Mouse model of human Barth syndrome
|
|
|
- Giles French
- 6 years ago
- Views:
Transcription
1 Mouse model of human Barth syndrome Zaza Khuchua, PhD Cincinnati Children s Research Foundation Cincinnati, OH, USA Barry J. Byrne, MD, PhD University of Florida Department of Pediatrics Gainesville, FL, USA
2 Background Barth (BTHS) syndrome is X linked genetic disorder. Common symptoms include: Cardiomyopathy Skeletal myopathy Neutropenia 3 methylglutaconic aciduria BTHS caused by mutations in tafazzin (taz) gene. Taz gene is located on Xq28. Taz encodes mitochondrial acyltransferase. Mutations in taz gene cause cardiolipin deficiency. Cardiolipin is mitochondrial phospholipid and constitutes about 20% of inner mitochondrial membrane.
3 MODELS OF TAFAZZIN DEFICIENCY Yeast; Drosophila; Zebrafish; Various cell cultures. Urgent need for mouse model of Barth syndrome Several floxed alleles of taz have been generated in mouse ES cells; Problems lay with germline transmission of floxed taz allele. 3
4 Tafazzin tet on shrna transgenic mice were generated by TaconicArtemis in Work was initiated and funded by Barth Syndrome Foundation ( Mice available from Jackson Laboratory: Gt(ROSA)26Sor<tm37(H1/tetO RNAi:Taz)Arte
5 RECOMBINASE MEDIATED CASSETE EXCHANGE ROSA 26 (RMCE) ATG F3 FRT ZsGreen- Exon 1 SA pa Hyg R FLPe Exon 2 site specific recombination by FLPe Neo R H1-tet0-shRNA:taz exchange vector tet-r Resulted locus ATG Exon 1 SA Neo R H1-tet0-shRNA:taz tet-r Exon 2 5
6 Taz RNA R tet H1-tet0-shRNA:taz shrna Taz 6
7 Dox R tet shrna Taz RNA H1-tet0-shRNA:taz Taz 7
8 Important Questions: 1. How efficient is shrna mediated silencing in different tissues? 2. How tight is regulation by Dox? 3. What are side effects of chronic Dox administration? 4. Is it reversible?
9 Induction of Taz knockdown Doxycycline was administered with rodent chow, formulated by Purina Mills (625 mg / kg) 5 days 0 4 days Dox Dox WT X Taz shrna Tg Dox 9
10 Taz silencing WT + Dox TG Dox TG + Dox 10
11 Un silencing WT + Dox TG Dox TG + Dox TG +/ Dox 1 M TG +/ Dox 2½ M 11
12 Cardiolipin analysis Acehan et al. JBC 2010 (in press) 12
13 CARDIOLIPIN IN HEART AND MUSCLE NTG Taz KD Acehan et al. JBC 2010 (in press) 13
14 CARDIOLIPIN IN HEART AND MUSCLE NTG Taz KD 4x(18:2) 14
15 MLCLs IN HEART AND MUSCLE NTG Taz KD 15
16 CARDIAC MRI Acehan et al. JBC 2010 (in press) 16
17 ECHOCARDIOGRAPHY (8M) NTG Taz KD Acehan et al. JBC
18 LOSS OF TAZ ALTERS CARDIAC PARAMETERS Wall thickness and LV wall mass mm M mm 0.8 IVS;d 0.7 P=0.06 * M 2M LVPW * n = 3 8M µl LV mass * * 60 2M 8M NTG Taz knockdown 18
19 CONTROL HEART TAFAZZIN KNOCKDOWN HEART Acehan et al. JBC
20 20
21 TAFAZZIN KNOCKDOWN SKELETAL MUSCLE Acehan et al. JBC
22 Questions Answered: 1. How efficient is shrna mediated silencing? An shrna mediated silencing of taz is very efficient in heart, muscle, liver and brain 2. How tight is regulation by Dox? Dox very efficiently controls shrna expression in heart, skeletal muscle and liver. In brain control is less tight and we observed ~35% reduction of taz mrna level. 3. What are side effects of chronic Dox administration? We didn t find any adverse effects of prolonged dox administration in control animals. 4. Is it reversible? We found that withdrawal from dox restores taz level to 75 90% of normal in 2.5 months.
