Autoimmunity and Hypertension

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Autoimmunity and Hypertension"

Transcription

1 Autoimmunity and Hypertension Henrique Andrade R. Fonseca PhD 1,2 and Magnus Gidlund PhD 1 I. INTRODUCTION Abstract- The blood circulatory system is intimately linked to the lymphocyte circulatory system and thus, plays an important role in the bodily homeostasis. Strong immunological reaction, such as allergic reactions (e.g. anaphylaxis) will cause imminent effect on the blood pressure and in some cases lead to a fatal event. Less is known how ongoing immune reaction as those manifested in autoimmune reactions can effect blood pressure. In here we review part of this field and suggest some possible mechanisms, with special emphasis on Angiotensin II, hsp and recently discovered immune-reactive apob peptide epitopes on the Low Density Lipoprotein, expressed only on oxidized or modified LDL. These neoantigen formations can be new pathway to lead hypertension disease since there are clinical evidence that support the participations of autoimmunity in blood pressure control. Keywords: Lymphocytes, Autoimmunity, Hypertension, Inflammation Received September 1, 2015, accepted September 13, Immunophysiopathology Laboratory, Department of Immunology, Institute Biomedical Science IV, University of Sao Paulo, São Paulo, Brazil. 2 Sector of Lipids, Atherosclerosis and Vascular Biology, Department of Medicine, Federal University of Sao Paulo, São Paulo, Brazil; Corresponding authors: Henrique A. Fonseca and Magnus Gidlund Av. Prof. Lineu Prestes, 1730 ZIPCODE Cidade Universitária São Paulo, SP, Brazil. address: and DOI: /iti Hypertension is the major driving force in cardiopathy and includes stroke myocardial infarction and as a secondary event impairment of renal function. World-wide hypertension affects approximately onethird of the population. The alarming increase in obesity in the society, regardless of degree of Human development index (e.g. HDI), combined with subsequent impact on this important risk factor motivates a more in-depth knowledge of what leads to hypertension, what mechanisms/factors are involved and how they can be manipulated [1]. The sympathetic nervous system control blood pressure via hormones produced by adrenal glands. Growing evidence suggests that the sympathetic nervous system via various vasoactive hormones contribute to the pathogenesis of hypertension [2]. Most interestingly adrenal glands may also regulate of lymphoid organs by neuroendocrine pathway [3]. The lymphatic system participates in the recirculation of lymphocytes and is connected to the blood circulatory system. Beside its importance for the exchange of cells and serum components between the lymphatic and red blood cell circulatory system it is also the mechanism by which the arterial/venous pressure by virtue of maintenance of the liquid balance and osmotic pressure (i.e. turgor) [4]. Strong immune reactions such as allergic reaction, initiating an anaphylactic reaction will rapidly cause a vasodilation/contraction with severe consequences if not reverted. However it is highly likely that in various degrees, immune reactions as those seen in adjacent or distal autoimmune foci s may cause similar events. For obvious reasons these will be less perturbing however these may cause if chronic cause local damage with distal or systemic consequences. In this case the response can act direct by local tissue damage by cellular or humoral components or indirectly by virtue of cytokines. Antigen-driven cytokines/lymphokines such as interleukin 1-β (IL-1 β), IL-4 and TNF-α with a capacity cause capillary damage or induce SMC 89

2 growth and reduction of arterial/capillary morphology are important targets for further studies [4]. II. IMMUNE CELLS AND HYPERTENSION Inflammation plays an important component in the pathogenesis of hypertension [7]. However, most interestingly studies observed the infiltration of T lymphocytes (T-cells) in the kidney and arteries can, in part, be responsible for changes in blood pressure levels [5,6].The infiltration and accumulation of immune cells in the kidneys, central nervous system and arteries are commonly observed in experimental models of hypertension [2,3,6]. Spontaneously hypertensive rats (SHR) exhibit an infiltration of immune cells prior to hypertension, and the animals with larger infiltrates of macrophages and CD4 T-cells associate with degree of hypertension, suggesting that way the cause-effect with inflammatory process [8-10]. However, whether T cells accumulation in these target organs as result of antigen-induced immune response is still unclear. In the arterial wall where the accumulation of macrophages and T cells is evident [11] Modified LDL and their degradation products (e.g. apob peptides) is a major contributing factor in the various events in the atheroma and plaque formation [12-14]. It has been shown that heat shock protein 70 (HSP-70), implied in atherosclerosis induced autoimmune responses leads to the chronic inflammation in kidney and subsequent hypertension [15]. However others proteins and peptide can be associated with elevated blood pressure and their regulation. Inflammation in hypertension disease can be modulating by angiotensin II with action in distinct regions to control blood pressure. In experimental studies lymphocytes infiltration has been showed in the perivascular aortic tissue in angiotensin II-induced hypertension, desoxycorticosterone acetate (DOCA)- salt hypertension [16] and aldosterone-induced hypertension [17]. In perivascular tissue is showed primarily lymphocytes CD4+ and less CD8+ [16]. The higher arterial blood pressure can occur by angiotensin II central actions in circumventricular regions to lead in perivascular regions activation and infiltration of CD4+T cells [18]. Perivascular immune cells infiltration promote reduction of nitric oxide (NO) viability by increase of oxidative stress leading to higher artery resistance and endothelial dysfunction [19]. Moreover, endothelial permeability are enhanced by oxidative injury, which increases entry of lipoproteins into the subendothelial space, where they are oxidized. This will cause recruitment of inflammatory cells, T cells reacting to and acticvated by angiotensin II promote changes in endothelial morphology that lead to hypertension by increase of artery resistance [20]. Others mechanisms associated with hypertension are immune cells infiltration in kidney, studies using mycophenolate mofetil to block T cells kidney infiltration showed that preventing renal lymphocytes infiltration can reduced or prevent hypertension in animal models [21,22]. These effects of mycophenolate mofetil is supported by studies that show hypertension in angiotensin II-infused mice was suppressed in the recombination activating gene 1 (Rag1 -/- ) which lacks T lymphocytes, and that angiotensin resistance was lost by adoptive transfer of T cell [16]. In addition to subsets CD4+ already mentioned other T cell with function of maintenance self-tolerance has a contrary role to induce hypertension. The T regulatory cells (Tregs) are characterized by expression of the fokhead transcription factor FoxP3+ and surface expression of CD25. Studies have showed that adoptative transfer of Treg cells has a protective effect in hypertensive response to angiotensin II by upregulation of T-cell infiltration into the kidney with reduction in inflammatory signaling [23-24]. The IL-10 derivate the Treg cells has an important effect to preventive endothelial dysfunction, by reduction of superoxide production derivate of angiotensin II stimulate, this pathway is crucial for preventive hypertension [25]. In a clinical study patients received immunosuppressant tacrolimus showed hypertension with reduced numbers of Treg cells concomitant less levels of FK506 binding protein 12 (FKBP12) and TGF-β receptor, resulting in decrease of FoxP3+ cells, and elevation in Th17 cells showed the balance between lymphocytes Th17 and FoxP3+ cells might determine whether hypertension develops in these models [26]. The clinical evidences of the role of T lymphocytes in hypertension was observed by Seaberg et al.,that patients HIV-infected with low CD4+ counts showed reduced prevalence of hypertension compared with antiretroviral treating patients with 90

