Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8"

Transcription

1 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+, Chihiro Mogi 2+, Hiroki Ono 1+, Toshihide Nishi 1, Yuma Horii 1, Yuki 6 Ohba 1, Koichi Sato 2, Michio Nakaya 1, Fumikazu Okajima 2,, Hitoshi Kurose 1,*

2 7 Supplementary Figure 1. Comparison of Gpr4, Ogr1 and G2a expression levels in 8 the hearts of WT and TDAG8 mice on post-mi day 3. 9 Quantitative analysis of the expression of proton-sensing GPCR mrnas in WT mice 1 hearts (sham, n = 3; MI, n = 7) and TDAG8 mice hearts (sham, n = 3; MI, n = 5) on 11 post-mi day 3. mrna expression was normalized to GAPDH. Comparisons were 12 assessed using unpaired Student s t-tests. Error bars represent the mean ± SEM (, 13 not significant) Supplementary Figure 2. The area at risk and infarct size were comparable 16 between WT and TDAG8 mice during the initial phase after MI. 17 (a) Representative heart sections of Evans blue/ttc staining 3 h after MI. The 18 non-ischemic area is indicated in blue, the area at risk (AAR) in red and the infarct area 19 in white. (b) The infarct size and AAR were quantified as a percentage of the AAR and 2 the left ventricular area (LV) of WT (n = 5) and TDAG8 (n = 4) mice. Error bars 21 represent the mean ± SEM. Comparisons among groups were assessed using unpaired 22 Student s t-test (, not significant) Supplementary Figure 3. Comparison of infiltrated B cells in the infarcted hearts

3 25 of WT and TDAG8 mice. 26 Comparison of infiltrated B cells (B22 + ) on post-mi day 3 between WT mice (n = 4) 27 and TDAG8 mice (n = 3) was performed using flow cytometry. Representative 28 FACS profiles are shown. The comparison was assessed using unpaired Student s t-tests. 29 Error bars represent the mean ± SEM Supplementary Figure 4. No significant differences in Tnf mrna were found on 32 post-mi day Tnf mrna expression in infarcted and non-infarcted areas of WT mice (sham n = 3, 34 MI n = 7) and TDAG8 mice (sham n = 3, MI n = 5) 3 days after MI was measured 35 using real-time RT-PCR. The comparison was assessed using an unpaired Student s 36 t-test Supplementary Figure 5. Time course of Ccl2 mrna expression in cardiac 39 macrophages stimulated with TNF- and HMGB1. 4 Cardiac macrophages were isolated from WT mice on post-mi day 3 and stimulated 41 with 1-ng/ml TNF- (left) or 1- g/ml HMGB1 (right). Three heart samples were 42 combined as one sample and used for real-time RT-PCR analysis.

4 43 44 Supplementary Figure 6. Comparison of infiltrated CCR6 + T cells in the 45 infarcted hearts of WT and TDAG8 mice on post-mi day Cardiac T cells were isolated from WT and TDAG8 mice 5 days after MI; stained 47 with antibodies against CD3, TCR and CCR6; and were analysed by flow cytometry. 48 Grey histograms indicate the isotype control Supplementary Figure 7. Upregulation of IL-17a mrna in TDAG8 mice 7 51 days after MI. 52 IL-17a mrna expression in the non-infarct and infarcted areas of WT mice (n = 7) or 53 TDAG8 mice (n = 5) 7 days after MI was measured using real-time RT-PCR. 54 Comparisons were assessed with a one-way ANOVA followed by Tukey s test. Error 55 bars represent the mean ± SEM (, not significant) Supplementary Figure 8. Comparison of IL-17A-related inflammatory genes of 58 WT and TDAG8 mice. 59 Expression levels of inflammatory gene mrnas in the infarcted and non-infarcted areas 6 of WT mice (sham, n = 6; MI, n = 1) and TDAG8 mice (sham, n = 5; MI, n = 8)

