Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and
|
|
- Damon Franklin
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTAL MATERIAL Supplemental Methods: Histology of Heart Hearts were fixed in 4% paraformaldehyde (ph 7.4) overnight, embedded in paraffin, and serially sectioned into 5-µm slices. Standard hematoxylin and eosin (HE) staining or immunofluorescence was performed with these slices. Measurement of Myocardial Infarct Size To measure the infarct size, isolated perfused hearts were frozen at -80 C for 10 min and cut into slices (5-6 slices/heart), which were then incubated in a sodium phosphate buffer containing 1 % 2,3,5-triphenyl-tetrazolium chloride for 15 min to visualize the unstained infarcted region. Infarct and left ventricle (LV) areas were determined by planimetry with Image/J software from NIH. The infarct size was calculated as infarct area divided by LV area. To measure the infarct size of rat hearts in vivo, at the end-point, the animals were anesthetized with sodium pentobarbital (50 to 100 mg/kg i.p. to effect) and heparinized (400 USP U/kg, i.p.). The heart was excised and the ascending aorta was cannulated (distal to the sinus of Valsalva), then perfused retrogradely with Alcian blue dye (5 % solution) to visualize the area at risk (AAR). The coronary artery was re-occluded at the site of occlusion before perfusion with Alcian blue solution. The subsequent procedures were the same as those for ex vivo hearts. The infarct size was calculated as infarct area divided by AAR 1. 1
2 Echocardiographic Evaluation of Cardiac Morphology and Function We first trained mice on 2 or 3 separate occasions by picking them up by the nape of the neck and holding them firmly in the palm of one hand in the supine position, with the tail held tightly between the last two fingers. The left hemithorax was shaved, and transthoracic echocardiography was performed using a Doppler echocardiographic system (GE vivid7) equipped with a 13 MHz linear transducer (GE i13l). The heart was first imaged using the two-dimensional mode in the parasternal long-axis and short-axis views. The short-axis views, including papillary muscles, were used to position the M-mode cursor perpendicular to the ventricular septum and LV posterior wall. Images obtained during training sessions were not recorded. Once the mice were acclimated to these procedures, images were stored in digital format on a magnetic optical disk for review and analysis. Measurements of the LV internal end-diastolic diameter (LVIDd) were taken at the time of the apparent maximal LV diastolic dimension, whereas measurements of the LV internal end-systolic diameter (LVIDs) were taken at the time of the most anterior systolic excursion of the posterior wall. LV ejection fraction (EF) was calculated by the cubic method: LVEF (%) = {(LVIDd) 3 - (LVIDs) 3 }/ (LVIDd) 3 100, and LV fraction shortening (FS) was calculated by FS (%) = (LVIDd - LVIDs) / LVIDd 100. The data are averaged from 5 cardiac cycles. PI3K Activity Hearts of or mice were perfused on a Langendorff apparatus with or without IPC (four cycles of 5 min of ischemia followed by 5 min of reperfusion), homogenized and immunoprecipitated with PI3K-p85 antibody (Upstate). Immunoprecipitated enzyme and 2
3 PI(4,5)P2 substrate were incubated for 1 h at room temperature in the reaction buffer. Kinase reaction was stopped by pelleting the beads by centrifugation and transferring the reaction mixture to the incubation plate and incubated overnight at 4 o C with a PI (3,4,5) P3 detector protein, then added to the PI (3,4,5) P3-coated microplate for 1 h for competitive binding. A peroxidase-linked secondary detection reagent and colorimetric detection (absorbance was measured at 450 nm) is used to detect PI (3,4,5) P3 detector protein binding to the plate. The colorimetric signal is inversely proportional to the amount PI (3,4,5) P3 produced by PI3 kinase. Adenoviral Infection, hypoxia and H 2 O 2 treatment of Neonatal Rat Ventricular Myocytes Adenovirus-mediated gene transfer was implemented after cardiomyocytes were cultured for 24 h in serum-free DMEM, then cultured for 