v22.i43.9571 World J Gastroenterol 2016 November 21; 22(43): 9571-9585 ISSN 1007-9327

More information

NORLAND AVENUE PHARMACY PRESCRIPTION COMPOUNDING FOR VETERINARY MEDICINE

NORLAND AVENUE PHARMACY PRESCRIPTION COMPOUNDING FOR VETERINARY MEDICINE OCTOBER 2011 PRESCRIPTION COMPOUNDING N ORLANDA VENUEP HARMACY. COM We customize individual prescriptions for the specific needs of our patients. INSIDE THIS ISSUE: Feline Analgesic Agent Feline Hypertension

More information

Department of Cardiology, China-Japan Friendship Hospital, Beijing (China) 1

Department of Cardiology, China-Japan Friendship Hospital, Beijing (China) 1 European Review for Medical and Pharmacological Sciences Reduction of the morning blood pressure surge treated with Olmesartan in Chinese patients with mild to moderate essential hypertension a multicenter,

More information

Internal and Emergency Medicine Official Journal of the Italian Society of Internal Medicine. ISSN Volume 8 Number 3

Internal and Emergency Medicine Official Journal of the Italian Society of Internal Medicine. ISSN Volume 8 Number 3 Hepatic Steatosis Index and Lipid Accumulation Product as middle-term predictors of incident metabolic syndrome in a large population sample: data from the Brisighella Heart Study Arrigo F. G. Cicero,

More information

Medicine. Association of Sodium Excretion With Metabolic Syndrome, Insulin Resistance, and Body Fat

Medicine. Association of Sodium Excretion With Metabolic Syndrome, Insulin Resistance, and Body Fat Medicine OBSERVATIONAL STUDY Association of Sodium Excretion With Metabolic Syndrome, Insulin Resistance, and Body Fat Se Won Oh, MD, PhD, Kum Hyun Han, MD, PhD, Sang Youb Han, MD, PhD, Ho Seok Koo, MD,

More information

Age-related reference ranges

Age-related reference ranges Authoriser: Peter Beresford Page 1 of 6 Age-related reference ranges Alkaline Phosphatase (ALP) IU/L Both less than 14 days 90 273 Both 14 days

More information

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54 CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects

More information

Prediction of Homeostasis Model Assessment of Insulin Resistance in Japanese Subjects

Prediction of Homeostasis Model Assessment of Insulin Resistance in Japanese Subjects Tokai J Exp Clin Med., Vol. 37, No. 4, pp. 12-16, 212 Prediction of Homeostasis Model Assessment of Insulin Resistance in Japanese Subjects Masako NEGAMI, Eiko TAKAHASHI, Hiroki OTSUKA and Kengo MORIYAMA

More information

imedpub Journals

imedpub Journals Research Article imedpub Journals www.imedpub.com Health Science Journal DOI: 10.21767/1791-809X.1000544 A 48-month Prospective Study of the Effects of Multifactorial Interventions on Cardiovascular Risk

More information

Outline of the Report on Cardiovascular Disease in China, 2010

Outline of the Report on Cardiovascular Disease in China, 2010 Biomed Environ Sci, 2012; 25(3): 251 256 251 Report Outline of the Report on Cardiovascular Disease in China, 2010 National Center for Cardiovascular Disease, China HU Sheng Shou 1, KONG Ling Zhi 2, GAO

More information

MS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers

MS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers Figure S. PGFα, - and -HETE are elevated in of patients with Acute Decompensation (AD) when compared with healthy volunteers. (a-g) Lipidomic LC/ESI- MS/MS analysis of from AD patients and healthy volunteers

More information

Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication

Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication 41 Research Article Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication Amarjeet Singh*, Sudeep bhardwaj, Ashutosh aggarwal Department of Pharmacology, Seth

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Diet-Related Factors, Educational Levels and Blood Pressure in a Chinese Population Sample: Findings from the Japan-China Cooperative Research Project

