SUPPLEMENTARY INFORMATION
|
|
- Pierce Little
- 5 years ago
- Views:
Transcription
1 doi: /nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide. The eluant was subjected to trypsin digestion and subsequently analyzed by mass spectroscopy and the human RefSeq database. Shown are proteins identified in the eluant that contained greater than two independent peptide fragments. 1
2 Figure 2: Absence of a detectable interaction between Sirt2 and RIP1. L929 cells were transfected with an empty vector (-) or with a vector encoding Flag-tagged Sirt2 (+) to assess potential interactions between Sirt2 and RIP1. As opposed to what was observed for RIP3 (see Figure 1a), no interaction between Sirt2 and RIP1 was detected. 2
3 Figure 3: Expression of Sirt2 in MEFs. Representative example demonstrating the level of Sirt2 expression in two independent isolates of either wild type (WT) or Sirt2 -/- MEFs. Actin is shown as a loading control. 3
4 Figure 4: Absence of RIP1-RIP3 complex formation in Sirt2 knockdown cells. Control L929 cells or L929 cells with stable shrna-mediated knockdown of Sirt2 were analyzed for their ability to form a RIP1-RIP3 complex following TNFα and z-vad-fmk (T/z) treatment. A RIP1- RIP3 complex is only observed in the control lentiviral-infected cells. 4
5 Figure 5: Assessment of endogenous RIP3 acetylation. Endogenous RIP3 acetylation was determined by immunoprecipitation of protein lysates using an acetyl-lysine specific antibody. Acetylation levels were assessed in the presence or absence of Sirt2 knockdown or in the presence or absence of TNFα and z-vad-fmk treatment (T/z). While RIP3 was acetylated under basal conditions, the level of acetylation was not altered by knockdown of Sirt2 or following the induction of necrosis. 5
6 Figure 6: Assessment of RIP1 acetylation. Reverse procedure for detecting RIP1 acetylation using immunoprecipitation of RIP1 followed by Western blotting using an acetyl-lysine antibody (AcK). These results are consistent with results shown in Figure 3 demonstrating that TNFα and z-vad-fmk treatment (T/z) catalyzes RIP1 deacetylation in a Sirt2-dependent fashion. 6
7 Figure 7: Assessment of endogenous RIP1 acetylation. Levels of acetylation for endogenous RIP1 were determined using L929 cells either in the presence or absence of stable Sirt2 knockdown or in the presence or absence of TNFα and z-vad-fmk treatment (T/z). As seen in Figure 3 for epitope-tagged RIP1, levels of endogenous RIP1 declined after necrotic stimulation in a Sirt2-dependent fashion. 7
8 Figure 8: Assessment of Sirt2 activity and NAD levels during necrosis. a, L929 cells were transfected with an empty control vector or with vector encoding for Flag-Sirt2. Samples were prepared with and without stimulation TNFα and z-vad-fmk treatment and protein lysates were subsequently immunoprecipitated with Flag antibody and assessed for Sirt2 specific activity. No detectable differences in Sirt2 activity was observed during necrosis. b, Relative NAD levels based on absorbance at 565 nm was measured in L929 cells under basal conditions and for the first three hours after the induction of necrosis. Both panels represent one representative experiment performed in triplicate. 8
9 Figure 9: Knockdown of RIP3 in L929 cells. Four separate clones (A-D) for stable RIP3 knockdown all showing high degree of knockdown efficiency. Clone B and D were used for the data shown in Figure 3 and these two clones were indistinguishable in their behavior regarding the regulation of RIP1 acetylation. 9
10 Figure 10: The p300 acetyltransferase regulates RIP1 acetylation. Levels of RIP1 acetylation in cells that are transfected as indicated with Flag-RIP1 and HA-tagged p300. As demonstrated, p300 expression dramatically increases basal RIP1 acetylation. 10
11 Figure 11: Lysine 530 of RIP1 is a target of the p300 acetyltransferase. a, Schematic of RIP1 demonstrating the RHIM domain (in blue) and the adjacent Lysine 530 (red). b, Lysine 530 of RIP1 is an in vitro target of acetylation by p300. A peptide corresponding to amino acids 529 to 546 of RIP1 was synthesized with a single lysine residue at position 530. In the absence of p300, only the non-acetylated peptide is seen. After p300 addition, a shift corresponding to the acetylated peptide is observed. These spectrums were obtained on a different mass spectroscopy unit then were used in Fig. 3f, hence the x-axis differs slightly. 11
12 Figure 12: Sirt1 expression does not alter RIP1 acetylation. Cells were transfected with an HAtagged form of RIP1 with or without an epitope-tagged Sirt1 and the level of RIP1 acetylation assessed by acetyl-lysine antibody-mediated immunoprecipitation. Expression of Sirt1 had no effects of RIP1 acetylation levels. See Figure 3g for comparative effect of Sirt2 expression on RIP
