hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

Save this PDF as:

Size: px
Start display at page:

Download "hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in"


1 SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in Fbn1 +/+ and Fbn1 C1039G/+ mice with and without valvular regurgitation at 4 and 12 months of age. EDD, end-diastolic diameter; ESD, end-systolic diameter; FS, fractional shortening; LVM, left ventricular mass. n>=14 per group. *p<5,, p<1, p<01, 2w ANOVA, Tukey s correction. B. Representative PV loop of a 12mo Fbn1 +/+ (blue line, blue fill) and Fbn1 C1039G/+ mouse (red line, red fill) without valvular regurgitation. Summary data obtained from PV loop analysis shown in bar graphs: Ees, end-systolic elastance and PRSW, preload recruitable stroke work, reflect load-independent indices of ventricular contractility. Tau, relaxation time constant reflects a load-independent index of ventricular stiffness; n=3-6 per group. C. dp/dtmax, peak rate of left ventricular pressure rise, an index of contractility; dp/dtmin, peak rate of left ventricular pressure decline, an index of lusitropy. Invasive blood pressure measurements taken from PV loop analysis of Fbn1 +/+ and Fbn1 C1039G/+ mice without valvular regurgitation at 4 and 12 months of age. n=3-6 per group. D. Gross morphometric analysis of post-natal Fbn1 +/+, Fbn1 C1039G/+, Fbn1 C1039G/C1039G mice at 8do, 6mo and 12mo age, in mice without valvular regurgitation. HW/BW, heart weight/body weight ratio; HW/TL, heart weight/tibial length ratio. n>=4 per group. Supplemental Figure 2. Fbn1 C1039G/+ hearts have normal TGFβ signaling in the absence of hemodynamic stress. A-C. Representative Western blot and summary quantification for phosphorylated/total (p/t), p/tsmad2, p/terk1/2, and GAPDH using left ventricular tissue lysates. n=4 per group. D. mrna expression normalized to 18S and then to Fbn1 +/+ data, assessed by real-time RT-PCR from left ventricular tissue of 3mo Fbn1 +/+ and 1

2 Fbn /C1039G/+ hearts without regurgitation. Ctgf, connective tissue growth factor. Serpine1, plasminogen activator inhibitor, type 1. n>=4 per group. Supplemental Figure 3. Fbn1 C1039G/+ hearts develop hypertrophy and fibrosis in response to pressure overload. A. Baseline echocardiographic quantification of cardiac dimensions in 5mo Fbn1 +/+ and Fbn1 C1039G/+ mice without valvular regurgitation. EDD, end-diastolic diameter; ESD, end-systolic diameter; IVST, interventricular septum thickness; PWT, posterior wall thickness. n=4-6 per group. B. Myocyte hypertrophy, as assessed by cross-sectional area (CSA) in hematoxylin-eosin staining. Summary quantification of averaged data, >20 cells per heart. n=4 per group. C. Fibrotic area, as assessed by Masson s Trichrome stain and quantified by total number of blue pixels normalized to whole tissue area and then to Fbn1 +/+ :SHAM data. n=4-6 per group. D. mrna expression of hypertrophy genes, normalized to Gapdh and then to Fbn1 +/+ :SHAM data, assessed by real-time RT-PCR. n=4-6 per group. Myh7, myosin heavy chain 7 (βmhc), Nppa, natriuretic peptide A (ANP), Nppb, natriuretic peptide B (BNP). p<1, p<01, 1w ANOVA, Tukey s correction. Supplemental Figure 4. Fibrillin-1 protein fails to deposit in myocardium in load-induced heart failure in Fbn1 C1039G/+ mice. Additional representative images of immunofluorescent fibrillin-1 staining (red) of heart sections from Fbn1 +/+ and Fbn1 C1039G/+ mice subjected to 4w. Red, fibrillin-1 (interstitial space); blue, DAPI (nuclei); Green, lipofuscin (myocytes). Top 4 panels, Scale bar: 20 µm. Bottom 4 panels, 2x zoom. White arrow head points to an example nonmyocyte cell in the interstitial space. Supplemental Figure 5. Smad2 and ERK1/2 activation are differentially increased in the myocyte and nonmyocyte compartments of failing Fbn1 C1039G/+ hearts. A. Representative serial sections of psmad2 (red, top panels) and perk1/2 (red, bottom panels) immunostaining in Fbn1 C1039G/+ 2

3 hearts subjected to 4w. Far left panels, scale bar: 50 µm. Middle and far right panels, zoom 2x. Blue, DAPI (nuclei); Green, lipofuscin (myocytes). White arrows, myocyte nuclei. Yellow arrows, nonmyocyte nuclei. B. Summary quantification of % of total psmad2 and perk1/2 immunofluorescence intensity localized to nonmyocyte (NM) and myocyte (M) cells per unit area. n=10-15 areas quantified. *p<5, p<1, Student s t-test. C. Representative myocyteenriched serial sections. Scale bar: 50 µm. D. Representative co-immunostaining of serial sections with vimentin (yellow) and psmad2 (left panel) and vimentin (yellow) and perk1/2 (right panel). Scale bar: 25 µm. Gray, lipofuscin (myocytes). Supplemental Figure 6. ERK1/2 activation, but not Smad2 activation, is significantly attenuated by MEK inhibition. Immunoblot for psmad2, perk1/2 and GAPDH using cultured neonatal rat cardiac fibroblasts with TGF-ß3 (10 ng/ml) stimulation for 15 minutes with and without treatment with, RDEA119 (100nM) or PD98059 (50μM). n=4 per group. p<1, p<01, 1w ANOVA, Tukey s correction. Supplemental Figure 7. Myocyte hypertrophy in Fbn1 C1039G/+ hearts is prevented with losartan and treatment. A. Representative hematoxylin-eosin staining of formalin-fixed heart sections. White dotted line delineates myocyte diameter. Scale bars: 50µm. B. Myocyte hypertrophy as assessed by wheat germ agglutinin (WGA) staining. Scale bars: 25µm. C. Summary quantification of average cross-sectional area (CSA) data, >1000 cells per heart. n=4-7 per group. D. mrna expression of hypertrophy genes, normalized to Gapdh and then to Fbn1 +/+ :SHAM data, assessed by real-time RT-PCR. Myh7, myosin heavy chain 7 (βmhc), Myh6, myosin heavy chain 6 (αmhc), Nppa, natriuretic peptide A (ANP), Nppb, natriuretic peptide B (BNP). n=4-7 per group. *p<5, p<1, p<01, 1w ANOVA, Tukey s correction. 3

