ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL. REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY.

Transcription

1 ONLINE SUPPLEMENT ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY. Enéas R.M. Gomes 1, Aline A. Lara 1, Pedro W.M. Almeida 1, Diogo Guimarães 1, Rodrigo R Resende 2, Maria J. Campagnole-Santos 1, Michael Bader 3, Robson A.S. Santos 1, Silvia Guatimosim 1 1 Department of Physiology and Biophysics, Federal University of Minas Gerais, Belo Horizonte, MG, , Brazil 2 Institute of Learning and Research Santa Casa of BH (IEPSC BH), Belo Horizonte, Brazil 3 Max-Delbrück Center for Molecular Medicine (MDC), Robert-Rössle-Str. 10, D Berlin, Germany Short title: Protective signaling by Ang-(1-7) in cardiomyocytes Address for correspondence Silvia Guatimosim Institute of Biological Sciences Federal University of Minas Gerais Av. Antônio Carlos 6627 Belo Horizonte, MG - CEP: Brazil Phone: (31) , FAX: (31) guatimosim@icb.ufmg.br 1

2 Expanded Materials and Methods Ang II infusion in TG rats A 14-day infusion of Ang II (6 µg/kg/h) or vehicle (0.9% NaCl, 0,5 µl/h) was performed using osmotic minipumps (ALZET, model 2002) implanted subcutaneously in the dorsal region under tribromoethanol anesthesia (2.5%, 1 ml/100 g of body wright), as previously described 1. Systolic Blood Pressure Measurement For monitoring systolic blood pressure (SBP) we performed the current tail-cuff method 2, 3. SBP was measured by the tail-cuff method using a XBP1000 Series Rat Tail Blood Pressure System (Kent Scientific, Torrington, CT). Cardiac and cardiomyocyte hypertrophy measurements To analyze the extension of cardiac hypertrophy we performed a heart weight/tibia length ratio measurement. For cardiomyocyte hypertrophy we measured cellular area in adult ventricular cardiomyocytes or in NRCM stained with anti-α-actinin antibody. Confocal images were analysed using LSM image browser software (Zeiss). DAF- measurents in neonatal cardiomyocytes Measurement of NO production in living NRCM was done using the membrane permeable fluorescent indicator DAF-FM (Molecular Probes) as previously described 4. NO measurements were performed in NRCM treated with peptides for 36 h. 2

3 Cytoplasmic/Nuclear fractionation Adult ventricular myocytes were harvested in ice-cold homogenization RIPA buffer (150 mm NaCl, 0.5% deoxycholate, 1% Triton X-100, 1: 300 Sigma protease inhibitor cocktail and 50 mm Tris-HCl at ph 7.4). The homogenate was centrifuged at 100 g for 5 min (4 C). The resulting supernatant was centrifuged again at 600 g for 5 min (4 C) to obtain the nuclear pellet and the cytoplasmic extract (supernatant). The pellet was incubated with RIPA buffer containing 0.3% SDS and DNAse (1 mg ml 1 ) for 30 min (4 C) and then centrifuged at 2000 g for 10 min (4 C) to obtain the nuclear extract (supernatant), as previously described 5. Purity of cytosolic and nuclear cell fractions was assessed with anti-gapdh and anti-histone 3 antibodies. GAPDH was found only in the cytosolic fraction whereas histone-3 was found only in the nuclear extract. Western blot Adult ventricular myocytes were harvested as described above and protein content was quantified according to Bradford protein assay µg of protein were separated by SDS-PAGE. Antibodies and their sources are as follows: anti-nfatc3 1:1000 (Santa Cruz BioTech), anti-gsk3β 1:1000 and anti-phospho (Ser 9) GsK3β 1:1000 (Cell Signaling), CaMKII 1:1000 (SAB), phospho-camkii 1:1000 (Millipore), anti-histone-3 1:1000 (Cell Signaling), and anti-gapdh 1:5000 (Clontech). Immunodetection was carried out using enhanced chemiluminescence (Amersham Biosciences). Protein levels were expressed as a ratio of optical densities. Quantitative Real time PCR 3