13 Figure 13: The role for Lysine 530 is necrosis-induced deacetylation. Unlike wild type RIP1 kinase, the RIP1 K530Q mutant is resistant to deacetylation after stimulation with TNFα and z- VAD-fmk (T/z). Experiments were performed in L929 cells. 13
14 Figure 14: Endogenous RIP1-RIP3 complex formation in myocardium. Complex formation was determined by immunopreciptiation of RIP1 and determination of co-precipitating RIP3. In the absence of AGK2, wild type (Sirt2 +/+ ) hearts demonstrate increased RIP1-RIP3 complex formation after ischemia/reperfusion (I/R) injury. This I/R-stimulated increase in RIP1-RIP3 complex formation is not observed in Sirt2 -/- hearts or in wild type hearts treated with AGK2. Shown is one of two similar experiments. 14
15 Figure 15: Sirt2 -/- mice have smaller infarcts after in vivo coronary artery occlusion. Wild type mice (n=3) and Sirt2 -/- mice (n=4) were subjected to 30 minutes of coronary occlusion followed by reperfusion. As is routinely done, the infarcted region of the myocardium was normalized to the area of myocardium at risk. Analysis was performed in a blinded fashion. Shown is the mean +/- SD, *p<
16 Figure 16: Effects of necrostain-1 on RIP1. a, Treatment with necrostatin-1 blocks the interaction of RIP1 and RIP3 following treatment with TNFα and z-vad-fmk (T/z). b, Necrostatin-1 treatment does not alter the ability of Sirt2 to deacetylate RIP1. RIP1 acetylation was determined by immunoprecipitation (IP) using an acetyl-lysine antibody (AcK) followed by Western blotting for the HA-RIP1 epitope. These experiments may be useful in understanding whether deacetylation is an initial or enforcing event for RIP1-RIP3 interaction, although caution is warranted given that both RIP1 and Sirt2 are overexpressed. 16
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationExpanded View Figures
MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect
More informationWilliam C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationSupplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSupplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationA. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSupplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.10/nature10195 NCBI gene: Tagged Subunit(s: HA-Vpx; FLAG-Cul4 HA-DCAF1 FLAG-Cul4 HA-FLAG-Vpx Mock Vpx (SIVmac 100 (a ; 0.159 (b ; 0.05 DCAF1 DDB1 DDA1 Cul4A 1; 0.024591
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationsupplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
More informationSupplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
More informationScaffold function of long noncoding RNA HOTAIR in protein ubiquitination
Yoon et al, page Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Je-Hyun Yoon,, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka,
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationFigure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationTel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationAppendix. Table of Contents
Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure
More informationSUPPLEMENTARY INFORMATION
Figure S1. Silver staining and immunoblotting of the purified TAK1 kinase complex. The TAK1 kinase complex was purified through tandem affinity methods (Protein A and FLAG), and aliquots of the purified
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationExpanded View Figures
Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationSamali A Figure S1.
Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under
More informationNature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationThe clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationeffects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN
a ISG15 sirna Ctrl #1 #2 ISG15 conjugates IB: ISG15 Virus titer (Pfu/ml) b ISG15 sirna #2 10 7 Ctrl sirna+ifn+wt Ctrl sirna+ifn+67 10 6 ISG15 sirna+ifn+wt ISG15 sirna+ifn+67 10 5 10 4 10 3 Free ISG15 10
More informationCA Tel.: ; Fax: ; ucsd.edu.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 10, pp. 6300 6311, March 7, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. The Phosphatase PHLPP
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: cholesterol manipulation alters the positioning of autophagosomes in cells, related to figure 1. (a) HeLa cells were treated for 24h under conditions reducing
More informationFigure 6: TERT regulates MYC half-life and ubiquitination.
TERT or IgG as indicated. For the western blots, representative images of n= independent experiments are shown. Student s t-test was used, and * indicates p
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationPhosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J.
UvA-DARE (Digital Academic Repository) Phosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J. Link to publication Citation for published version (APA): Keune, W. J. H.
More information