4 Supplemental Figure 8. Smad2 and ERK1/2 activation are differentially increased in response to TGFβ and angiotensin II in cardiac fibroblasts. Immunoblot for psmad2, perk1/2 and GAPDH using cultured neonatal murine cardiac fibroblasts with TGFß1 (5 ng/ml) or AngII (5nM) stimulation for 24 hours. Lanes were run on the same gel but were noncontiguous. n>=3 per group. p<1, 1w ANOVA, Tukey s correction. Supplemental Figure 9. Inhibition of ERK1/2 activation suppresses Smad2 activation in both nonmyocyte and myocyte compartments. A-B. Labeling index (% positive cells) of psmad2 or perk1/2 immunofluorescence in the nonmyocyte and myocyte compartments. n>5 fields per group. C. Total number of nonmyocytes and myocytes normalized to Fbn1 +/+ :SHAM data. n=15-30 fields per group. *p<5, p<1, p<01, 1w ANOVA, Tukey s correction. Supplemental Figure 10. TGFβ3 is predominantly expressed in the nonmyocyte compartment. A- C. Representative in situ hybridization of Tgfb3. A. Fbn1 +/+ : vs Fbn1 C1039G/+ :, Tgfb3, red. Left panel, scale bar: 10µm. Right panel, zoom 2x inset. Dotted line demarcates myocyte compartment. Red arrows point to examples of in situ RNA hybridization (red dots) found throughout the nonmyocyte compartment. B. Myocyte- vs nonmyocyte-enriched areas. Scale bar: 10µm. C. Tgfb3 and Vim. Left panel, Tgfb3, red, left panel and Vim, red, right panel. Dottedline outlines the cardiac myocytes. Scale bar: 10µm. D. mrna expression of Tgfb3 and Vim normalized to Gapdh and then to myocyte data. n=4-6 per group. p<01, Student s t-test. Supplemental Figure 11. AngII-mediated ERK1/2 activation is differentially increased in Fbn1 C1039G/+ vs WT fibroblasts. Immunoblots for psmad2, perk1/2 and GAPDH using cultured neonatal murine cardiac fibroblasts from Fbn1 C1039G/+ and Fbn1 +/+ hearts with AngII (5nM) or TGFß3 (5 ng/ml) stimulation for 12 hours. Lanes were run on the same gel but were noncontiguous. n>=3 per group. p<01, 1w ANOVA, Tukey s correction. 4

5 Supplemental Figure 1 A * * * EDD (mm) ESD (mm) FS (%) LVM (mg) Fbn1 +/+ Fbn1 C1039G/+ without regurgitation Fbn1 C1039G/+ with regurgitation 4 mo 12 mo 4 mo 12 mo 4 mo 12 mo 4 mo 12 mo B 160 E es (mmhg/µl/g) PRSW (mmhg) Tau (ms) Pressure (mmhg) C Volume (ml) 4mo 12 mo Systolic Pressure (mmhg) 4mo 12 mo Diastolic Pressure (mmhg) 4mo 12 mo Pulse Pressure (mmhg) dp/dt max (mmhg/s) Thousands 4mo 12 mo 4mo 12 mo 4mo 12 mo 4mo 12 mo dp/dt min (mmhg/s) Thousands D HW/BW (mg/g) Post natal day 8 HW/BW (mg/g) 6mo HW/BW (mg/g) 12mo +/+ C1039G/+ C1039G/ C1039G +/+ C1039G/+ +/+ C1039G/+ Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in Fbn1 +/+ and Fbn1 C1039G/+ mice with and without valvular regurgitation at 4 and 12 months of age. EDD, end diastolic diameter; ESD, end systolic diameter; FS, fractional shortening; LVM, left ventricular mass. n>=14 per group. *p<5,, p<1, p<01, 2w ANOVA, Tukey s correction. B. Representative PV loop of a 12mo Fbn1 +/+ (blue line, blue fill) and Fbn1 C1039G/+ mouse (red line, red fill) without valvular regurgitation. Summary data obtained from PV loop analysis shown in bar graphs: E es, end systolic elastance and PRSW, preload recruitable stroke work, reflect load independent indices of ventricular contractility. Tau, relaxation time constant reflects a load independent index of ventricular stiffness; n=3 6 per group. C. dp/dt max, peak rate of left ventricular pressure rise, an index of contractility; dp/dt min, peak rate of left ventricular pressure decline, an index of lusitropy. Invasive blood pressure measurements taken from PV loop analysis of Fbn1 +/+ and Fbn1 C1039G/+ mice without valvular regurgitation at 4 and 12 months of age. n=3 6 per group. D. Gross morphometric analysis of post natal Fbn1 +/+, Fbn1 C1039G/+, Fbn1 C1039G/C1039G mice at 8do, 6mo and 12mo age, in mice without valvular regurgitation. HW/BW, heart weight/body weight ratio; HW/TL, heart weight/tibial length ratio. n>=4 per group.