48 h in DMEM containing 10% FBS in the presence or absence of an adenoviral vector expressing GFP-MG53 or GFP or MG53-shRNA or a scramble-shrna as previously described 2. In a subset of experiments, cardiomyocytes were subjected to hypoxia conditions. In brief, cells were cultured in RPMI1640 / 5 % FBS for 48 h after adenoviral infection for 24 h. Then, the medium was changed to serum-free RPMI1640 saturated with 95% N 2 /5% CO 2, and cells were placed in a 37 C airtight box saturated with 95% N 2 /5% CO 2 for various period of time. O 2 concentrations were < 0.1 % (Ohmeda oxygen monitor, type 5120). For normoxia controls, culture medium was changed to RPMI1640 / 5% FCS / 10% HS, and cells were placed in a 37 C / 5% CO 2 incubator for 3-24 h before analysis. In another subset of experiments, myocytes were insulted with H 2 O 2 for 24h. 3
4 Real-time PCR The following primer pairs were used for quantitative real-time PCR: 18S RNA, 5 -GGA AGG GCA CCA CCA GGA GT-3 (forward) and 5 -TGC AGC CCC GGA CAT CTA AG-3 (reverse). The primers for MG53 were 5'-CGAGCAGGACCGCACACTT-3' (forward) and 5'-CCAGGAACATCCGCATCTT-3' (reverse). Amplification was performed as follows: 94 C for 30 s and 30 cycles at 94 C for 30 s, 55 C for 30 s, and 72 C for 30 s. The cycle number at which the emission intensity of the sample rose above baseline was referred to as Ct (threshold cycle) and was proportional to target concentration. Data presented are the average of at least 4 independent experiments. Gene silencing through RNA interference The sequence of MG53-shRNA was GAGCTGTCAAGCCTGAACTCT, while the sequences of CaV3 shrna was GACATTCACTGCAAGGAGATA. The sequence of the scramble-shrna was GCCTGCCGTCCAAAGTTGTAA. Adenovirus expressing GFP-MG53 fusion protein was packaged using the Stratagene Adeasy system. Adenoviruses expressing CaV3-shRNA, or the scramble-shrna were generated in HEK293 cells using the BLOCK-iT adenoviral RNAi expression system, according to the manufacturer s protocol (Invitrogen). The efficiency of gene knockdown was assessed by Western blotting and functional studies at 72 h after adenoviral shrna transfection. Co-immunoprecipitation 4
5 Cells were lysed in lysis buffer A (30 mm Hepes (ph7.6), 100 mmnacl, % Nonidet P-40, and protease inhibitors mixture) on ice for 10 min, and the lysates were clarified by centrifugation at 4 C for 10 min at 13,000 rpm. The supernatant was mixed with nprotein A Sepharose TM 4 Fast Flow (GE Healthcare) and the antibody and incubated at 4 C for 2 h. The resins were then washed three times with lysis buffer A, and the bound proteins were detected by Western blotting. Materials Antibodies of p-erk1/2, ERK1/2, p-akt, Akt, p-gsk3β, GSK3, p-stat3, STAT3, COX IV, and GAPDH were from Cell Signaling Technology. The antibodies of β-actin, PKCε and β-tubulin were from Santa Cruz. The antibody of CaV3 was from Abcam. The antibodies of Kir6.2 and Connexin 43 were from Bioworld Technology. The antibody of PKG was from Stressgen. The antibody of p85-pi3k was from Upstate. MG53 antibody was described previously 3. The Akt inhibitor was from Calbiochem (Cat. #: ). Unless indicated otherwise, all chemicals were from Sigma. References: 1. Shen YT, Depre C, Yan L, Park JY, Tian B, Jain K, Chen L, Zhang Y, Kudej RK, Zhao X, Sadoshima J, Vatner DE, Vatner SF. Repetitive ischemia by coronary stenosis induces a novel window of ischemic preconditioning. Circulation. 2008;118: Shen T, Zheng M, Cao C, Chen C, Tang J, Zhang W, Cheng H, Chen KH, Xiao RP. Mitofusin-2 is a major determinant of oxidative stress-mediated heart muscle cell apoptosis. J Biol Chem. 2007;282: Cai C, Masumiya H, Weisleder N, Matsuda N, Nishi M, Hwang M, Ko JK, Lin P, Thornton A, Zhao X, Pan Z, Komazaki S, Brotto M, Takeshima H, Ma J. MG53 5
6 nucleates assembly of cell membrane repair machinery. Nat Cell Biol. 2009;11:
7 Supplemental Figures A. B. MG53 GAPDH Data Supplement Figure I: No morphological differences between wild type () and mice at the age of 2-3 months. (A) Representative immunoblot of MG53 protein levels in myocardial lysates from and mice. (B) HE staining of coronal sections of hearts from and mice.