3 more CD4+ counts. In treated patients the prevalence of hypertension was similar over time to uninfected patients [27]. Hypertensive patients show increase numbers of CD8+ cytotoxic T cells with increase marker CD57 and lost CD28 showing immunosenescence cellular [28] suggesting that inflammation in target organs cold be responsible for increase of neoantigens ( se explanation below) that repeated bouts of stimulation would lead to long-term CD28 loss in hypertensive patients [29]. III. CYTOKINE AND HYPERTENSION Activated T cell produce cytokines such as IL-17 by Th17 cell, a subset of CD4+ cell distinct of Th1 and Th2, and by this can contribute to maintenance of angiotensin II-induced hypertension [30]. Studies in mice lacking isoform IL-17 A (IL-17 -/- ) develop blunted hypertension after angiotensin II infusion and that increase in superoxide production and promote endothelial dysfunction showed in hypertensive wild-type mice does not occur in animals know out for IL-17 [31]. The IL17 likely contributes to vascular pathology in hypertension not only by direct effects, but also recruiting immune cells, active the NADPH oxidase, stimulates chemokines release and promotes chemotaxis [32]. The source of IL-17 is IL-6, acts to polarize both CD4+ and CD8+ cells toward IL-17 release. IL-6 stimulates the liver to produce inflammatory acute phase proteins (C-reactive protein and serum amyloid A) to enhance inflammatory milieu. Clinical and experimental studies have shown strong correlations between IL-6 and presence of hypertension [33]. However, production of IL-6 can derivate of angiotensin II stimulate by smooth muscle cells via a pathway relationship AT1 receptor, increased intracellular calcium, tyrosine kinase and MAP-kinase stimulation to release IL-6 [34]. In humans showed that angiotensin II infusion increases IL-6 levels and aldosterone block by spironolactone prevent hypertension with no changes in IL-6 levels [35]. The mechanism of cytokines interact remains unclear, by IL-6-derivate of kidney and smooth cells induce T cells to release IL-17 leading to hypertension. These inflammatory pathways need further investigations about future pharmacological interventions. IV. AUTOIMMUNITY RESPONSE AND HYPERTENSION The formation of new antigens by secondary modifications such as glycosylation, chemical modifications or proteolytic cleavage creating neoantigens can be targets of autoimmune responses in hypertension as proposed above. The neoantigens formations can be new pathway to lead hypertension disease since clinical evidence that there is a causal link between autoimmune manifestations and impaired blood pressure control. Studies suggest the autoimmunity response to HSP-peptide fragments expressed in kidney, CNS and arteries is associated with elevation in oxidative stress, sympathetic stimulation, and stress associated in animals with hypertension [36-37] In clinical studies essential hypertension is associated with elevated autoantibodies anti-hsp70 [38]. The association of humoral immunity and hypertension was postulated by Kristensen, reported an increase in IgG and IgM autoantibodies in patients with essential hypertension [39-41]. Several examples exist where the antigen is known; an example is HSP have been found to be overexpressed in target organs in animal models of hypertension. Angiotensin-II, ROS, sympathetic activation can induce expression of HSPs in different tissue (kidney, blood vessels and brain) [42-43]. HSP derivate-peptides can stimulate acquired and innate immunity involves the CD91, CD40 and LOX-1 in antigen-present cells [44]. Determination of overexpression HSP-70, for example, might have antigenic properties initiation immune response to alter blood pressure in animal models salt-sensitive hypertension [45]. HSP 70 fragments can induces T- cell response derived IL-10 to blocked the development of salt-sensitive hypertension with reduction of renal inflammation and increases expression of IL-10 in the kidney [46] suggesting a new possibility of immunotherapy target HSP-70 expression for hypertension control. We previous studies [47,48] have showed the oxldl induces differention in T cells with increase expression of HSP-60, higher autoantibodies, and elevation pro-inflammatory status, suggesting that endothelial dysfunction can promote oxidation of LDL particle with possibility the increase HSP expression to lead elevation in autoimmunity response to trigger hypertension disease [47-49]. 91

4 Patients in the early stages of hypertension have shown IgG and IgM antibodies against endothelial cells, revealing a possible role of the humoral response in the pathophysiology of hypertension [50]. The endothelial cells the processes of apoptosis release microparticles can be recognized by the humoral response, especially IgM antibodies with greater affinity for oxidized lipid of membranes that are abundant in senescent cells [51]. The endothelial microparticles are implicated with chronic elevation of blood pressure and endothelial cell senescence to occur hypertension disease [52]. Humoral immunity can recognize oxidized LDL particles similarly to apoptotic cells as discussed above, initiating a response by anti-oxldl antibodies IgG and IgM isotype, more specifically against epitopes formed during the oxidation process have been associated to the degree of hypertension degree [53]. We have showed that reducing blood pressure can modulate humoral IgG anti-oxldl [54] and that metabolic factors associated with obesity can also modify the immune response of patients with hypertension [55]. Several pathological condition driving atherosclerosis and hypertension such as acute inflammation, chronic inflammation modify low density lipoprotein particle. These modification leads to the expression of neoantigens and the immune response against these newly formed antigens have been implied in the pathogenesis of atherosclerosis. Our group has demonstrated that humoral response to apob peptide-derived (apobd) a peptide fragment derived from an integral part of the apob protein, is associated with blood pressure levels [48] and that thet the peptide itself can cause endothelial dysfunction [56]. This peptide neoantigen is generated from the apob part component of LDL particle. The apobd epitope is not expressed on the native, normal, but in particle fragment by degradation. These peptide fragments can be involved with modulate of humoral immunity in hypertension and atherosclerosis process [57,58]. In a prospective study we have shown that HIV infected patients undergoing antiretroviral therapy (ART) demonstrate an inverse correlation between anti-apobd autoantibodies levels and carotid artery intimal-media thickness with subsequent decreased arterial caliber [59]. Yet, our group recently findings other peptide (ApoBDS-1) with immunogenic properties with potential to atherosclerosis contribution, by differentiation T cells to Th1 phenotype with increase inflammatory cytokines. Interestingly, ApoBDS-1 peptide has a specific Ca 2+ receptor to signaling IL-8 expression and increase burst oxidative in inflammatory cells. They ApoBDS-1 peptide can be associated with atherosclerosis process as well as hypertension diseases by inflammatory and oxidative stress increase [60]. Other evidences show that presence of antagonistic antibodies to α-adrenergic receptor, angiotensin type 1 (AT-1) receptor, and β-1 adrenergic receptor are involved with hypertension [61] and the removal of α1-adregergic receptor antibodies in patients with hypertension was shown to reduce blood pressure revealing the clinical relevance of antibodies in higher blood pressure [62]. T-cells subsets have important roles in the development of autoimmune diseases by activation of B cell to production of autoantibodies, however special subset Th2 cells are implicated in humoralmediated immunity and Th17 to release IL-17, which can also increase TNF-α production. These immunity responses are present in different autoimmunity disease, example of Systemic Lupus Erythematosus (SLE), in which patients showed prevalence of hypertension when compared health patients controls [63]. In summary, evidences suggest that cellular and humoral autoimmunity responses may have a pivotal role in the pathogenesis of hypertension. Various subsets of T lymphocytes can participate as well as antibodies. Some of the have been identified (e.g. angiotensin II and apobd) Today we know some candidate antigens and epitopes. The further characterization of the underlying mechanisms behind this response as well as new potential neoantigens can be important new strategies for the understanding of hypertension as well as strategies for new therapy modalities. CONFLICT OF INTEREST STATEMENT Magnus Gidlund is inventor of apob peptides fragment (apobd) for application as biomarkers, immunotherapy and vaccine in cardiovascular diseases. References 92