6 Supplemental Figure 2 A Post natal day 8 +/+ C1039G/+ C1039G/ C1039G psmad2 tsmad2 perk1/2 terk1/2 psmad2/tsmad perk1/2/terk1/ B Fbn1 +/+ Fbn1 C1039G/+ GAPDH 1.6 +/+ C1039G/+ C1039G/ C1039G 1.6 +/+ C1039G/+ C1039G/ C1039G 3 mo psmad2 GAPDH perk1/2 psmad2/gapdh perk1/2/gapdh C Fbn1 +/+ Fbn1 C1039G/+ GAPDH 1.6 +/+ C1039G/ /+ C1039G/+ 12 mo psmad2 tsmad2 perk1/2 terk1/2 psmad2/tsmad perk1/2/terk1/ D 2.0 Ctgf 2.0 Serpine1 +/+ C1039G/+ +/+ C1039G/+ Relative expression Relative expression /+ C1039G/+ +/+ C1039G/+ Supplemental Figure 2. Fbn1 C1039G/+ hearts have normal TGFβ signaling in the absence of hemodynamic stress. A C. Representative Western blot and summary quantification for phosphorylated/total (p/t), p/tsmad2, p/terk1/2, and GAPDH using left ventricular tissue lysates. n=4 per group. D. mrna expression normalized to 18S and then to Fbn1 +/+ data, assessed by real time RT PCR from left ventricular tissue of 3mo Fbn1 +/+ and Fbn /C1039G/+ hearts without regurgitation. Ctgf, connective tissue growth factor. Serpine1, plasminogen activator inhibitor, type 1. n>=4 per group.

7 Supplemental Figure 3 A mm SHAM: Fbn1 +/+ : Fbn1 +/+ SHAM: Fbn1 C1039G/+ : Fbn1 C1039G/+ 1 B Normalized fibrotic area Fbn1 +/+ Fbn1 C1039G/+ EDD ESD IVST PWT C Normalized myocyte area SHAM SHAM 0 SHAM SHAM D Myh7/GAPDH * Nppa/GAPDH Nppb/GAPDH SHAM SHAM SHAM SHAM SHAM SHAM Supplemental Figure 3. Fbn1 C1039G/+ hearts develop hypertrophy and fibrosis in response to pressure overload. A. Baseline echocardiographic quantification of cardiac dimensions in 5mo Fbn1 +/+ and Fbn1 C1039G/+ mice without valvular regurgitation. EDD, end diastolic diameter; ESD, end systolic diameter; IVST, interventricular septum thickness; PWT, posterior wall thickness. n=4 6 per group. B. Myocyte hypertrophy, as assessed by cross sectional area (CSA) in hematoxylin eosin staining. Summary quantification of averaged data, >20 cells per heart. n=4 per group. C. Fibrotic area, as assessed by Masson s Trichrome stain and quantified by total number of blue pixels normalized to whole tissue area and then to Fbn1 +/+ :SHAM data. n=4 6 per group. D. mrna expression of hypertrophy genes, normalized to Gapdh and then to Fbn1 +/+ :SHAM data, assessed by real time RT PCR. n=4 6 per group. Myh7, myosin heavy chain 7 (βmhc), Nppa, natriuretic peptide A (ANP), Nppb, natriuretic peptide B (BNP). p<1, p<01, 1w ANOVA, Tukey s correction.

8 Supplemental Figure 4 Supplemental Figure 4. Fibrillin 1 protein fails to deposit in myocardium in load induced heart failure in Fbn1C1039G/+ mice. Additional representative images of immunofluorescent fibrillin 1 staining (red) of heart sections from Fbn1+/+ and Fbn1C1039G/+ mice subjected to 4w. Red, fibrillin 1 (interstitial space); blue, DAPI (nuclei); Green, lipofuscin (myocytes). Top 4 panels, Scale bar: 20 µm. Bottom 4 panels, 2x zoom. White arrow head points to an example nonmyocyte cell in the interstitial space.

9 Fbn1C1039G/+: Supplemental Figure 5 A B % of total intensity psmad2/3 Myocyte Nuclei D Myocyte Nuclei psmad2 perk1/2 * NM M perk1/2 % of total intensity C NM M Supplemental Figure 5. Smad2 and ERK1/2 activation are differentially increased in the myocyte and nonmyocyte compartments of failing Fbn1C1039G/+ hearts. A. Representative serial sections of psmad2 (red, top panels) and perk1/2 (red, bottom panels) immunostaining in Fbn1C1039G/+ hearts subjected to 4w. Far left panels, scale bar: 50 µm. Middle and far right panels, zoom 2x. Blue, DAPI (nuclei); Green, lipofuscin (myocytes). White arrows, myocyte nuclei. Yellow arrows, nonmyocyte nuclei. B. Summary quantification of % of total psmad2 and perk1/2 immunofluorescence intensity localized to nonmyocyte (NM) and myocyte (M) cells per unit area. n=10 15 areas quantified. *p<5, p<1, Student s t test. C. Representative myocyte enriched serial sections. Scale bar: 50 µm. D. Representative co immunostaining of serial sections with vimentin (yellow) and psmad2 (left panel) and vimentin (yellow) and perk1/2 (right panel). Scale bar: 25 µm. Gray, lipofuscin (myocytes).

10 Supplemental Figure 6 No stim TGFβ3 TGFβ3 + psmad2/gapdh perk1/2/gapdh TGFβ3 + _ + + TGFβ3 + _ + + Supplemental Figure 6. ERK1/2 activation, but not Smad2 activation, is significantly attenuated by MEK inhibition. Immunoblot for psmad2, perk1/2 and GAPDH using cultured neonatal rat cardiac fibroblasts with TGF ß3 (10 ng/ml) stimulation for 15 minutes with and without treatment with, RDEA119 (100nM) or PD98059 (50μM). n=4 per group. p<1, p<01, 1w ANOVA, Tukey s correction.