4 Total RNA was extracted from isolated ventricular cardiomyocytes using Trizol (Invitrogen, São Paulo, Brazil). For quantitative PCR (qpcr), total RNA was treated with DNase I (Ambion, Austin, TX, USA) and first strand cdna was synthesized using High Capacity cdna Transcription Kit (Applied Biosystems, CA, USA) according to manufacturer s instructions. After reverse transcription, the cdna was subjected to qpcr on a 7500 Real Time PCR System (Applied Biosystems, CA, USA) using Power SYBR Green PCR Master Mix (Applied Biosystems, CA, USA). Relative quantification of gene expression was done with the 2 - Ct method using the beta actin gene expression to normalize the data. Primers used were: ANF FW: 5 - GGATTTCAAGAACCTGCTAGA -3 and RE 5 - CTTCATCGGTCTGCTCGCTCA - 3 ; BNP FW 5 - CTCTGGGACCACCTCTCAAG -3 ND RE 5 - ACACTGTGGCAAGTTTGTGC -3 ; β-mhc FW 5 - CCTCGCAATATCAAGGGAAA -3 and RE 5 - TACAGGTGCATCAGCTCCAG -3. TGF-β FW 5 - GAAGCCATCCGTGGCCAGAT-3 and RE 5 - CCAGTGACGTCAAAAGACAG-3. Immunofluorescence Cardiomyocytes were fixed in PFA 4% and permeabilized with Triton X %. Antibodies and their sources were as follow: anti-nfatc3 (Santa Cruz BioTech), anti-α-actinin (Sigma). Anti-rabbit and anti-mouse antibodies conjugated to Alexa-488 and Alexa-633 (Molecular Probes) were used at a dilution of 1:1000, nuclear staining was performed with 4,6-Diamidino-2-Phenylindole (DAPI) 1:50, as previously described 7. 4

5 Reagents The peptides angiotensin-(1-7), A-779, and angiotensin II were from Bachem. Unless specified, other reagents were obtained from Sigma Chemical Corp. 5

6 References 1. da Silva LM, Nardoni Goncalves BA, Roberto da SJ, ugusto Souza Dos SR. Altered cardiovascular responses to chronic angiotensin II infusion in aged rats. Regul Pept. 2005;132: Krege JH, Hodgin JB, Hagaman JR, Smithies O. A noninvasive computerized tailcuff system for measuring blood pressure in mice. Hypertension. 1995;25: Whitesall SE, Hoff JB, Vollmer AP, D'Alecy LG. Comparison of simultaneous measurement of mouse systolic arterial blood pressure by radiotelemetry and tail-cuff methods. Am J Physiol Heart Circ Physiol. 2004;286:H2408-H Dias-Peixoto MF, Santos RA, Gomes ER, Alves MN, Almeida PW, Greco L, Rosa M, Fauler B, Bader M, Alenina N, Guatimosim S. Molecular mechanisms involved in the angiotensin-(1-7)/mas signaling pathway in cardiomyocytes. Hypertension. 2008;52: Oliveira RS, Ferreira JC, Gomes ER, Paixao NA, Rolim NP, Medeiros A, Guatimosim S, Brum PC. Cardiac anti-remodelling effect of aerobic training is associated with a reduction in the calcineurin/nfat signalling pathway in heart failure mice. J Physiol. 2009;587:

7 6. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72: Guatimosim S, Amaya MJ, Guerra MT, Aguiar CJ, Goes AM, Gomez-Viquez NL, Rodrigues MA, Gomes DA, Martins-Cruz J, Lederer WJ, Leite MF. Nuclear Ca2+ regulates cardiomyocyte function. Cell Calcium. 2008;44:

8 Supplemental Figures Supplemental Figure 1: Ang II induced cardiomyocyte hypertrophy is prevented in TGR rats. A. Representative immunofluorescence images of cardiomyocytes stained with antiα-actinin. B. Bar graph show averaged-cardiomyocyte area for ventricular cardiomyocytes from SD and TG rats treated or not with Ang II. n= number of cardiomyocytes analysed. *p< 0.05 when compared to other groups. Bar=10 µm. 8

9 Supplemental Figure 2: Overexpression of Ang-(1-7) in TG rats prevents TGF-β upregulation on Ang-II stimulation. TGF-β mrna levels were measured by real-time PCR. n= data from at least 4 independent experiments.*p< 0.05 when compared to SD group, #p< 0.05 when compared to TG group. 9

10 Supplemental Figure 3: Ang-(1-7) stimulates NO release in NRCM. A. Representative confocal images showing DAF-loaded untreated control (left panel), treated with Ang- (1-7) (middle panel) or with Ang-(1-7) and Ang II (right panel). Bar= 10µm. B. Bar graph shows significant increase in DAF fluorescence in NRCM following treatment with Ang-(1-7) for 36h. Treatment of NRCM with Ang-(1-7) and Ang II also resulted in significant NO production when compared to untreated cardiomyocytes. n= number of cardiomyocytes analysed. *p<0.05 when compared to control cells, and #p< 0.05 when compared to Ang-(1-7) treated cells. 10