8 GFP-MG53 MG53 GAPDH Adv-GFP Adv-GFP-MG (m.o.i.) 80 kd 53 kd Data Supplement Figure II : Overexpression of Adv-GFP-MG53 in cardiomyocytes. Representative immunoblot of MG53 and GFP-MG53 protein levels in lysates of cardiomyocytes infected with Adv-GFP and Adv-GFP-MG53 at indicated titers for 24 h (n = 5).
9 A. MTT ** ** Hypoxia Adv-GFP Adv-GFP-MG B. MTT ** ** H 2 O 2 Adv-GFP Adv-GFP-MG C. MTT * ** Hypoxia Scramble-shRNA MG53-shRNA Adv-GFP-MG Data Supplement Figure III: A-C
10 Data Supplement Figure III : Overexpression of MG53 protects cardiomyocyte against hypoxia- and oxidative stress-induced cell death, whereas knockdown of MG53 acerbates cell death. (A) Overexpression of MG53 protects cardiomyocytes against hypoxia-induced cell-death. Cell viability was indexed by MTT assay in cells infected with Adv-GFP or Adv-GFP-MG53 (30 m.o.i.) for 24 h and then subjected to hypoxia for 12 h (n = 12, ** p <1 vs groups in the absence of hypoxia or Adv-GFP-MG53, p <1 vs hypoxia and hypoxia + Adv-GFP). (B) Overexpression of MG53 protects cardiomyocytes against H 2 O 2 -induced cell-death. Cell viability was indexed by MTT assay in cells infected with Adv-GFP or Adv-GFP-MG53 (30 m.o.i.) for 24 h and then subjected to H 2 O 2 (200 μm) treatment for 24 h (n = 12, ** p <1 vs groups in the absence of H 2 O 2 or Adv-GFP-MG53, p <1 vs H 2 O 2 and H 2 O 2 + Adv-GFP). (C) MG53 gene silencing worsens hypoxia-induced cell death (12 h). Cell viability of NVMC in the presence or absence of Adv-MG53, MG53-shRNA or Scramble-shRNA, assayed by MTT (n = 12, * p <5, ** p <1 as indicated).
11 A B PKCε PKG GAPDH GAPDH PKCε/GAPDH PKG/GAPDH C D Mitochondria Kir6.2 Connexin 43 GAPDH Cox IV Kir6.2/GAPDH Connexin 43/Cox IV Data Supplement Figure IV: Expression of PKCε, PKG and Kir6.2 at protein level was not altered in hearts. Representative immunoblots and average data of PKCε (A), PKG (B), Kir6.2 (C) and mitochondria Connexin 43 (D) protein levels in myocardial tissues from and mice (n = 4 for each group).
12 MG53 CaV3 Merged Data Supplement Figure V: Colocalization of MG53 and CaV3. Confocal immunofluorescence costaining to visualize the colocalization of MG53 (red) and CaV3 (green) in an adult cardiomyocyte (scale bar is 10 μm).
13 A. B. PI3K-p85 CaV3 GAPDH GAPDH PI3K-p85 protein (fold of ) CaV3 protein (fold of ) Data Supplement Figure VI: Expression of p85 subunit of PI3K (PI3K-p85) or CaV3 at protein level was not altered in hearts. (A) Representative immunoblots and average data of PI3K-p85 protein levels in myocardial tissues from and mice (n = 4 for each group). (B) Representative immunoblots and average data of CaV3 protein levels in myocardial tissues from and mice (n = 9 for each group).