11 Supplemental Figure 7 A B C Nppb/GAPDH Myocyte Area (μm 3 ) Fbn1 +/+ Fbn1 C1039G/+ D Myh7/GAPDH p=0.10 SHAM SHAM Supplemental Figure 7. Myocyte hypertrophy in Fbn1 C1039G/+ hearts is prevented with losartan and treatment. A. Representative hematoxylin eosin staining of formalin fixed heart sections. White dotted line delineates myocyte diameter. Scale bars: 50µm. B. Myocyte hypertrophy as assessed by wheat germ agglutinin (WGA) staining. Scale bars: 25µm. C. Summary quantification of average cross sectional area (CSA) data, >1000 cells per heart. n=4 7 per group. D. mrna expression of hypertrophy genes, normalized to Gapdh and then to Fbn1 +/+ :SHAM data, assessed by real time RT PCR. Myh7, myosin heavy chain 7 (βmhc), Myh6, myosin heavy chain 6 (αmhc), Nppa, natriuretic peptide A (ANP), Nppb, natriuretic peptide B (BNP). n=4 7 per group. *p<5, p<1, p<01, 1w ANOVA, Tukey s correction. Nppa/GAPDH SHAM SHAM * SHAM SHAM * SHAM SHAM

12 Supplemental Figure 8 psmad2/gapdh Ctrl TGFβ1 AngII perk1/2/gapdh Ctrl TGFβ1 AngII Supplemental Figure 8. Smad2 and ERK1/2 activation are differentially increased in response to TGFβ and angiotensin II in cardiac fibroblasts. Immunoblot for psmad2, perk1/2 and GAPDH using cultured neonatal murine cardiac fibroblasts with TGFß1 (5 ng/ml) or AngII (5nM) stimulation for 24 hours. Lanes were run on the same gel but were noncontiguous. n>=3 per group. p<1, 1w ANOVA, Tukey s correction.

13 Supplemental Figure 9 A psmad2 (% positive) Fbn1 +/+ Fbn1 C1039G/+ Nonmyocytes psmad2 (% positive) Myocytes B perk1/2 (% positive) SHAM SHAM Nonmyocytes perk1/2 (% positive) SHAM SHAM Myocytes C SHAM SHAM Nonmyocytes: Fbn1 +/+ Nonmyocytes: Fbn1 C1039G/+ Myocytes: Fbn1 +/+ Myocytes: Fbn1 C1039G/+ Fold change # of nonmyocytes/mm 2 * * SHAM SHAM SHAM SHAM TGFβNAbLosartan Supplemental Figure 9. Inhibition of ERK1/2 activation suppresses Smad2 activation in both nonmyocyte and myocyte compartments. A B. Labeling index (% positive cells) of psmad2 or perk1/2 immunofluorescence in the nonmyocyte and myocyte compartments. n>5 fields per group. C. Total number of nonmyocytes and myocytes normalized to Fbn1 +/+ :SHAM data. n=15 30 fields per group. *p<5, p<1, p<01, 1w ANOVA, Tukey s correction.

14 Supplemental Figure 10 B Myocyte enriched DAPI D Myocyte Fold increase Vim Tgfb3/GAPDH Nonmyocyte enriched Tgfb3 Myocyte Fibroblast Fold increase Fbn1C1039G/+: C Vim/GAPDH A Myocyte Fibroblast Supplemental Figure 10. TGFβ3 is predominantly expressed in the nonmyocyte compartment. A C. Representative in situ hybridization of Tgfb3. A. Fbn1+/+: vs Fbn1C1039G/+:, Tgfb3, red. Left panel, scale bar: 10µm. Right panel, zoom 2x inset. Dotted line demarcates myocyte compartment. Red arrows point to examples of in situ RNA hybridization (red dots) found throughout the nonmyocyte compartment. B. Myocyte vs nonmyocyte enriched areas. Scale bar: 10µm. C. Tgfb3 and Vim. Left panel, Tgfb3, red, left panel and Vim, red, right panel. Dotted line outlines the cardiac myocytes. Scale bar: 10µm. D. mrna expression of Tgfb3 and Vim normalized to Gapdh and then to myocyte data. n=4 6 per group. p<01, Student s t test.

15 Supplemental Figure 11 psmad2/gapdh Fbn1 +/+ Fbn1 C1039G/+ psmad2/gapdh Ctrl AngII Ctrl AngII 0 Ctrl TGFβ3 Ctrl TGFβ3 3 2 perk1/2/gapdh 2 1 perk1/2/gapdh 1 0 Ctrl AngII Ctrl AngII 0 Ctrl TGFβ3 Ctrl TGFβ3 Supplemental Figure 11. AngII mediated ERK1/2 activation is differentially increased in Fbn1 C1039G/+ vs WT fibroblasts. Immunoblots for psmad2, perk1/2 and GAPDH using cultured neonatal murine cardiac fibroblasts from Fbn1 C1039G/+ and Fbn1 +/+ hearts with AngII (5nM) or TGFß3 (5 ng/ml) stimulation for 12 hours. Lanes were run on the same gel but were noncontiguous. n>=3 per group. p<01, 1w ANOVA, Tukey s correction.

Supplemental Figure I

Supplemental Figure I Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Supplementary Material

Supplementary Material Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.

More information

5 -GGTAAAGCAGGTCTAGGTGGCTGACAGTCT-3. Cre-transgene allele was detected. by PCR using the primers; 5 -ACATGTTCAGGGATCGCCAG-3 and

5 -GGTAAAGCAGGTCTAGGTGGCTGACAGTCT-3. Cre-transgene allele was detected. by PCR using the primers; 5 -ACATGTTCAGGGATCGCCAG-3 and Supplemental Information Methods PCR primers for mice genotyping The Gab1 flox allele can be distinguished from the wild type Gab1 allele by PCR on genomic DNAs extracted from tails, using the primer pair

More information


DECLARATION OF CONFLICT OF INTEREST DECLARATION OF CONFLICT OF INTEREST Disclosures: Research grants & clinical trials (Gilead), honoraria & clinical trials (Berlin-Chemie/Menarini) Ranolazine in Heart Failure with Preserved Ejection Fraction

More information

MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice

MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice Research article MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice Thomas E. Callis, 1,2 Kumar Pandya, 3 Hee Young Seok, 1,2 Ru-Hang Tang, 1,2,4 Mariko Tatsuguchi, 1,2 Zhan-Peng

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

SUPPLEMENTAL DATA. Lumen area ( m 2 )

SUPPLEMENTAL DATA. Lumen area ( m 2 ) Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental

More information

FGF23 induces left ventricular hypertrophy

FGF23 induces left ventricular hypertrophy Research article FGF23 induces left ventricular hypertrophy Christian Faul, 1,2 Ansel P. Amaral, 1,2 Behzad Oskouei, 3 Ming-Chang Hu, 4,5,6 Alexis Sloan, 1,2 Tamara Isakova, 1 Orlando M. Gutiérrez, 7 Robier