Diet-Related Factors, Educational Levels and Blood Pressure in a Chinese Population Sample: Findings from the Japan-China Cooperative Research Project 559 Original Article Diet-Related Factors, Educational Levels and Blood Pressure in a Chinese Population Sample: Findings from the Japan-China Cooperative Research Project Yukio YAMORI 1, Longjian LIU

More information

Annals of RSCB Vol. XIV, Issue 1

Annals of RSCB Vol. XIV, Issue 1 THE ROLE OF URIC ACID AS A RISK FACTOR FOR ARTERIAL HYPERTENSION Corina Şerban 1, Germaine Săvoiu 2, Lelia Şuşan 3, Alina Păcurari 3, A. Caraba 3, Anca Tudor 4, Daniela Ionescu 5, I. Romosan 3, A. Cristescu

More information

Clinical Role of Inflammation in Metabolic Diseases

Clinical Role of Inflammation in Metabolic Diseases Clinical Role of Inflammation in Metabolic Diseases Won-Young Lee Department of Endocrinology and Metabolism Kangbuk Samsung Hospital Sungkyunkwan University Medical School, Seoul, Korea (2009-Nov-19)

More information

Characteristics of blood glucose excursions in type 2 diabetes mellitus patients with three different Traditional Chinese Medicine syndromes

Characteristics of blood glucose excursions in type 2 diabetes mellitus patients with three different Traditional Chinese Medicine syndromes Online Submissions: http://www.journaltcm.com J Tradit Chin Med 015 October 15; 35(5): 537-545 info@journaltcm.com ISSN 055-9 015 JTCM. All rights reserved. CLINICAL STUDY TOPIC Characteristics of blood

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

2003 World Health Organization (WHO) / International Society of Hypertension (ISH) Statement on Management of Hypertension.

2003 World Health Organization (WHO) / International Society of Hypertension (ISH) Statement on Management of Hypertension. 2003 World Health Organization (WHO) / International Society of Hypertension (ISH) Statement on Management of Hypertension Writing Group: Background Hypertension worldwide causes 7.1 million premature

More information

The Value of a BP Determination Method Using a Novel Non-Invasive BP Device against the Invasive Catheter Measurement

The Value of a BP Determination Method Using a Novel Non-Invasive BP Device against the Invasive Catheter Measurement The Value of a BP Determination Method Using a Novel Non-Invasive BP Device against the Invasive Catheter Measurement Jinsong Xu 1., Yanqing Wu 1., Hai Su 1 *, Weitong Hu 1, Juxiang Li 1, Wenying Wang

More information

BioScience Trends. 2017; 11(4): Department of VIP Medical Service, Beijing Hospital, National Center of Gerontology, Beijing, China; 2

BioScience Trends. 2017; 11(4): Department of VIP Medical Service, Beijing Hospital, National Center of Gerontology, Beijing, China; 2 Original Article BioScience Trends. 2017; 11(4):418-426. 418 Prevalence of metabolically obese but normal weight (MONW) and metabolically healthy but obese (MHO) in Chinese Beijing urban subjects Yan Zhang

More information

The association between white blood cell subtypes and prevalence and incidence of nonalcoholic fatty liver disease

The association between white blood cell subtypes and prevalence and incidence of nonalcoholic fatty liver disease 834477EJI0010.1177/2058739219834477European Journal of InflammationZhang et al. letter2019 Letter to the Editor The association between white blood cell subtypes and prevalence and incidence of nonalcoholic

More information

Biomed Environ Sci, 2018; 31(2):

Biomed Environ Sci, 2018; 31(2): Biomed Environ Sci, 2018; 31(2): 159-162 159 Letter to the Editor Additive Benefits of Twice Forest Bathing Trips in Elderly Patients with Chronic Heart Failure * MAO Gen Xiang 1,, CAO Yong Bao 1,, YANG

More information