5 [1] Poulter NR, Prabhakaran D, Caulfield M. Hypertension. Lancet pii: S (14): [2] Rahimi K, Emdin CA, MacMahon S. The epidemiology of blood pressure and its worldwide management. Circulation Research. 2015;116(6): [3] Grassi G, Mark A, Esler M. The sympathetic nervous system alterations in human hypertension. Circulation Research. 2015;116(6): [4] Singh MV, Chapleau MW, Harwani SC, Abboud FM. The immune system and hypertension. Immunologic Research. 2014;59(1-3): [5] Ryan MJ. An update on immune system activation in the pathogenesis of hypertension. Hypertension. 2013;62(2): [6] Harrison DG. The immune system in hypertension. Trans Am Clin Climatol Assoc. 2014;125: [7] Harrison DG, Guzik TJ, Lob HE, et al., Inflammation, immunity, and hypertension. Hypertension. 2011;57(2): [8] Franco M, Tapia E, Bautista R, et al., Impaired pressure natriuresis resulting in salt-sensitive hypertension is caused by tubulointerstitial immune cell infiltration in the kidney. American Journal of Physiology: Renal Physiology. 2013;304(7):F [9] Franco M, Martínez F, Quiroz Y, Galicia O, Bautista R, Johnson RJ, Rodríguez-Iturbe B. Renal angiotensin II concentration and interstitial infiltration of immune cells are correlated with blood pressure levels in salt-sensitive hypertension. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology. 2007;293(1):R [10] Rodríguez-Iturbe B, Quiroz Y, Ferrebuz A, Parra G, Vaziri ND. Evolution of renal interstitial inflammation and NF-kappaB activation in spontaneously hypertensive rats. American Journal of Nephrology. 2004;24(6): [11] Libby P, Lichtman AH, Hansson GK. Immune effector mechanisms implicated in atherosclerosis: from mice to humans. Immunity. 2013;38(6): [12] Carvalho MD, Tobias VE, Vendrame CM, Shimabukuro AF, Gidlund M, Quintão EC. Lipoproteins modify the macrophage uptake of triacylglycerol emulsion and of zymosan particles by similar mechanisms. Lipids. 2000;35(1):55-9. [13] Rios FJ, Jancar S, Melo IB, Ketelhuth DF, Gidlund M. Role of PPAR-gamma in the modulation of CD36 and FcgammaRII induced by LDL with low and high degrees of oxidation during the differentiation of the monocytic THP-1 cell line. Cellular Physiology and Biochemistry. 2008;22(5-6): [14] Maiolino G, Rossitto G, Caielli P, Bisogni V, Rossi GP, Calò LA. The role of oxidized low-density lipoproteins in atherosclerosis: the myths and the facts. Mediators of Inflammation. 2013;2013: [15] Manucha W. HSP70 Family in the Renal Inflammatory Response. Inflammation Allergy Drug Targets. 2014;13(4): [16] Guzik TJ, Hoch NE, Brown KA, McCann LA, Rahman A, Dikalov S, Goronzy J, Weyand C, Harrison DG. Role of the T cell in the genesis of angiotensin II induced hypertension and vascular dysfunction. Journal of Experimental Medicine. 2007;204(10): [17] Kasal DA, Barhoumi T, Li MW, Yamamoto N, Zdanovich E, Rehman A, Neves MF, Laurant P, Paradis P, Schiffrin EL. T regulatory lymphocytes prevent aldosterone-induced vascular injury. Hypertension. 2012;59(2): [18] Marvar PJ, Thabet SR, Guzik TJ, Lob HE, McCann LA, Weyand C, Gordon FJ, Harrison DG. Central and peripheral mechanisms of T-lymphocyte activation and vascular inflammation produced by angiotensin IIinduced hypertension. Circulation Research. 2010;107(2): [19] Higashi Y, Maruhashi T, Noma K, Kihara Y. Oxidative stress and endothelial dysfunction: clinical evidence and therapeutic implications. Trends in Cardiovascular Medicine. 2014;24(4): [20] Sima AV, Stancu CS, Simionescu M. Vascular endothelium in atherosclerosis. Cell Tissue Research. 2009;335(1): [21] Rodríguez-Iturbe B, Quiroz Y, Nava M, Bonet L, Chávez M, Herrera-Acosta J, Johnson RJ, Pons HA. Reduction of renal immune cell infiltration results in blood pressure control in genetically hypertensive rats. American Journal of Physiology: Renal Physiology. 2002;282(2):F [22] de Miguel C, Guo C, Lund H, Feng D, Mattson DL. Infiltrating T lymphocytes in the kidney increase oxidative stress and participate in the development of hypertension and renal disease. American Journal of Physiology: Renal Physiology. 2011;300(3):F [23] Viel EC, Lemarié CA, Benkirane K, Paradis P, Schiffrin EL. Immune regulation and vascular inflammation in genetic hypertension. American Journal of Physiology. Heart and Circulatory Physiology. 2010;298(3):H [24] Kvakan H, Kleinewietfeld M, Qadri F, Park JK, Fischer R, Schwarz I, Rahn HP, Plehm R, Wellner M, Elitok S, Gratze P, Dechend R, Luft FC, Muller DN. Regulatory T cells ameliorate angiotensin II-induced cardiac damage. Circulation. 2009;119(22): [25] Didion SP, Kinzenbaw DA, Schrader LI, Chu Y, Faraci FM. Endogenous interleukin-10 inhibits angiotensin IIinduced vascular dysfunction. Hypertension. 2009;54(3): [26] Chiasson VL, Talreja D, Young KJ, Chatterjee P, Banes- Berceli AK, Mitchell BM. FK506 binding protein 12 deficiency in endothelial and hematopoietic cells decreases regulatory T cells and causes hypertension. Hypertension. 2011;57(6): [27] Seaberg EC, Muñoz A, Lu M, Detels R, Margolick JB, Riddler SA, Williams CM, Phair JP; Multicenter AIDS Cohort Study. Association between highly active antiretroviral therapy and hypertension in a large cohort of men followed from 1984 to AIDS. 2005;19(9): [28] Youn JC, Yu HT, Lim BJ, Koh MJ, Lee J, Chang DY, Choi YS, Lee SH, Kang SM, Jang Y, Yoo OJ, Shin EC, Park S. Immunosenescent CD8+ T cells and C-X-C chemokine receptor type 3 chemokines are increased in human hypertension. Hypertension. 2013;62(1): [29] Madhur MS, Harrison DG. Senescent T cells and hypertension: new ideas about old cells. Hypertension. 2013;62(1):13-5. [30] Zimmerman MA, Baban B, Tipton AJ, O'Connor PM, Sullivan JC. Chronic ANG II infusion induces sexspecific increases in renal T cells in Sprague-Dawley rats. American Journal of Physiology: Renal Physiology. 2015;308(7):F