More information

Supporting Information

Supporting Information Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

Copyright 2011, 2007 by Mosby, Inc., an affiliate of Elsevier Inc. Normal Cardiac Anatomy

Copyright 2011, 2007 by Mosby, Inc., an affiliate of Elsevier Inc. Normal Cardiac Anatomy Mosby,, an affiliate of Elsevier Normal Cardiac Anatomy Impaired cardiac pumping Results in vasoconstriction & fluid retention Characterized by ventricular dysfunction, reduced exercise tolerance, diminished

More information

Evaluation of Left Ventricular Function and Hypertrophy Gerard P. Aurigemma MD

Evaluation of Left Ventricular Function and Hypertrophy Gerard P. Aurigemma MD Evaluation of Left Ventricular Function and Hypertrophy Gerard P. Aurigemma MD Board Review Course 2017 43 year old health assistant Severe resistant HTN LT BSA 2 Height 64 1 Here is the M mode echocardiogram

More information

Microstructural Basis of Conduction II Introduction to Experimental Studies

Microstructural Basis of Conduction II Introduction to Experimental Studies Bioeng 6460 Electrophysiology and Bioelectricity Microstructural Basis of Conduction II Introduction to Experimental Studies Frank B. Sachse fs@cvrti.utah.edu Overview Microstructural Basis of Conduction

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Succinate causes pathological cardiomyocyte hypertrophy through GPR91 activation

Succinate causes pathological cardiomyocyte hypertrophy through GPR91 activation Aguiar et al. Cell Communication and Signaling (2014) 12:78 DOI 10.1186/s12964-014-0078-2 RESEARCH Open Access Succinate causes pathological cardiomyocyte hypertrophy through GPR91 activation Carla J Aguiar

More information

Cardiac fibrosis in mice with hypertrophic cardiomyopathy is mediated by non-myocyte proliferation and requires Tgf-β

Cardiac fibrosis in mice with hypertrophic cardiomyopathy is mediated by non-myocyte proliferation and requires Tgf-β Research article Cardiac fibrosis in mice with hypertrophic cardiomyopathy is mediated by non-myocyte proliferation and requires Tgf-β Polakit Teekakirikul, 1 Seda Eminaga, 1 Okan Toka, 1,2 Ronny Alcalai,

More information

TRPC6 fulfills a calcineurin signaling circuit during pathologic cardiac remodeling

TRPC6 fulfills a calcineurin signaling circuit during pathologic cardiac remodeling Research article TRPC6 fulfills a calcineurin signaling circuit during pathologic cardiac remodeling Koichiro Kuwahara, 1 Yanggan Wang, 2 John McAnally, 1 James A. Richardson, 1,3 Rhonda Bassel-Duby, 1

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Outline. Pathophysiology: Heart Failure. Heart Failure. Heart Failure: Definitions. Etiologies. Etiologies

Outline. Pathophysiology: Heart Failure. Heart Failure. Heart Failure: Definitions. Etiologies. Etiologies Outline Pathophysiology: Mat Maurer, MD Irving Assistant Professor of Medicine Definitions and Classifications Epidemiology Muscle and Chamber Function Pathophysiology : Definitions An inability of the

More information

Stress-dependent cardiac remodeling occurs in the absence of microrna-21 in mice

Stress-dependent cardiac remodeling occurs in the absence of microrna-21 in mice Brief report Related Commentary, page 3817 Stress-dependent cardiac remodeling occurs in the absence of microrna-21 in mice David M. Patrick, 1 Rusty L. Montgomery, 2 Xiaoxia Qi, 1 Susanna Obad, 3 Sakari

More information

PKC II inhibition attenuates myocardial infarction induced heart failure and is associated with a reduction of fibrosis and pro-inflammatory responses

PKC II inhibition attenuates myocardial infarction induced heart failure and is associated with a reduction of fibrosis and pro-inflammatory responses J. Cell. Mol. Med. Vol 15, No 8, 2011 pp. 1769-1777 PKC II inhibition attenuates myocardial infarction induced heart failure and is associated with a reduction of fibrosis and pro-inflammatory responses

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Hsp90 regulation of fibroblast activation in pulmonary fibrosis

Hsp90 regulation of fibroblast activation in pulmonary fibrosis Downloaded from http:// on January 22, 2018. Hsp90 regulation of fibroblast activation in pulmonary fibrosis Vishwaraj Sontake, 1,4 Yunguan Wang, 2 Rajesh K. Kasam, 1,4 Debora Sinner, 3 Geereddy B. Reddy,

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

ABSTARCT...1 FREQUENTLY USED ABBREVIATIONS...2 INTRODUCTION...3. Overview...3. Systolic and diastolic heart failure...4

ABSTARCT...1 FREQUENTLY USED ABBREVIATIONS...2 INTRODUCTION...3. Overview...3. Systolic and diastolic heart failure...4 TABLE OF CONTENTS ABSTARCT...1 FREQUENTLY USED ABBREVIATIONS...2 INTRODUCTION...3 Overview...3 Systolic and diastolic heart failure...4 Prevalence and incidence of heart failure...4 Prognosis...5 Etiology

More information

Thick Walls, Why? Steven J. Lester MD, FRCP(C), FACC, FASE Relevant Financial Relationship(s) None Off Label Usage None

Thick Walls, Why? Steven J. Lester MD, FRCP(C), FACC, FASE Relevant Financial Relationship(s) None Off Label Usage None Thick Walls, Why? Steven J. Lester MD, FRCP(C), FACC, FASE Relevant Financial Relationship(s) None Off Label Usage None 1 Hypertrophy Infiltrative Storage Genetic Hemodynamic, Endocrine Amyloidosis Glycogen

More information

Muscle RING-finger 2 and 3 maintain striated-muscle structure and function

Muscle RING-finger 2 and 3 maintain striated-muscle structure and function Published online in Wiley Online Library (wileyonlinelibrary.com) ORIGINAL ARTICLE Muscle RING-finger 2 and 3 maintain striated-muscle structure and function Dörte Lodka 1, Aanchal Pahuja 2, Cornelia Geers-Knörr

More information

Does the reduction in systolic blood pressure alone explain the regression of left ventricular hypertrophy?