5 61 on post-mi day 3. # indicates that Il8 mrna was not detected. Comparisons were 62 assessed using unpaired Student s t-tests. Error bars represent the mean ± SEM (, 63 not significant) Supplementary Figure 9. A portion of CCR6 + T cells secrete IL-17A. 66 Cardiac cells were isolated from TDAG8 mice on post-mi day 5 and stimulated 67 with PMA and ionomycin in the presence of Brefeldin A. The samples were stained 68 with antibodies against CD3, TCR, CCR6 and IL-17A. After gating visible and 69 singlet cells, CD3 + CR + CCR6 + cells were further gated, and IL-17A expression was 7 determined using flow cytometry. Mixed samples (n = 3) were used for the analysis Supplementary Figure 1. Comparison of fibrosis between WT and TDAG8 73 mice on the post-mi day (a) Expression levels of fibrosis-related gene mrnas in the infarcted and non-infarcted 75 area of WT mice (sham n = 3, MI n = 7) and TDAG8 mice (sham n = 3, MI n = 5) 76 on post-mi day 3. (b) Quantification of the fibrotic area using Picrosirius Red staining 77 in the infarcted areas on post-mi day 3 in WT (n = 3) and TDAG8 (n = 3) mice. 78 Comparisons were assessed using unpaired Student s t-tests. Error bars represent the

6 79 mean ± SEM (, not significant) Supplementary Figure 11. Quantitative analysis of the mrna expression of 82 proton-sensing GPCRs in cardiac macrophages. 83 Cardiac cells were isolated from WT mice on post-mi day 3, and cardiac macrophages 84 (CD Ly6G CD11b + CD3 ) were sorted after eliminating dead cells and doublet 85 cells. The levels of proton-sensing GPCRs (TDAG8, GPR4, OGR1 and G2A) were 86 quantified using real-time RT-PCR. Three infarcted WT mice hearts were combined for 87 this analysis

7 9 Supplemental Table 1. Sequences of primers or Assay ID used for real time 91 RT-PCR mrna Sequences of primers (Sigma) Il17a Forward: 5 -GGTCAACCTCAAAGTCTTTAACTCC-3 Reverse: 5 -GGTCTTCATTGCGGTGGAGAG-3 Probe: 5 -CCAGAAGGCCCTCAGACTACCTCAACCG-3 Ccl2 Forward: 5 -CGGCTGGAGCATCCACGT-3 Reverse: 5 -ATTGGGATCATCTTGCTGGTGAAT-3 Probe: 5 -TCAGCCAGATGCAGTTAACGCCCCAC-3 Cxcl12 Forward: 5 -GTGACGGTAAACCAGTCAGCC-3 Reverse: 5 -GCACAGTTTGGAGTGTTGAGGA-3 Probe: 5 -CGGTTCTTCGAGAGCCACATCGCCAG-3 Ccl2 Forward: 5 -CCTCTCGTACATACAGAC-3 Reverse: 5 -CGTGTGAAAGATGATAGC-3 Probe: 5 -CATCGGCCATCTGTCTTGTGAA-3 Il23 Forward: 5 -TCAAGGACAACAGCCAGTTCT-3 Reverse: 5 -AAGATGTCAGAGTCAAGCAGGT-3 Probe: 5 -AGCCAGACCTTGGCGGATCCTTTGC-3

8 92 Supplemental Table 1 (Continued) mrna Sequences of primers (Sigma) Tdag8 Forward: 5 -TGAGCTAGGGATTTACCTCTTCAG-3 Reverse: 5 -AGTCCAGTTGTCTTTATTCCAAGTG-3 Probe: 5 -CTGTCCCTGTCAGACCTGCTGTATGCG-3 Gpr4 Forward: 5 -GCACCGCTCTTCCATGATGA-3 Reverse: 5 -CGCTCCATGGGGAACTTCTC-3 Probe: 5 -TCGTGATCGCTACAACCACACCTTCTGCT-3 Ogr1 Forward: 5 -TCTGGGAGAGAAACTGTGAGTTTG-3 Reverse: 5 -TCCTCGGAGGCGGGCTAG-3 Probe: 5 -TCTATCACTTCTCCCTCCTCCTCACCAGCT-3 G2a Forward: 5 -GGTCCTGGTGGTGGTGTAC-3 Reverse: 5 -GCAGAACAGGTAGACGGCTAG-3 Probe: 5 -CCTACCAGCCAACTGCCTGACTGCCT-3 GAPDH Forward: 5 -CGTCCCGTAGACAAAATGGTGA-3 Reverse: 5 -CCACTTTGCCACTGCAAATGG-3 Probe: 5 -CCAATACGGCCAAATCCGTTCACACCGA-3 93