6 [31] Madhur MS, Lob HE, McCann LA, Iwakura Y, Blinder Y, Guzik TJ, Harrison DG. Interleukin 17 promotes angiotensin II-induced hypertension and vascular dysfunction. Hypertension. 2010;55(2): [32] Harrison DG, Marvar PJ, Titze JM. Vascular inflammatory cells in hypertension. Frontiers in Physiology. 2012;3:128. [33] Chae CU, Lee RT, Rifai N, Ridker PM. Blood pressure and inflammation in apparently healthy men. Hypertension. 2001;38(3): [34] Funakoshi Y, Ichiki T, Ito K, Takeshita A. Induction of interleukin-6 expression by angiotensin II in rat vascular smooth muscle cells. Hypertension. 1999;34(1): [35] Luther JM, Gainer JV, Murphey LJ, Yu C, Vaughan DE, Morrow JD, Brown NJ. Angiotensin II induces interleukin-6 in humans through a mineralocorticoid receptor-dependent mechanism. Hypertension. 2006;48(6): [36] Rodríguez-Iturbe B, Vaziri ND, Herrera-Acosta J, Johnson RJ. Oxidative stress, renal infiltration of immune cells, and salt-sensitive hypertension: all for one and one for all. American Journal of Physiology: Renal Physiology. 2004;286(4):F [37] Rodríguez-Iturbe B, Pons H, Quiroz Y, Lanaspa MA, Johnson RJ. Autoimmunity in the pathogenesis of hypertension. Nature Reviews Nephrology. 2014;10(1): [38] Wu T, Ma J, Chen S, Sun Y, Xiao C, Gao Y, Wang R, Poudrier J, Dargis M, Currie RW, Tanguay RM. Association of plasma antibodies against the inducible Hsp70 with hypertension and harsh working conditions. Cell Stress and Chaperones. 2001;6(4): [39] Kristensen BO. Increased serum levels of immunoglobulins in untreated and treated essential hypertension. I. Relation to blood pressure. Acta Medica Scandinavica. 1978;203(1-2): [40] Kristensen BO, Andersen PL. Autoantibodies in untreated and treated essential hypertension. I. Acta Medica Scandinavica. 1978;203(1-2): [41] Kristensen BO. Aspects of immunology and immunogenetics in human essential hypertension with special reference to vascular events. Journal of Hypertension. 1984;2(6): [42] Bravo J, Quiroz Y, Pons H, Parra G, Herrera-Acosta J, Johnson RJ, Rodríguez-Iturbe B. Vimentin and heat shock protein expression are induced in the kidney by angiotensin and by nitric oxide inhibition. Kidney International Supplements. 2003;(86):S [43] Calabrese V, Butterfield DA, Scapagnini G, Stella AM, Maines MD. Redox regulation of heat shock protein expression by signaling involving nitric oxide and carbon monoxide: relevance to brain aging, neurodegenerative disorders, and longevity. Antioxidants & Redox Signaling. 2006;8(3-4): [44] Pockley AG, Muthana M, Calderwood SK. The dual immunoregulatory roles of stress proteins. Trends in Biochemical Sciences. 2008;33(2):71-9. [45] Quiroz Y, Pons H, Gordon KL, Rincón J, Chávez M, Parra G, Herrera-Acosta J, Gómez-Garre D, Largo R, Egido J, Johnson RJ, Rodríguez-Iturbe B. Mycophenolate mofetil prevents salt-sensitive hypertension resulting from nitric oxide synthesis inhibition. American Journal of Physiology: Renal Physiology. 2001;281(1):F [46] Pons H, Ferrebuz A, Quiroz Y, Romero-Vasquez F, Parra G, Johnson RJ, Rodriguez-Iturbe B. Immune reactivity to heat shock protein 70 expressed in the kidney is cause of salt-sensitive hypertension. American Journal of Physiology: Renal Physiology. 2013;304(3):F [47] Frostegård J, Kjellman B, Gidlund M, Andersson B, Jindal S, Kiessling R. Induction of heat shock protein in monocytic cells by oxidized low density lipoprotein. Atherosclerosis. 1996;121(1): [48] da Fonseca HA, Fonseca FA, Monteiro AM, et al., Inflammatory environment and immune responses to oxidized LDL are linked to systolic and diastolic blood pressure levels in hypertensive subjects. International Journal of Cardiology. 2012;157(1): [49] Ellins E, Shamaei-Tousi A, Steptoe A, Donald A, O'Meagher S, Halcox J, Henderson B. The relationship between carotid stiffness and circulating levels of heat shock protein 60 in middle-aged men and women. Journal of Hypertension. 2008;26(12): [50] Frostegård J, Wu R, Gillis-Haegerstrand C, Lemne C, de Faire U. Antibodies to endothelial cells in borderline hypertension. Circulation. 1998,98(11): [51] Tuominen A, Miller YI, Hansen LF, Kesäniemi YA, Witztum JL, Hörkkö S. A natural antibody to oxidized cardiolipin binds to oxidized low-density lipoprotein, apoptotic cells, and atherosclerotic lesions. Arteriosclerosis, Thrombosis and Vascular Biology. 2006;26(9): [52] Huang PH, Huang SS, Chen YH, et al., Increased circulating CD31+/annexin V+ apoptotic microparticles and decreased circulating endothelial progenitor cell levels in hypertensive patients with microalbuminuria. Journal of Hypertension. 2010;28(8): [53] Wu R, de Faire U, Lemne C, Witztum JL, Frostegård J. Autoantibodies to OxLDL are decreased in individuals with borderline hypertension. Hypertension. 1999;33(1):53-9. [54] Brandão SA, Izar MC, Fischer SM, et al., Early increase in autoantibodies against human oxidized low-density lipoprotein in hypertensive patients after blood pressure control. American Journal of Hypertension. 2010; 23(2): [55] Fonseca HA, Fonseca FA, Monteiro AM, et al., Obesity modulates the immune response to oxidized LDL in hypertensive patients. Cell Biochemistry and Biophysics. 2013;67(3): [56] Svensjö E, Boschcov P, Ketelhuth DF, Jancar S, Gidlund M. Increased microvascular permeability in the hamster cheek pouch induced by oxidized low density lipoprotein (oxldl) and some fragmented apolipoprotein B proteins. Inflammation Research. 2003;52(5): [57] Soares SR, Carvalho-Oliveira R, Ramos-Sanchez E, et al., Air pollution and antibodies against modified lipoproteins are associated with atherosclerosis and vascular remodeling in hyperlipemic mice. Atherosclerosis. 2009;207(2): [58] Ketelhuth DF, Tonini GC, Carvalho MD, Ramos RF, Boschcov P, Gidlund M. Autoantibody response to chromatographic fractions from oxidized LDL in unstable angina patients and healthy controls. Scandinavian Journal of Immunology. 2008;68(4): [59] Ronchini KR, Goto H, Duarte AJ, Gidlund M. Antioxidized LDL antibodies as atherosclerosis development 94