Does the reduction in systolic blood pressure alone explain the regression of left ventricular hypertrophy? (24) 18, S23 S28 & 24 Nature Publishing Group All rights reserved 95-92/4 $3. www.nature.com/jhh ORIGINAL ARTICLE Does the reduction in systolic blood pressure alone explain the regression of left ventricular

More information


RIGHT VENTRICULAR SIZE AND FUNCTION RIGHT VENTRICULAR SIZE AND FUNCTION Edwin S. Tucay, MD, FPCC, FPCC, FPSE Philippine Society of Echocardiography Quezon City, Philippines Echo Mission, BRTTH, Legaspi City, July 1-2, 2016 NO DISCLOSURE

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment Small Molecule Inhibitor of the Wnt Pathway (SM755) as a Potential Topical Scleroderma Treatment Vishal Deshmukh, PhD, Allison Hood, Yusuf Yazici, MD Disclosures Vishal Deshmukh, Ph.D. o Financial disclosure:

More information

HDAC4 controls histone methylation in response to elevated cardiac load

HDAC4 controls histone methylation in response to elevated cardiac load Research article HDAC4 controls histone methylation in response to elevated cardiac load Mathias Hohl, 1 Michael Wagner, 1 Jan-Christian Reil, 1 Sarah-Anne Müller, 1 Marcus Tauchnitz, 1 Angela M. Zimmer,

More information

Vevo 2100 System Cardio Measurements. Dieter Fuchs, PhD FUJIFILM VisualSonics, Inc.

Vevo 2100 System Cardio Measurements. Dieter Fuchs, PhD FUJIFILM VisualSonics, Inc. Vevo 2100 System Cardio Measurements Dieter Fuchs, PhD FUJIFILM VisualSonics, Inc. dfuchs@visualsonics.com Instructions This document is a guideline on how to assess cardiac function in rodents imaged

More information

Advanced imaging of the left atrium - strain, CT, 3D, MRI -

Advanced imaging of the left atrium - strain, CT, 3D, MRI - Advanced imaging of the left atrium - strain, CT, 3D, MRI - Monica Rosca, MD Carol Davila University of Medicine and Pharmacy, Bucharest, Romania Declaration of interest: I have nothing to declare Case

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP Glucose vs.

More information

Systolic and Diastolic Dysfunction: Four Upcoming Challenges

Systolic and Diastolic Dysfunction: Four Upcoming Challenges Systolic and Diastolic Dysfunction: Four Upcoming Challenges Promoting Early Detection HFrEF: Beyond Neprilysin/Enalapril HFmrEF: What Is It and How Does One Manage It? HFpEF: Etiopathogenetic Role and

More information

Heart Failure in Pressure Overload Hypertrophy The Relative Roles of Ventricular Remodeling and Myocardial Dysfunction

Heart Failure in Pressure Overload Hypertrophy The Relative Roles of Ventricular Remodeling and Myocardial Dysfunction Journal of the American College of Cardiology Vol. 39, No. 4, 2002 2002 by the American College of Cardiology ISSN 0735-1097/02/$22.00 Published by Elsevier Science Inc. PII S0735-1097(01)01792-2 Heart

More information

Ivana Nedeljkovic, M Ostojic, V Giga, V Stojanov, J Stepanovic, A Djordjevic Dikic, B Beleslin, M Nikolic, M Petrovic, D Popovic

Ivana Nedeljkovic, M Ostojic, V Giga, V Stojanov, J Stepanovic, A Djordjevic Dikic, B Beleslin, M Nikolic, M Petrovic, D Popovic Combined cardiopulmonary exercise stress echocardiography test: New test for assessment of diastolic dysfunction in patients with hypertension Ivana Nedeljkovic, M Ostojic, V Giga, V Stojanov, J Stepanovic,

More information


CARDIAC HYPERTROPHY: PATHOPHYSIOLOGY AND PROGRESSION TO FAILURE Heart Failure The abnormalities described above often culminate in heart failure, an extremely common result of many forms of heart disease. In heart failure, often called congestive heart failure (CHF),

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

Aortic Root Dilatation as a Marker of Subclinical Left Ventricular Diastolic Dysfunction in Patients with Cardiovascular Risk Factors

Aortic Root Dilatation as a Marker of Subclinical Left Ventricular Diastolic Dysfunction in Patients with Cardiovascular Risk Factors The Journal of International Medical Research 2011; 39: 64 70 Aortic Root Dilatation as a Marker of Subclinical Left Ventricular Diastolic Dysfunction in Patients with Cardiovascular Risk Factors H MASUGATA,

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Effect of Ventricular Pacing on Myocardial Function. Inha University Hospital Sung-Hee Shin

Effect of Ventricular Pacing on Myocardial Function. Inha University Hospital Sung-Hee Shin Effect of Ventricular Pacing on Myocardial Function Inha University Hospital Sung-Hee Shin Contents 1. The effect of right ventricular apical pacing 2. Strategies for physiologically optimal ventricular

More information

Age-related changes in cardiovascular system. Dr. Rehab Gwada

Age-related changes in cardiovascular system. Dr. Rehab Gwada Age-related changes in cardiovascular system Dr. Rehab Gwada Objectives explain the main structural and functional changes in cardiovascular system associated with normal aging Introduction aging results

More information

Evaluation of Myocardial Changes in Familial Amyloid Polyneuropathy after Liver Transplantation

Evaluation of Myocardial Changes in Familial Amyloid Polyneuropathy after Liver Transplantation ORIGINAL ARTICLE Evaluation of Myocardial Changes in Familial Amyloid Polyneuropathy after Liver Transplantation Sadahisa Okamoto 1, Taro Yamashita 1, Yukio Ando 2, Mitsuharu Ueda 2, Yohei Misumi 1, Konen

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Left ventricular hypertrophy: why does it happen?