9 94 Supplemental Table 1 (Continued) mrna Sequences of primers (Sigma) or Assay ID (Thermo Fisher) 18S rrna Forward: 5 -GGGTCATAAGCTTGCGTTGATTAAG-3 Reverse: 5 -TCCGAGGGCCTCACTAAAC-3 Probe: 5 - TACACACCGCCCGTCGCTACTACCG-3 Cxcl15 (Il8) Forward: 5 - ACAGAAAGGAAGTGATAGCAGTCC-3 Reverse: 5 - GAGGTCCTCAGGTAGGAACCT-3 Probe: 5 - ATTGGGCCAACAGTAGCCTTCACCCATG-3 Tnf Mm443258_m1 Il1 Mm434228_m1 Il6 Mm44619_m1 Ccl2 Mm _m1 Col1a1 Mm81666_g1 Tgf 1 Mm117882_m1 Ifn Mm _m1 Tdag8 Mm _s1 18S rrna Hs33631_g1 Csf-2 Mm12962_m1

10 Gpr4 Ogr1 G2a (x1-5 ) (x1-5 ) (x1-5 ) Copy number/gapdh Copy number/gapdh Copy number/gapdh sham infarct sham infarct WT TDAG8 sham infarct sham infarct sham infarct sham infarct WT TDAG8 WT TDAG8 Supplementary Figure 1. Comparison of Gpr4, Ogr1 and G2a expression levels in the hearts of WT and TDAG8 mice on post-mi day 3. Quantitative analysis of the expression of proton-sensing GPCR mrnas in WT mice hearts (sham, n = 3; MI, n = 7) and TDAG8 mice hearts (sham, n = 3; MI, n = 5) on post-mi day 3. mrna expression was normalized to GAPDH. Comparisons were assessed using unpaired Student s t-tests. Error bars represent the mean ± SEM (, not significant).

11 a b 1 mm N.S N.S AAR /LV (%) Infarct area /AAR (%) WT 4 WT WT Supplementary Figure 2. The area at risk and infarct size were comparable between WT and TDAG8 mice during the initial phase after MI. (a) Representative heart sections of Evans blue/ttc staining 3 h after MI. The non-ischemic area is indicated in blue, the area at risk (AAR) in red and the infarct area in white. (b) The infarct size and AAR were quantified as a percentage of the AAR and the left ventricular area (LV) of WT (n = 5) and TDAG8 (n = 4) mice. Error bars represent the mean ± SEM. Comparisons among groups were assessed using unpaired Student s t-test (, not significant).

12 WT Lymphocyte singlet B cell (B22 + ) p=.14 SSC-A Lymphocyte FSC-A FSC-H singlet FSC-A Count 46. B22 (%) WT Supplementary Figure 3. Comparison of infiltrated B cells in the infarcted hearts of WT and TDAG8 mice. Comparison of infiltrated B cells (B22+) on post-mi day 3 between WT mice (n = 4) and TDAG8 mice (n = 3) was performed using flow cytometry. Representative FACS profiles are shown. The comparison was assessed using unpaired Student s t-tests. Error bars represent the mean ± SEM.

13 mrna/18s rrna (fold) WT Tnfα Sham Non-infarct Infarct Supplementary Figure 4. No significant differences in Tnfα mrna were found on post-mi day 3. Tnfα mrna expression in infarcted and non-infarcted areas of WT mice (sham n = 3, MI n = 7) and TDAG8 mice (sham n = 3, MI n = 5) 3 days after MI was measured using real-time RT-PCR. The comparison was assessed using an unpaired Student s t-test.

14 mrna/18s rrna (fold) h 2 h Ccl2 (TNF-α) 4 h 8 h 24 h h 2 h Ccl2 (HMGB1) 4 h 8 h 24 h Supplementary Figure 5. Time course of Ccl2 mrna expression in cardiac macrophages stimulated with TNF-α and HMGB1. Cardiac macrophages were isolated from WT mice on post-mi day 3 and stimulated with 1-ng/ml TNF-α (left) or 1-μg/ml HMGB1 (right). Three heart samples were combined as one sample and used for real-time RT-PCR analysis.