14 Scramble-shRNA CaV3-shRNA Adv-GFP Adv-MG p-erk ERK 1/2 GFP-MG53 MG53 CaV3 2 Scramble-shRNA CaV3-shRNA * p-erk/erk 1/2 1 0 Adv-GFP Adv-MG53 Data Supplement Figure VII:. Gene silencing CaV3 blocks MG53 overexpression-mediated activation of ERK 1/2. Representative immunoblots and statistical data of phosphorylated and total ERK 1/2 in the lysates of NVMC infected with Adv-GFP or Adv-MG53 (30 m.o.i., 24 h) with or without Adv-CaV3- shrna or Adv-scramble-shRNA (n = 5; * p <5 vs all other three groups).
15 Supplemental Table Data Supplement Table I. Cardiac Function and Morphology Parameters (n = 8) HR LVIDd LVPWd LVIDs LVPWs EF FS HW BW HW/BW (bpm) (mm) (mm) (mm) (mm) (%) (%) (g) (g) (g/kg) 635.6± ±7 0.71±2 1.76±3 1.11± ± ± ± ± ± ± ± ±3 1.61±8 1.11± ± ±7 0.15± ± ±0.40 HR, heart rate. LVID, left ventricle internal diameter. LVPW, left ventricle posterior wall thickness. EF, ejection fraction. FS, fraction shortening. HW, heart weight. BW, body weight. d, diastolic. s, systolic Values are mean ± s.e.m..
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSupplementary Material
Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationSupporting Information
Supporting Information Muraski et al. 10.1073/pnas.0709135105 SI Text Generation of Transgenic Animals. Pim-WT and Pim-DN cdnas were subcloned NheI/SmaI from pegfp-c1 Pim-1 and pegfp-c1 Pim-DN plasmids
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationTcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
More informationSUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
More informationA Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial. Ischemia/Reperfusion Injury
Supporting Information A Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial Ischemia/Reperfusion Injury Xiaotian Sun 1 *, Wenshuo Wang 2, Jing Dai 3, Sheng Jin 4, Jiechun Huang
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationE10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
More informationPretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair
Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Mouse Model of Myocardial Infarction (MI) All animal work was compliant with the Institutional Animal
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationControl. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupporting Information
Supporting Information Kuroda et al. 10.1073/pnas.1002178107 SI Methods Monoclonal Antibodies Against Nox4. Generation of the anti-nox4 mouse monoclonal antibody (3D2), which detects Nox4 and does not
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationNature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationProspect Cardiac Packages. S-Sharp
Prospect Cardiac Packages S-Sharp B mode: Teichholz: Teichholz formula LV Volume 2D: modified Simpson's rule method ALM: area length method LV Volume (Intg.): integral method M mode: Long axis: Teichholz
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More information2. Langendorff Heart
2. Langendorff Heart 2.1. Principle Langendorff heart is one type of isolated perfused heart which is widely used for biochemical, physiological, morphological and pharmacological researches. It provides
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplemental Figure I
Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries
More informationSupplementary Material for
Supplementary Material for Parathyroid Hormone Signaling through Low-density-lipoprotein-related Protein 6 Mei Wan, Chaozhe Yang, Jun Li, Xiangwei Wu, Hongling Yuan, Hairong Ma, Xi He, Shuyi Nie, Chenbei
More informationAppendix II: ECHOCARDIOGRAPHY ANALYSIS
Appendix II: ECHOCARDIOGRAPHY ANALYSIS Two-Dimensional (2D) imaging was performed using the Vivid 7 Advantage cardiovascular ultrasound system (GE Medical Systems, Milwaukee) with a frame rate of 400 frames
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationFetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2.