7 markers in HIV patients undergoing antiretroviral therapy: a longitudinal cohort study. International Trends in Immunity. 2013; 1(3):72-9. [60] Ketelhuth DF, Rios FJ, Wang Y, Liu H, Johansson ME, Fredrikson GN, Hedin U, Gidlund M, Nilsson J, Hansson GK, Yan ZQ. Identification of a dangerassociated peptide from apolipoprotein B100 (ApoBDS- 1) that triggers innate proatherogenic responses. Circulation. 2011;124(22): , 1-7. [61] Mathis KW, Broome HJ, Ryan MJ. Autoimmunity: an underlying factor in the pathogenesis of hypertension. Current Hypertension Reports. 2014;16(4):424. [62] Wenzel K, Haase H, Wallukat G, Derer W, Bartel S, Homuth V, Herse F, Hubner N, Schulz H, Janczikowski M, Lindschau C, Schroeder C, Verlohren S, Morano I, Muller DN, Luft FC, Dietz R, Dechend R, Karczewski P. Potential relevance of alpha(1)-adrenergic receptor autoantibodies in refractory hypertension. PLoS One. 2008;3(11):e3742. [63] Sabio JM, Vargas-Hitos JA, Navarrete-Navarrete N, Mediavilla JD, Jiménez-Jáimez J, Díaz-Chamorro A, Jiménez-Alonso J; Grupo Lupus Virgen de las Nieves. Prevalence of and factors associated with hypertension in young and old women with systemic lupus erythematosus. Journal of Rheumatology. 2011;38(6): [64] Mathis KW, Wallace K, Flynn ER, Maric-Bilkan C, LaMarca B, Ryan MJ. Preventing autoimmunity protects against the development of hypertension and renal injury. Hypertension. 2014;64(4):

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

All biomarkers at higher level in HIV group

All biomarkers at higher level in HIV group Supplemental Table S1: Summary of studies assessing mainly inflammatory biomarkers and their association with mortality and clinical endpoints in HIV infection First author, year, country Biomarkers measured

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

THE CARDIOVASCULAR INFLAMMATORY CONTINUUM DR AB MAHARAJ

THE CARDIOVASCULAR INFLAMMATORY CONTINUUM DR AB MAHARAJ THE CARDIOVASCULAR INFLAMMATORY CONTINUUM DR AB MAHARAJ Disclosures: On National Advisory Boards of: (1) Pfizer Pharmaceuticals (2) MSD (3) Roche Pharmaceuticals (4) Abbott International: AfME Rheumatology

More information

Dyslipidemia Endothelial dysfunction Free radicals Immunologic

Dyslipidemia Endothelial dysfunction Free radicals Immunologic ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and

More information

Dengue pathogenesis and vaccine design

Dengue pathogenesis and vaccine design Dengue pathogenesis and vaccine design Dengue 390 million cases worldwide each year Fever to severe hemorrhaging and shock No effective vaccine Tropical disease on the move Dengue disease worldwide WHO

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

Heart disease What is a heart attack, what are short and long term causes of heart attacks? Would you expect type 1 or type 2 fibers in heart muscle?

Heart disease What is a heart attack, what are short and long term causes of heart attacks? Would you expect type 1 or type 2 fibers in heart muscle? Would you expect type 1 or type 2 fibers in heart muscle? Adjustments to stroke volume Heart disease What is a heart attack, what are short and long term causes of heart attacks? 1 Myocardial infarction

More information

Immunology Lecture 4. Clinical Relevance of the Immune System

Immunology Lecture 4. Clinical Relevance of the Immune System Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor

More information

Structure and organization of blood vessels

Structure and organization of blood vessels The cardiovascular system Structure of the heart The cardiac cycle Structure and organization of blood vessels What is the cardiovascular system? The heart is a double pump heart arteries arterioles veins

More information

Association of anti-mcv autoantibodies with SLE (Systemic Lupus Erythematosus) overlapping with various syndromes

Association of anti-mcv autoantibodies with SLE (Systemic Lupus Erythematosus) overlapping with various syndromes International Journal of Medicine and Medical Sciences Vol. () pp. 21-214, June 211 Available online http://www.academicjournals.org/ijmms ISSN 2-972 211 Academic Journals Full Length Research Paper Association

More information

Elevated Th17 and IL-23 in Hypertensive Patients with Acutly Increased Blood Pressure