15 CD3ε + γδtcr + cells WT Count CCR6 Supplementary Figure 6. Comparison of infiltrated CCR6 + γδt cells in the infarcted hearts of WT and TDAG8 mice on post-mi day 5. Cardiac γδt cells were isolated from WT and TDAG8 mice 5 days after MI; stained with antibodies against CD3ε, γδtcr and CCR6; and were analysed by flow cytometry. Grey histograms indicate the isotype control.

16 Il-17a mrna/18s rrna (fold) Non-infarct WT Infarct p <.5 Non-infarct Infarct Supplementary Figure 7. Upregulation of Il-17a mrna in TDAG8 mice 7 days after MI. IL-17a mrna expression in the non-infarct and infarcted areas of WT mice (n = 7) or TDAG8 mice (n = 5) 7 days after MI was measured using real-time RT-PCR. Comparisons were assessed with a one-way ANOVA followed by Tukey s test. Error bars represent the mean ± SEM (, not significant).

17 Il6 Il8 (Cxcl15) Gm-csf (Csf2) mrna/18s rrna (fold) # # # # WT WT WT Sham Non-infarct Infarct Supplementary Figure 8. Comparison of IL-17A-related inflammatory genes of WT and TDAG8 mice. Expression levels of inflammatory gene mrnas in the infarcted and non-infarcted areas of WT mice (sham, n = 6; MI, n = 1) and TDAG8 mice (sham, n = 5; MI, n = 8) on post-mi day 3. # indicates that Il8 mrna was not detected. Comparisons were assessed using unpaired Student s t-tests. Error bars represent the mean ± SEM (, not significant).

18 CD3ε + γδtcr + CD3ε + γδtcr + CCR6 + Count CCR IL-17A Supplementary Figure 9. A portion of CCR6 + γδt cells secrete IL-17A. Cardiac cells were isolated from TDAG8 mice on post-mi day 5 and stimulated with PMA and ionomycin in the presence of Brefeldin A. The samples were stained with antibodies against CD3ε, γδtcr, CCR6 and IL-17A. After gating visible and singlet cells, CD3ε + γδtcr + CCR6 + cells were further gated, and IL-17A expression was determined using flow cytometry. Mixed samples (n = 3) were used for the a.nalysis.

19 a Col1a1 Tgfb mrna/18s rrna (fold) Sham Non-infarct Infarct WT WT b Infarct 4 WT CVF (%) μ WT Supplementary Figure 1. Comparison of fibrosis between WT and TDAG8 mice on the post-mi day 3. (a) Expression levels of fibrosis-related gene mrnas in the infarcted and non-infarcted area of WT mice (sham n = 3, MI n = 7) and TDAG8 mice (sham n = 3, MI n = 5) on post-mi day 3. (b) Quantification of the fibrotic area using Picrosirius Red staining in the infarcted areas on post-mi day 3 in WT (n = 3) and TDAG8 (n = 3) mice. Comparisons were assessed using unpaired Student s t-tests. Error bars represent the mean ± SEM (, not significant).

20 Copy number/gapdh (x1-3 ) Proton-sensing GPCRs TDAG8 GPR4 OGR1 G2A Supplementary Figure 11. Quantitative analysis of the mrna expression of protonsensing GPCRs in cardiac macrophages. Cardiac cells were isolated from WT mice on post-mi day 3, and cardiac macrophages (CD Ly6G CD11b + CD3 ) were sorted after eliminating dead cells and doublet cells. The levels of proton-sensing GPCRs (TDAG8, GPR4, OGR1 and G2A) were quantified using realtime RT-PCR. Three infarcted WT mice hearts were combined for this analysis.

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF A RT I C L E S Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL and GM-CSF Daniela F. Quail,7, Oakley C. Olson,7, Priya Bhardwaj, Logan A. Walsh, Leila Akkari,,,

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supporting Information

Supporting Information Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine

More information

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs. Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small

More information

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression Zha et al. Journal of Neuroinflammation 2014, 11:65 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,

More information

CCR6 is required for IL-23 induced psoriasis-like inflammation in mice

CCR6 is required for IL-23 induced psoriasis-like inflammation in mice Research article CCR6 is required for IL-23 induced psoriasis-like inflammation in mice Michael N. Hedrick, 1 Anke S. Lonsdorf, 2,3 Aiko-Konno Shirakawa, 1 Chyi-Chia Richard Lee, 4 Fang Liao, 1 Satya P.