23 Impact of Cardiolipin on IMM Claypool et al. 2008
24 Dox shrna induction causes significant TAZ knockdown RQ * * TAZKD CON * TAZKD CON TAZKD CON TAZKD * CON N=4 Cardiac TA Liver Brain Soustek et al., HGT, 2011
25 TAZKD Results in Impaired Contractility in the Soleus Force (N/cm 2 ) * * CON TAZKD 0 Tw Frequency (Hz) Soustek et al., HGT, 2011
26 TAZKD Results in Reduced Cardiac Function Ejection Fraction (%) * * CON TAZKD Age (mths) Soustek et al., HGT, 2011
27 Transduction of ptr Myc TAZ FL in HEK293 Cells 33KDa HEK 293 UF11 GFP Myc TAZ FL 15 μg Western Blot : C Myc Antibody (1:200)
28 Acknowledgements University of Florida Meghan Soustek Al Lewin Cathryn Mah Denise Cloutier Darien Falk Supported by NIH/NHLBI, NIDDK, NCRR, Barth Syndrome Foundation, Muscular Dystrophy Association and the University of Florida.
Evaluation of cardiolipin nanodisks as lipid replacement therapy for Barth syndrome
Available online at www.jbr-pub.org Open Access at PubMed Central The Journal of Biomedical Research, 2018 32(2): 107 112 Original Article Evaluation of cardiolipin nanodisks as lipid replacement therapy
Abnormalities of Intermediary Metabolism in Barth Syndrome
Abnormalities of Intermediary Metabolism in Barth Syndrome Richard I. Kelley, M.D., Ph.D. Kennedy Krieger Institute Department of Pediatrics Johns Hopkins University Is Barth Syndrome a Mitochondrial Disease?
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Treatment Strategies for a Complex
Treatment Strategies for a Complex Neuromuscular Disease: The Pompe Story Barry J. Byrne, MD, PhD Pediatrics and Powell Gene Therapy Center University of Florida, College of Medicine 2 4 Initial Presentation
SUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Loss of protein association causes cardiolipin degradation in Barth syndrome
SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
Barth syndrome: A life-threatening disorder caused by abnormal cardiolipin remodeling
www.rarediseasesjournal.com Journal of Rare Diseases Research & Treatment Mini-review Open Access Barth syndrome: A life-threatening disorder caused by abnormal cardiolipin remodeling Vaishnavi Raja, Christian
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Central insulin action regulates peripheral glucose and fat metabolism in mice
Research article Central insulin action regulates peripheral glucose and fat metabolism in mice Linda Koch, 1 F. Thomas Wunderlich, 1 Jost Seibler, 2 A. Christine Könner, 1 Brigitte Hampel, 1 Sigrid Irlenbusch,
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
Cardiac-specific succinate dehydrogenase deficiency in Barth syndrome
Research Article Cardiac-specific succinate dehydrogenase deficiency in Barth syndrome Jan Dudek 1, I-Fen Cheng 1,2, Arpita Chowdhury 1, Katharina Wozny 3, Martina Balleininger 1, Robert Reinhold 1, Silke
E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
Engineering Microphysiological Systems for Human Cardiac Disease Modeling
Engineering Microphysiological Systems for Human Cardiac Disease Modeling Megan L. McCain, PhD Chonette Early Career Chair Assistant Professor of Biomedical Engineering and Stem Cell Biology and Regenerative
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Eremina V, Jefferson JA, Kowalewska J, et al. VEGF inhibition
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Overview of the transplant procedure and supplementary data to Figure 1. a. Under isofluorane anesthesia, the lumen of the colon is washed by a gentle PBS enema. b. Using a p200
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
Linoleic acid supplemention of Barth syndrome fibroblasts restores cardiolipin levels: implications for treatment