3562-RG-1 Supplementary Figure 1 Fetal gene upregulation by 1-wk is significantly increased in mice lacking RGS2. ANP(Nppa) /BNP(Nppb) A-type and B-type natriuretic peptide; β-mhc (Myh7) beta myosin heavy
More informationSupplemental Table 1. Echocardiography Control (n=4)
Supplemental Table 1. Echocardiography (n=4) Mlc2v cre/+ ; DNMAML (n=4) LVIDd, mm 3.9±0.3 4.3±0.3 LVIDs, mm 2.6±0.4 2.9±0.2 d, mm 0.72±0.06 0.75±0.1 LVPWd, mm 0.72±0.06 0.77±0.11 FS, % 33±6 33±1 EF, %
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationVelocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography
Velocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography Toshinari Onishi 1, Samir K. Saha 2, Daniel Ludwig 1, Erik B. Schelbert 1, David Schwartzman 1,
More informationB-Mode measurements protocols:
Application Note How to Perform the Most Commonly Used Measurements from the Cardiac Measurements Package associated with Calculations of Cardiac Function using the Vevo Lab Objective The Vevo LAB offline
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationLentiviral vector carrying the murin Apelin precursor gene, 234-bp cdna, (Lenti-Apelin) was
SUPPLEMENTAL METHODS Construction of recombinant lentiviral vectors Lentiviral vector carrying the murin Apelin precursor gene, 234-bp cdna, (Lenti-Apelin) was constructed. The cdna was inserted into the
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationhemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationSupplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow
Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationPRELIMINARY STUDIES OF LEFT VENTRICULAR WALL THICKNESS AND MASS OF NORMOTENSIVE AND HYPERTENSIVE SUBJECTS USING M-MODE ECHOCARDIOGRAPHY
Malaysian Journal of Medical Sciences, Vol. 9, No. 1, January 22 (28-33) ORIGINAL ARTICLE PRELIMINARY STUDIES OF LEFT VENTRICULAR WALL THICKNESS AND MASS OF NORMOTENSIVE AND HYPERTENSIVE SUBJECTS USING
More informationSUPPLEMENTARY MATERIALS. IL-4 as a Repurposed Biological Drug for Myocardial Infarction through. Augmentation of Reparative Cardiac Macrophages:
1 SUPPLEMENTARY MATERIALS IL-4 as a Repurposed Biological Drug for Myocardial Infarction through Augmentation of Reparative Cardiac Macrophages: Proof-of-Concept Data in Mice Yusuke Shintani MD PhD, Tomoya
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationSupplementary Figures and Figure Legends
1 Supplementary Figures and Figure Legends 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Supplementary Figure 1: camp levels in myocytes confirm studies in perfused hearts. (a) Time-resolved camp dynamics (presented
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSupporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationBNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationsupplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSupplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. A B C (A) Schematic representation of the new constructs designed for local camp imaging.
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationSerum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
More informationMCD-microRNA. WU Hong-quan, LIU Di-chuan *, TONG Xin, CAI Min, HUANG Jing. (LVIDd) A [ ] (2012)
MCD-microRNA [ ] A (MCD)-microRNA MCD MCD 4 MCD-microRNA HEK293 PCR MCD mrna 28 + 3 ( + + + + + + ) 7 7 ( + ) MCD-microRNA 4 4d 1 28d (LVEF) (FS) (LVIDd)A PCR 1 MCD mrna82% + + + LVEF FS (P 0.05) (P 0.05)
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationMcAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
More informationNo-reflow Phenomenon in Patients with Acute Myocardial Infarction: Its Pathophysiology and Clinical Implications
No-reflow Phenomenon in Patients with Acute Myocardial Infarction: Its Pathophysiology and Clinical Implications * 164 Ito Acta Med. Okayama Vol. 63, No. 4 Normal case Anterior MI Fig. 3 Myocardial contrast
More informationTable S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
More informationInternational Graduate Research Programme in Cardiovascular Science
1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.
More informationSupplement Material. chain (MLC2v) promoter to generate cardiac-specific MKK4 knockout mice (referred to
Supplement Material Materials and Methods Generation of MKK Mutant Mice The mkk-flox mice (referred to as ) were previously generated and characterised. mice were mated with mice expressing Cre under a
More information