Left ventricular hypertrophy: why does it happen? Nephrol Dial Transplant (2003) 18 [Suppl 8]: viii2 viii6 DOI: 10.1093/ndt/gfg1083 Left ventricular hypertrophy: why does it happen? Gerard M. London Department of Nephrology and Dialysis, Manhes Hospital,

More information



More information

Requirement for Ca 2+ /calmodulin dependent kinase II in the transition from pressure overload induced cardiac hypertrophy to heart failure in mice

Requirement for Ca 2+ /calmodulin dependent kinase II in the transition from pressure overload induced cardiac hypertrophy to heart failure in mice Research article Related Commentary, page 1082 Requirement for Ca 2+ /calmodulin dependent kinase II in the transition from pressure overload induced cardiac hypertrophy to heart failure in mice Haiyun

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis 10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis

More information

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin Molecular Cell, Volume 64 Supplemental Information 3D-CLEM Reveals that a Major Portion of Mitotic Chromosomes Is Not Chromatin Daniel G. Booth, Alison J. Beckett, Oscar Molina, Itaru Samejima, Hiroshi

More information

2.6 Cardiovascular Computer Simulation

2.6 Cardiovascular Computer Simulation 2.6 Cardiovascular Computer Simulation ROOM 23G22 Contents 1. INTRODUCTION... 4 1.1. GENERAL REMARKS... 4 1.2. LEARNING GOALS... 4 1.3. PHYSIOLOGICAL PARAMETERS... 5 1.4. GLOSSARY... 5 2. USING THE COMPUTER

More information

QUIZ 1. Tuesday, March 2, 2004

QUIZ 1. Tuesday, March 2, 2004 Harvard-MIT Division of Health Sciences and Technology HST.542J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments

More information


SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Introduction. assisted by a newly-developed semi-automated algorithm for automated function imaging (AFI). 7) This method can

Introduction. assisted by a newly-developed semi-automated algorithm for automated function imaging (AFI). 7) This method can ORIGINAL ARTICLE Korean Circ J 2008;38:250-256 Print ISSN 1738-5520 / On-line ISSN 1738-5555 Copyright c 2008 The Korean Society of Cardiology Systolic Long Axis Function of the Left Ventricle, as Assessed

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Dr.Fayez EL Shaer Consultant cardiologist Assistant professor of cardiology KKUH

Dr.Fayez EL Shaer Consultant cardiologist Assistant professor of cardiology KKUH Pulmonary Hypertension in patients with Heart Failure with Preserved Ejection Fraction Dr.Fayez EL Shaer Consultant cardiologist Assistant professor of cardiology KKUH Recent evaluation of available data

More information

Circ Res. 2009;105:12-15; originally published online June 11, 2009; doi: /CIRCRESAHA

Circ Res. 2009;105:12-15; originally published online June 11, 2009; doi: /CIRCRESAHA Avoidance of Transient Cardiomyopathy in Cardiomyocyte-Targeted Tamoxifen-Induced MerCreMer Gene Deletion Models Norimichi Koitabashi, Djahida Bedja, Ari L. Zaiman, Yigal M. Pinto, Manling Zhang, Kathleen

More information

Comprehensive Hemodynamics By Doppler Echocardiography. The Echocardiographic Swan-Ganz Catheter.

Comprehensive Hemodynamics By Doppler Echocardiography. The Echocardiographic Swan-Ganz Catheter. Comprehensive Hemodynamics By Doppler Echocardiography. The Echocardiographic Swan-Ganz Catheter. Itzhak Kronzon, MD, FASE, FACC, FESC, FAHA, FACP, FCCP North Shore HS, LIJ/Lenox Hill Hospital, New York

More information

Jong-Won Ha*, Jeong-Ah Ahn, Jae-Yun Moon, Hye-Sun Suh, Seok-Min Kang, Se-Joong Rim, Yangsoo Jang, Namsik Chung, Won-Heum Shim, Seung-Yun Cho

Jong-Won Ha*, Jeong-Ah Ahn, Jae-Yun Moon, Hye-Sun Suh, Seok-Min Kang, Se-Joong Rim, Yangsoo Jang, Namsik Chung, Won-Heum Shim, Seung-Yun Cho Eur J Echocardiography (2006) 7, 16e21 CLINICAL/ORIGINAL PAPERS Triphasic mitral inflow velocity with mid-diastolic flow: The presence of mid-diastolic mitral annular velocity indicates advanced diastolic

More information

Topics to be Covered. Cardiac Measurements. Distribution of Blood Volume. Distribution of Pulmonary Ventilation & Blood Flow

Topics to be Covered. Cardiac Measurements. Distribution of Blood Volume. Distribution of Pulmonary Ventilation & Blood Flow Topics to be Covered MODULE F HEMODYNAMIC MONITORING Cardiac Output Determinants of Stroke Volume Hemodynamic Measurements Pulmonary Artery Catheterization Control of Blood Pressure Heart Failure Cardiac

More information

Ref 1. Ref 2. Ref 3. Ref 4. See graph

Ref 1. Ref 2. Ref 3. Ref 4. See graph Ref 1 Ref 2 Ref 3 1. Ages 6-23 y/o 2. Significant LVM differences by gender 3. For males 95 th percentiles: a. LVM/BSA = 103 b. LVM/height = 100 4. For females 95 th percentiles: a. LVM/BSA = 84 b. LVM/height

More information

Martin G. Keane, MD, FASE Temple University School of Medicine

Martin G. Keane, MD, FASE Temple University School of Medicine Martin G. Keane, MD, FASE Temple University School of Medicine Measurement of end-diastolic LV internal diameter (LVIDd) made by properly-oriented M-Mode techniques in the Parasternal Long Axis View (PLAX):

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

Ophthalmology, Radiation Oncology,

Ophthalmology, Radiation Oncology, Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic

More information

Let-7a Is an Antihypertrophic Regulator in the Heart via Targeting Calmodulin

Let-7a Is an Antihypertrophic Regulator in the Heart via Targeting Calmodulin 22 Ivyspring International Publisher Research Paper International Journal of Biological Sciences 2017; 13(1): 22-31. doi: 10.7150/ijbs.16298 Let-7a Is an Antihypertrophic Regulator in the Heart via Targeting

More information

Multimodality Imaging of Anomalous Left Coronary Artery from the Pulmonary

Multimodality Imaging of Anomalous Left Coronary Artery from the Pulmonary 1 IMAGES IN CARDIOVASCULAR ULTRASOUND 2 3 4 Multimodality Imaging of Anomalous Left Coronary Artery from the Pulmonary Artery 5 6 7 Byung Gyu Kim, MD 1, Sung Woo Cho, MD 1, Dae Hyun Hwang, MD 2 and Jong

More information

Stretching Cardiac Myocytes: A Finite Element Model of Cardiac Tissue

Stretching Cardiac Myocytes: A Finite Element Model of Cardiac Tissue Megan McCain ES240 FEM Final Project December 19, 2006 Stretching Cardiac Myocytes: A Finite Element Model of Cardiac Tissue Cardiac myocytes are the cells that constitute the working muscle of the heart.