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary figure 2. VCAM1 protein expression in static HCAECs exposed to CSE over 72 hours, with TNFα or TNFα + CSE positive controls.

Supplementary figure 2. VCAM1 protein expression in static HCAECs exposed to CSE over 72 hours, with TNFα or TNFα + CSE positive controls. Supplementary data Cigarette smoke extract profoundly suppresses TNFα-mediated proinflammatory gene expression through upregulation of ATF3 in human coronary artery endothelial cells Jack E. Teasdale 1,

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Prolactin and its cleaved 16-kDa subform. enhance myocardial injury after ischemia/reperfusion

Prolactin and its cleaved 16-kDa subform. enhance myocardial injury after ischemia/reperfusion Prolactin and its cleaved 16-kDa subform enhance myocardial injury after ischemia/reperfusion Hatice Yamac, Denise Hilfiker-Kleiner Department of Cardiology & Angiology Hannover, Medical School There is

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

Asian Zika virus strains target CD14 + blood monocytes and induce M2-skewed immunosuppression during pregnancy

Asian Zika virus strains target CD14 + blood monocytes and induce M2-skewed immunosuppression during pregnancy SUPPLEMENTARY INFORMATION Articles DOI:./s-7-- In the format provided y the authors and unedited. Asian Zika virus strains target CD + lood monocytes and induce M-skewed immunosuppression during pregnancy

More information

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g.71598-?_71681+?del

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Cardiac myosin-th17 responses promote heart failure in human myocarditis

Cardiac myosin-th17 responses promote heart failure in human myocarditis Cardiac myosin-th17 responses promote heart failure in human myocarditis Jennifer M. Myers, 1 Leslie T. Cooper, 2 David C. Kem, 3 Stavros Stavrakis, 4 Stanley D. Kosanke, 5 Ethan M. Shevach, 6 DeLisa Fairweather,

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/333/333ra47/dc1 Supplementary Materials for Androgen receptor antagonists compromise T cell response against prostate cancer leading to early tumor

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Supplementary appendix

Supplementary appendix Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kennedy GA, Varelias A, Vuckovic S, et al.

More information

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Categorical analysis of human T cell heterogeneity with One-SENSE

Categorical analysis of human T cell heterogeneity with One-SENSE 1 2 3 4 Supplementary Information Categorical analysis of human T cell heterogeneity with One-SENSE 5 6 Running title: T cell Analysis by One-SENSE 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26

More information

Horizon 2020 Programme. SFS-01b Tackling losses from terrestrial animal diseases

Horizon 2020 Programme. SFS-01b Tackling losses from terrestrial animal diseases Horizon 2020 Programme SFS-01b-2014 Tackling losses from terrestrial animal diseases Strengthening Animal Production and Health through the Immune Response Project ID: 633184 D12.1 Age related innate responses

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Soluble phospho-tau from Alzheimer's disease hippocampus drives. Elisabeth Sanchez-Mejias1,4*, Victoria Navarro2,3,4*, Sebastian Jimenez2,3,4,

Soluble phospho-tau from Alzheimer's disease hippocampus drives. Elisabeth Sanchez-Mejias1,4*, Victoria Navarro2,3,4*, Sebastian Jimenez2,3,4, Soluble phospho-tau from Alzheimer's disease hippocampus drives microglial degeneration Elisabeth Sanchez-Mejias,, Victoria Navarro,,, Sebastian Jimenez,,, Maria Sanchez-Mico,,, Raquel Sanchez-Varo,, Cristina

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Supplementary Material

Supplementary Material Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

MAIT cells are critical for optimal mucosal immune responses during in vivo pulmonary bacterial infection

MAIT cells are critical for optimal mucosal immune responses during in vivo pulmonary bacterial infection MAIT cells are critical for optimal mucosal immune responses during in vivo pulmonary bacterial infection Anda Meierovics, Wei-Jen Chua Yankelevich, and Siobhán C. Cowley 1 Division of Bacterial, Parasitic,

More information

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Involvement of urinary bladder Connexin43 and the circadian clock in the coordination of diurnal micturition rhythm Hiromitsu Negoro, 1,2 Akihiro Kanematsu, 1,3 Masao Doi,

More information

How plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft

How plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft How plasma cells develop Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft 1 Plasma cells develop from activated B cells Toll Like Receptor B Cell Receptor B cell B cell microbia