Elevated Th17 and IL-23 in Hypertensive Patients with Acutly Increased Blood Pressure American Journal of Immunology 8 (2): 27-32, 2012 ISSN 1553-619X 2012 Science Publications Elevated Th17 and IL-23 in Hypertensive Patients with Acutly Increased Blood Pressure 1 Junxian Wang, 1 Jianying

More information

1. The scavenger receptor, CD36, functions as a coreceptor for which TLR? a. TLR ½ b. TLR 3 c. TLR 4 d. TLR 2/6

1. The scavenger receptor, CD36, functions as a coreceptor for which TLR? a. TLR ½ b. TLR 3 c. TLR 4 d. TLR 2/6 Allergy and Immunology Review Corner: Cellular and Molecular Immunology, 8th Edition By Abul K. Abbas, MBBS, Andrew H. H. Lichtman, MD, PhD and Shiv Pillai, MBBS, PhD. Chapter 4 (pages 62-74): Innate Immunity

More information

Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 19: Tolerance, Autoimmunity, and Autoinflammation Prepared

More information

Neuroimmunology. Innervation of lymphoid organs. Neurotransmitters. Neuroendocrine hormones. Cytokines. Autoimmunity

Neuroimmunology. Innervation of lymphoid organs. Neurotransmitters. Neuroendocrine hormones. Cytokines. Autoimmunity Neuroimmunology Innervation of lymphoid organs Neurotransmitters Neuroendocrine hormones Cytokines Autoimmunity CNS has two ways of contacting and regulating structures in the periphery Autonomic

More information

Heart Failure (HF) Treatment

Heart Failure (HF) Treatment Heart Failure (HF) Treatment Heart Failure (HF) Complex, progressive disorder. The heart is unable to pump sufficient blood to meet the needs of the body. Its cardinal symptoms are dyspnea, fatigue, and

More information

Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts

Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Serena Del Turco, Teresa Navarra, Giuseppina Basta, Raffaele De

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

immunopathology Dr. Ameer Dhahir

immunopathology Dr. Ameer Dhahir immunopathology Dr. Ameer Dhahir Objectives. Explaining the causes of immune deficiency with clinical examples. Explaining important examples of inappropriate or excessive immune response. Discussing the

More information

MOLECULAR IMMUNOLOGY Manipulation of immune response Autoimmune diseases & the pathogenic mechanism

MOLECULAR IMMUNOLOGY Manipulation of immune response Autoimmune diseases & the pathogenic mechanism MOLECULAR IMMUNOLOGY Manipulation of immune response Autoimmune diseases & the pathogenic mechanism SCHMAIEL SHIRDEL CONTENT 2 Introduction Autoimmune diseases Classification Involved components Autoimmune

More information

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O

More information

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

More information

LXIV: DRUGS: 4. RAS BLOCKADE

LXIV: DRUGS: 4. RAS BLOCKADE LXIV: DRUGS: 4. RAS BLOCKADE ACE Inhibitors Components of RAS Actions of Angiotensin i II Indications for ACEIs Contraindications RAS blockade in hypertension RAS blockade in CAD RAS blockade in HF Limitations

More information

Chapter 13: Cytokines

Chapter 13: Cytokines Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

More information

Defensive mechanisms include :

Defensive mechanisms include : Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral

More information

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

More information

The dynamic regulation of blood vessel caliber

The dynamic regulation of blood vessel caliber INVITED BASIC SCIENCE REVIEW The dynamic regulation of blood vessel caliber Colleen M. Brophy, MD, Augusta, Ga BACKGROUND The flow of blood to organs is regulated by changes in the diameter of the blood

More information

Hans Strijdom SA Heart Meeting November 2017

Hans Strijdom SA Heart Meeting November 2017 Hans Strijdom SA Heart Meeting November 2017 HIV-infection and ART, but not high sensitivity CRP, are associated with markers of vascular function: Results from the Western Cape cohort of the EndoAfrica

More information

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell There are 2 major lines of defense: Non-specific (Innate Immunity) and Specific (Adaptive Immunity) Photo of macrophage cell Development of the Immune System ery pl neu mφ nk CD8 + CTL CD4 + thy TH1 mye

More information

Circulation. Blood Pressure and Antihypertensive Medications. Venous Return. Arterial flow. Regulation of Cardiac Output.

Circulation. Blood Pressure and Antihypertensive Medications. Venous Return. Arterial flow. Regulation of Cardiac Output. Circulation Blood Pressure and Antihypertensive Medications Two systems Pulmonary (low pressure) Systemic (high pressure) Aorta 120 mmhg Large arteries 110 mmhg Arterioles 40 mmhg Arteriolar capillaries

More information

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 13 Effector Responses: Cell- and Antibody-Mediated Immunity Copyright 2013 by W. H.

More information

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Cell Therapy 2014 Las Vegas, NV, USA Sulaiman Al-Hashmi, PhD Sultan Qaboos University Oman What are MSCs? Stem

More information

AUTOIMMUNITY CLINICAL CORRELATES

AUTOIMMUNITY CLINICAL CORRELATES AUTOIMMUNITY CLINICAL CORRELATES Pamela E. Prete, MD, FACP, FACR Section Chief, Rheumatology VA Healthcare System, Long Beach, CA Professor of Medicine, Emeritus University of California, Irvine Colonel

More information

Chapter 16 Lymphatic System and Immunity. Lymphatic Pathways. Lymphatic Capillaries. network of vessels that assist in circulating fluids

Chapter 16 Lymphatic System and Immunity. Lymphatic Pathways. Lymphatic Capillaries. network of vessels that assist in circulating fluids Chapter 16 Lymphatic System and Immunity network of vessels that assist in circulating fluids closely associated with the cardiovascular system transports excess fluid away from interstitial spaces transports

More information

AUTOIMMUNITY TOLERANCE TO SELF

AUTOIMMUNITY TOLERANCE TO SELF AUTOIMMUNITY CLINICAL CORRELATES Pamela E. Prete, MD, FACP, FACR Section Chief, Rheumatology VA Healthcare System, Long Beach, CA Professor of Medicine, Emeritus University of California, Irvine Colonel

More information

SEVENTH EDITION CHAPTER

SEVENTH EDITION CHAPTER Judy Owen Jenni Punt Sharon Stranford Kuby Immunology SEVENTH EDITION CHAPTER 16 Tolerance, Autoimmunity, and Transplantation Copyright 2013 by W. H. Freeman and Company Immune tolerance: history * Some

More information

Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti.

Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti. Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti. Chapter 1: Overview of Immunology Prepared by David Scott, MD, Scripps

More information

Pathology of Coronary Artery Disease

Pathology of Coronary Artery Disease Pathology of Coronary Artery Disease Seth J. Kligerman, MD Pathology of Coronary Artery Disease Seth Kligerman, MD Assistant Professor Medical Director of MRI University of Maryland Department of Radiology

More information

Basic Immunology. Immunological tolerance. Cellular and molecular mechanisms of the immunological tolerance. Lecture 23 rd

Basic Immunology. Immunological tolerance. Cellular and molecular mechanisms of the immunological tolerance. Lecture 23 rd Basic Immunology Lecture 23 rd Immunological tolerance Cellular and molecular mechanisms of the immunological tolerance Tolerated skin grafts on MHC (H2) identical mice TOLERANCE & AUTOIMMUNITY Upon encountering

More information

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

Atherosclerosis, inflammation and leukotrienes

Atherosclerosis, inflammation and leukotrienes Review. Ingvill Ellertsen, Marcelo H. Petri, Magnus Bäck Atherosclerosis, inflammation and leukotrienes Michael Quarterly 2011;8:514 22. Atherosclerosis, which is a chronic inflammatory disease that leads

More information

La risposta immune all infezione da virus ebola. Chiara Agrati, PhD

La risposta immune all infezione da virus ebola. Chiara Agrati, PhD La risposta immune all infezione da virus ebola Chiara Agrati, PhD Pathogenetic mechanisms This virus infection is able to: - disable the immune system, preventing an effective protective immune response

More information

Principles of Anatomy and Physiology

Principles of Anatomy and Physiology Principles of Anatomy and Physiology 14 th Edition CHAPTER 22 The Lymphatic System and Immunity Introduction The purpose of this chapter is to: 1. Understand the lymphatic system structure and function

More information

2. Ontogeny of the Immune System

2. Ontogeny of the Immune System 2. Ontogeny of the Immune System Introduction Available evidence suggests that the lymphoid system consists of two compartments, as shown in Figure 1: A central compartment in which stem cells originating

More information

Chapter 15. The Lymphatic System and Immunity

Chapter 15. The Lymphatic System and Immunity Chapter 15 The Lymphatic System and Immunity Objectives Describe general functions of the lymphatic system and list the main lymphatic structures Compare nonspecific and specific immunity Name the major

More information

Allergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis

Allergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis Hypersensitivity Disorders Hypersensitivity Disorders Immune Response IgE Disease Example Ragweed hay fever IgG Cytotoxic Immune complex T Cell Hemolytic anemia Serum sickness Poison ivy IgE-mediated Diseases

More information

The development of T cells in the thymus

The development of T cells in the thymus T cells rearrange their receptors in the thymus whereas B cells do so in the bone marrow. The development of T cells in the thymus The lobular/cellular organization of the thymus Immature cells are called

More information

Dr. Mehmet Kanbay Department of Medicine Division of Nephrology Istanbul Medeniyet University School of Medicine Istanbul, Turkey.

Dr. Mehmet Kanbay Department of Medicine Division of Nephrology Istanbul Medeniyet University School of Medicine Istanbul, Turkey. The uric acid dilemma: causal risk factor for hypertension and CKD or mere bystander? Mehmet Kanbay, Istanbul, Turkey Chairs: Anton H. van den Meiracker, Rotterdam, The Netherlands Claudia R.C. Van Roeyen,

More information

Risk Stratification in Heart Failure: The Role of Emerging Biomarkers

Risk Stratification in Heart Failure: The Role of Emerging Biomarkers Risk Stratification in Heart Failure: The Role of Emerging Biomarkers David G. Grenache, PhD Associate Professor of Pathology, University of Utah Medical Director, ARUP Laboratories Salt Lake City, UT

More information

Cutaneous Immunology: Innate Immune Responses. Skin Biology Lecture Series

Cutaneous Immunology: Innate Immune Responses. Skin Biology Lecture Series Cutaneous Immunology: Innate Immune Responses Skin Biology Lecture Series The Immune Response: Innate and Adaptive Components Source: Wolff, Goldsmith, Katz, Gilchrest, Paller, Leffell. Fitzpatrick s Dermatology

More information

Chapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group

Chapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group Allergy and Immunology Review Corner: Cellular and Molecular Immunology, 8th Edition By Abul K. Abbas, MBBS; Andrew H. H. Lichtman, MD, PhD; and Shiv Pillai, MBBS, PhD. Chapter 2 (pages 22 33): Cells and

More information

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers CardioMetabolic Risk Poor blood sugar regulation and unhealthy triglyceride and lipoprotein levels often present long before the diagnosis of type 2 Diabetes. SpectraCell s CardioMetabolic and Pre-Diabetes

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Sessione Congiunta SIMDO - FADOI. Acido urico e diabete: quando e come correggere

Sessione Congiunta SIMDO - FADOI. Acido urico e diabete: quando e come correggere Sessione Congiunta SIMDO - FADOI Acido urico e diabete: quando e come correggere Giovanni Gulli ASL CN1 SC Medicina Interna Ospedale Maggiore SS. Annunziata Savigliano, CN Agenda uric acid (UA) metabolism

More information

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive

More information

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

Examples of questions for Cellular Immunology/Cellular Biology and Immunology Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions

More information

Immunity 101: The basics

Immunity 101: The basics As published in Research Update Research with Diamond V s Original line of products, including Original XPC, has consistently shown that these products influence the immune system of livestock and poultry.

More information

Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD ? Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Christian S Lobsiger & Don W Cleveland (2007) Nature Neuroscience 10, 1355-1360 Astrocytes: interlinked gatekeepers of glutamate astrocytes

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

Estrogens vs Testosterone for cardiovascular health and longevity

Estrogens vs Testosterone for cardiovascular health and longevity Estrogens vs Testosterone for cardiovascular health and longevity Panagiota Pietri, MD, PhD, FESC Director of Hypertension Unit Athens Medical Center Athens, Greece Women vs Men Is there a difference in

More information

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA

More information

Blood Pressure Regulation 2. Faisal I. Mohammed, MD,PhD

Blood Pressure Regulation 2. Faisal I. Mohammed, MD,PhD Blood Pressure Regulation 2 Faisal I. Mohammed, MD,PhD 1 Objectives Outline the intermediate term and long term regulators of ABP. Describe the role of Epinephrine, Antidiuretic hormone (ADH), Renin-Angiotensin-Aldosterone

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Posters and Presentations

Posters and Presentations Posters and Presentations June 2017: American Society of Clinical Oncology (ASCO) Annual - Preliminary Correlative Analysis of PD-L1 expression from the SUNRISE Study. View April 2017: American Association

More information

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System 24.1 Multiple-Choice Questions 1) The body's innate defenses against infection include A) several nonspecific

More information

Immune Surveillance. Immune Surveillance. Immune Surveillance. Neutrophil granulocytes Macrophages. M-cells

Immune Surveillance. Immune Surveillance. Immune Surveillance. Neutrophil granulocytes Macrophages. M-cells he immune system is everywhere Some organs have developed strategies towards the immune system to keep it out or to put it under control Immune privileged organs: Brain Eye estis hyroid gland Humoral immunity

More information

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine

Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline! Consensus characteristics! Allergens:role in asthma! Immune/inflammatory basis! Genetic basis!