More information

Sports Participation in Patients with Inherited Diseases of the Aorta

Sports Participation in Patients with Inherited Diseases of the Aorta Sports Participation in Patients with Inherited Diseases of the Aorta Yonatan Buber, MD Adult Congenital Heart Service Leviev Heart Center Safra Childrens Hospital Disclosures None Patient Presentation

More information

Sildenafil treatment attenuates ventricular remodeling in an experimental model of aortic regurgitation

Sildenafil treatment attenuates ventricular remodeling in an experimental model of aortic regurgitation DOI 10.1186/s40064-015-1317-8 RESEARCH Open Access Sildenafil treatment attenuates ventricular remodeling in an experimental model of aortic regurgitation Kristian Eskesen 1,2*, Niels Thue Olsen 1,2, Veronica

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

NO triggers RGS4 degradation to coordinate angiogenesis and cardiomyocyte growth

NO triggers RGS4 degradation to coordinate angiogenesis and cardiomyocyte growth Research article NO triggers RGS4 degradation to coordinate angiogenesis and cardiomyocyte growth Irina M. Jaba, 1 Zhen W. Zhuang, 1 Na Li, 1 Yifeng Jiang, 2 Kathleen A. Martin, 1,3 Albert J. Sinusas,

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Diagnosis is it really Heart Failure?

Diagnosis is it really Heart Failure? ESC Congress Munich - 25-29 August 2012 Heart Failure with Preserved Ejection Fraction From Bench to Bedside Diagnosis is it really Heart Failure? Prof. Burkert Pieske Department of Cardiology Med.University

More information

The impact of hypertension on systolic and diastolic left ventricular function. A tissue Doppler echocardiographic study

The impact of hypertension on systolic and diastolic left ventricular function. A tissue Doppler echocardiographic study The impact of hypertension on systolic and diastolic left ventricular function. A tissue Doppler echocardiographic study Manolis Bountioukos, MD, PhD, a Arend F.L. Schinkel, MD, PhD, a Jeroen J. Bax, MD,

More information

Clinical material and methods. Clinical Departments of 1 Radiology II and 2 Cardiology, Innsbruck Medical University, Innsbruck, Austria

Clinical material and methods. Clinical Departments of 1 Radiology II and 2 Cardiology, Innsbruck Medical University, Innsbruck, Austria Aortic Valve Calcification as Quantified with Multislice Computed Tomography Predicts Short-Term Clinical Outcome in Patients with Asymptomatic Aortic Stenosis Gudrun M. Feuchtner 1, Silvana Müller 2,

More information

Hippo pathway deficiency reverses systolic heart failure after infarction

Hippo pathway deficiency reverses systolic heart failure after infarction Letter doi:1.138/nature2445 Hippo pathway deficiency reverses systolic heart failure after infarction John P. Leach 1, Todd Heallen 2, Min Zhang 1,3, Mahdis Rahmani 2, Yuka Morikawa 2, Matthew C. Hill

More information

Study Title: Study of Hypertenol on the development of Hypertension in the SHR INTRODUCTION

Study Title: Study of Hypertenol on the development of Hypertension in the SHR INTRODUCTION P.O. No.: 20001201 HYPERTENOL Pharmacodynamical Study (Efficacy Study) LIIDHATIRY IEPD,RT Test Facilitv: Institut de Cardiologie De Montreal, Canada Sponsor: Hamida Pharma, Inc, USA PHARMACODYNAMICAL STUDY

More information

LCZ696 A First-in-Class Angiotensin Receptor Neprilysin Inhibitor

LCZ696 A First-in-Class Angiotensin Receptor Neprilysin Inhibitor The Angiotensin Receptor Neprilysin Inhibitor LCZ696 in Heart Failure with Preserved Ejection Fraction The Prospective comparison of ARNI with ARB on Management Of heart failure with preserved ejection

More information

Heart Failure with Preserved Ejection Fraction: Pathologies, Aetiology and Directions for Treatment

Heart Failure with Preserved Ejection Fraction: Pathologies, Aetiology and Directions for Treatment Heart Failure with Preserved Ejection Fraction: Pathologies, Aetiology and Directions for Treatment Dr Will Watson Oxford Centre for Magnetic Resonance Research Will.watson@cardiov.ox.ac.uk Introduction

More information

Advances in Peritoneal Dialysis, Vol. 29, 2013

Advances in Peritoneal Dialysis, Vol. 29, 2013 Advances in Peritoneal Dialysis, Vol. 29, 2013 Takeyuki Hiramatsu, 1 Takahiro Hayasaki, 1 Akinori Hobo, 1 Shinji Furuta, 1 Koki Kabu, 2 Yukio Tonozuka, 2 Yoshiyasu Iida 1 Icodextrin Eliminates Phosphate

More information

Echocardiographic Evaluation of the Cardiomyopathies. Stephanie Coulter, MD, FACC, FASE April, 2016

Echocardiographic Evaluation of the Cardiomyopathies. Stephanie Coulter, MD, FACC, FASE April, 2016 Echocardiographic Evaluation of the Cardiomyopathies Stephanie Coulter, MD, FACC, FASE April, 2016 Cardiomyopathies (CMP) primary disease intrinsic to cardiac muscle Dilated CMP Hypertrophic CMP Infiltrative

More information