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Research article Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Chen Wang, 1 Tai Yi, 1 Lingfeng Qin, 2 Roberto A. Maldonado, 3 Ulrich H. von Andrian, 3

More information

The tumor-promoting actions of TNF-α involve TNFR1 and IL-17 in ovarian cancer in mice and humans

The tumor-promoting actions of TNF-α involve TNFR1 and IL-17 in ovarian cancer in mice and humans Research article The tumor-promoting actions of TNF-α involve TNFR1 and IL-17 in ovarian cancer in mice and humans Kellie A. Charles, 1 Hagen Kulbe, 1 Robin Soper, 1 Monica Escorcio-Correia, 1 Toby Lawrence,

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Systemically administered anti-tnf therapy ameliorates functional outcomes after focal cerebral ischemia

Systemically administered anti-tnf therapy ameliorates functional outcomes after focal cerebral ischemia Clausen et al. Journal of Neuroinflammation 2014, 11:203 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Systemically administered anti-tnf therapy ameliorates functional outcomes after focal cerebral

More information

Licensing delineates helper and effector NK cell subsets during viral infection

Licensing delineates helper and effector NK cell subsets during viral infection Licensing delineates helper and effector NK cell subsets during viral infection Anthony E. Zamora, 1 Ethan G. Aguilar, 1 Can M. Sungur, 1 Lam T. Khuat, 1 Cordelia Dunai, 1 G. Raymond Lochhead, 2 Juan Du,

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Interleukin-20 is associated with delayed healing in diabetic wounds

Interleukin-20 is associated with delayed healing in diabetic wounds Interleukin-20 is associated with delayed healing in diabetic wounds Phillip Finley, PhD Integrated and Applied Sciences Program Biology and Statistics/Research Methodology Normal Healing Body s natural

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

qpcr-array Analysis Service

qpcr-array Analysis Service qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model Nader Najafian, 1,2 Tanuja Chitnis, 2,3 Alan D. Salama, 1,2 Bing Zhu, 3 Christina Benou, 3 Xueli Yuan, 1 Michael R. Clarkson, 1

More information

Integrative Physiology. Foxp3 + CD4 + T Cells Improve Healing After Myocardial Infarction by Modulating Monocyte/Macrophage Differentiation

Integrative Physiology. Foxp3 + CD4 + T Cells Improve Healing After Myocardial Infarction by Modulating Monocyte/Macrophage Differentiation Integrative Physiology Foxp3 + CD4 + T Cells Improve Healing After Myocardial Infarction by Modulating Monocyte/Macrophage Differentiation Johannes Weirather,* Ulrich D.W. Hofmann,* Niklas Beyersdorf,*

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich

Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2013 Nitric oxide synthase 2 is required for conversion of pro-fibrogenic inflammatory

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Viral acute lower respiratory infections impair CD8 + T cells through PD-1

Viral acute lower respiratory infections impair CD8 + T cells through PD-1 Research article Viral acute lower respiratory infections impair CD8 + T cells through PD-1 John J. Erickson, 1 Pavlo Gilchuk, 1 Andrew K. Hastings, 1 Sharon J. Tollefson, 2 Monika Johnson, 1 Melissa B.

More information

Antigen-pulsed dendritic cells expressing macrophagederived chemokine elicit Th2 responses and promote specific humoral immunity

Antigen-pulsed dendritic cells expressing macrophagederived chemokine elicit Th2 responses and promote specific humoral immunity Antigen-pulsed dendritic cells expressing macrophagederived chemokine elicit Th2 responses and promote specific humoral immunity Toshiaki Kikuchi 1 and Ronald G. Crystal 1,2 1 Division of Pulmonary and

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Emilie Viennois 1*, Yuan Zhao 1, 2, Moon Kwon Han 1, Bo Xiao 1, 3, Mingzhen Zhang 1,

More information

Mature natural killer cell and lymphoid tissue-inducing cell development requires Id2-mediated suppression of E protein activity.

Mature natural killer cell and lymphoid tissue-inducing cell development requires Id2-mediated suppression of E protein activity. Mature natural killer cell and lymphoid tissue-inducing cell development requires Id2-mediated suppression of E protein activity. Markus D. Boos, Yoshifumi Yokota, Gérard Eberl, B. L. Kee To cite this

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information