More information

Salt Sensitivity: Mechanisms, Diagnosis, and Clinical Relevance

Salt Sensitivity: Mechanisms, Diagnosis, and Clinical Relevance Salt Sensitivity: Mechanisms, Diagnosis, and Clinical Relevance Matthew R. Weir, MD Professor and Director Division of Nephrology University of Maryland School of Medicine Overview Introduction Mechanisms

More information

Acquired Immunity 2. - Vaccines & Immunological Memory - Wataru Ise. WPI Immunology Frontier Research Center (IFReC) Osaka University.

Acquired Immunity 2. - Vaccines & Immunological Memory - Wataru Ise. WPI Immunology Frontier Research Center (IFReC) Osaka University. Acquired Immunity 2 - Vaccines & Immunological Memory - Wataru Ise WPI Immunology Frontier Research Center (IFReC) Osaka University Outline 1. What is vaccine (vaccination)? 2. What is immunological memory?

More information

Pathophysiologic Basis of Autoimmune Disorders

Pathophysiologic Basis of Autoimmune Disorders Pathophysiologic Basis of Autoimmune Disorders Linda Felver, Ph.D., R.N. Associate Professor School of Nursing Oregon Health & Science University The immune system has two arms: Adaptive (Acquired) Immune

More information

Biology 1442 Supplemental Instruction Worksheet Cardiovascular System Jacaruso - 1 -

Biology 1442 Supplemental Instruction Worksheet Cardiovascular System Jacaruso - 1 - Biology 1442 Supplemental Instruction Worksheet Cardiovascular System Jacaruso - 1-2. Organs of a closed circulatory system: A. Have valves a. Arteriole B. Regulate blood flow b. Artery C. Lead to heart

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

References List. References cited on CVInflammation.com

References List. References cited on CVInflammation.com References List References cited on CVInflammation.com 1. Cannon CP, Braunwald E, McCabe CH, et al; Pravastatin or Atorvastatin Evaluation and Infection Therapy-Thrombolysis in Myocardial Infarction 22

More information

LYMPHATIC AND IMMUNE SYSTEMS. Chapter 33

LYMPHATIC AND IMMUNE SYSTEMS. Chapter 33 LYMPHATIC AND IMMUNE SYSTEMS Chapter 33 THE LYMPHATIC SYSTEM The lymphatic system has three main functions Take up excess tissue fluid and return it to the bloodstream Receive fats called lipoproteins

More information

The Immune System: The Mind Body Connection. Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco

The Immune System: The Mind Body Connection. Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco The Immune System: The Mind Body Connection Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco Psychoneuroimmunology Investigation of the bidirectional

More information

Camillo Porta S.C. di Oncologia Medica Università degli Studi di Pavia & I.R.C.C.S. Fondazione Policlinico San Matteo di Pavia

Camillo Porta S.C. di Oncologia Medica Università degli Studi di Pavia & I.R.C.C.S. Fondazione Policlinico San Matteo di Pavia Keynote Lecture: Immunotherapy in GU cancer: where are we, and where are we going? Camillo Porta S.C. di Oncologia Medica Università degli Studi di Pavia & I.R.C.C.S. Fondazione Policlinico San Matteo

More information

The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep

The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep invaders out of the body (pp. 772 773; Fig. 21.1; Table

More information

Five chapters 1. What is CVD prevention 2. Why is CVD prevention needed 3. Who needs CVD prevention 4. How is CVD prevention applied 5. Where should CVD prevention be offered Shorter, more adapted to clinical

More information

LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS

LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS Patrick M. Moriarty, M.D., FACP, Director, Atherosclerosis and LDL-Apheresis Center, University of Kansas Medical

More information

Immune surveillance hypothesis (Macfarlane Burnet, 1950s)

Immune surveillance hypothesis (Macfarlane Burnet, 1950s) TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,

More information

Alida R Harahap & Farida Oesman Department of Clinical Pathology Faculty of Medicine, University of Indonesia

Alida R Harahap & Farida Oesman Department of Clinical Pathology Faculty of Medicine, University of Indonesia Alida R Harahap & Farida Oesman Department of Clinical Pathology Faculty of Medicine, University of Indonesia Foreign molecules = antigens Immune response Immune system non-specific specific cellular humoral

More information

Dr. Hany M. Abo-Haded

Dr. Hany M. Abo-Haded BY Dr. Hany M. Abo-Haded Pediatric Cardiology Unit, Mansoura Universty Children Hospital, Mansoura, Egypt Co-authors: Dina S El-Agamy and Mohamed A Elkablawy Background Doxorubicin (DOX) is an anthracycline

More information

Vitamin D: Is it a superhero??

Vitamin D: Is it a superhero?? Vitamin D: Is it a superhero?? Dr. Ashraf Abdel Basset Bakr Prof. of Pediatrics 1 2 History of vitamin D discovery Sources of vitamin D and its metabolism 13 Actions of vitamin D 4 Vitamin D deficiency

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Antibody-Cytokine- Autoimmune

Antibody-Cytokine- Autoimmune Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท

More information

Diseases-causing agents, pathogens, can produce infections within the body.

Diseases-causing agents, pathogens, can produce infections within the body. BIO 212: ANATOMY & PHYSIOLOGY II 1 CHAPTER 16 Lecture: Dr. Lawrence G. Altman www.lawrencegaltman.com Some illustrations are courtesy of McGraw-Hill. LYMPHATIC and IMMUNE Systems Body Defenses Against

More information

An autoimmune perspective on neuromuscular diseases

An autoimmune perspective on neuromuscular diseases An autoimmune perspective on neuromuscular diseases Colin Chalk MD,CM FRCPC Montreal General Hospital McGill University Schlomchik 2001 The proportion of neuromuscular patients who have an autoimmune cause

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Jung Han Kim, PhD Project 1 Project 2

Jung Han Kim, PhD Project 1 Project 2 Jung Han Kim, PhD Professor Joan C Edwards School of Medicine at Marshall University 1700 3 rd Ave, 435 BBSC Huntington, WV 25755 Tel: (304) 696-3873 Email: kimj@marshall.edu My long-term research interest

More information