Linoleic acid supplemention of Barth syndrome fibroblasts restores cardiolipin levels: implications for treatment F. Valianpour, R. J. A. Wanders, 1 H. Overmars, F. M. Vaz, P. G. Barth, and A. H. van Gennip
Paula Clemens NS-065/NCNP-01 Study Chair
A Phase II, Dose Finding Study to Assess the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of NS-065/NCNP-01 in Boys with Duchenne Muscular Dystrophy (DMD) Paula Clemens NS-065/NCNP-01 Study
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Generating Mouse Models of Pancreatic Cancer
Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
A NOVEL INTRONIC SPLICE SITE TAFAZZIN GENE MUTATION DETECTED PRENATALLY IN A FAMILY WITH BARTH SYNDROME
19 (2), 2016 95-100 DOI: 10.1515/bjmg-2016-0043 CASE REPORT A NOVEL INTRONIC SPLICE SITE TAFAZZIN GENE MUTATION DETECTED PRENATALLY IN A FAMILY WITH BARTH SYNDROME Bakšienė M 1,2*, Benušienė E 1,2, Morkūnienė
Mitochondria play an essential role in energy production,
Integrative Physiology A Zebrafish Model of Human Barth Syndrome Reveals the Essential Role of Tafazzin in Cardiac Development and Function Zaza Khuchua, Zou Yue, Lorene Batts, Arnold W. Strauss Abstract
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Yokohama City University School of Medicine Susumu Minamisawa (
Yokohama City University School of Medicine Susumu Minamisawa ( skeletal muscle cardiac muscle mitochondria Sarcoplasmic reticulum mitochondria I A T-tubule SR Free Ca 2+ T-tubule SR Opi. The Heart, 3rd
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
CHAPTER 1 INTRODUCTION
1 CHAPTER 1 INTRODUCTION 1.1. BACKGROUND Fragile X mental retardation 1 gene (FMR1) is located on the X chromosome and is responsible for producing the fragile X mental retardation protein (FMRP) which
Role of calcium-independent phospholipase A 2 in the pathogenesis of Barth syndrome
Role of calcium-independent phospholipase A 2 in the pathogenesis of Barth syndrome Ashim Malhotra a, Irit Edelman-Novemsky b, Yang Xu a, Heide Plesken b, Jinping Ma b, Michael Schlame a,b, and Mindong
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Transgenic Mice and Genetargeting
Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Gene therapy for Oculopharyngeal Muscular Dystrophy. Alberto Malerba
Gene therapy for Oculopharyngeal Muscular Dystrophy Alberto Malerba World muscle society annual conference 06-10-2017 OPMD: Oculopharyngeal Oculopharyngeal Muscular muscular Dystrophy dystrophy (OPMD)
Muscular Dystrophy. Biol 405 Molecular Medicine
Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
Erythropoietin preserves the endothelial differentiation potential of cardiac progenitor cells and attenuates heart failure during anti-cancer therapy
Erythropoietin preserves the endothelial differentiation potential of cardiac progenitor cells and attenuates heart failure during anti-cancer therapy Melanie Hoch Cardiology & Angiology MHH, Hannover
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
Induction of myocardial regeneration to attenuate cardiotoxicity
Induction of myocardial regeneration to attenuate cardiotoxicity Denise Hilfiker-Kleiner Kardiologie & Angiologie MHH, Hannover I have nothing to declare. Situations where hearts are prone to develop failure
doi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Exon skipping in a DCM mouse model mimicking a human mutation in titin
Exon skipping in a DCM mouse model mimicking a human mutation in titin Dr. Michael Gramlich Department of Cardiology, University of Tuebingen, Germany I do not have a financial interest/arrangement or
The X-Linked Gene G4.5 Is Responsible for Different Infantile Dilated Cardiomyopathies
Am. J. Hum. Genet. 61:862 867, 1997 The X-Linked Gene G4.5 Is Responsible for Different Infantile Dilated Cardiomyopathies Patrizia D Adamo, 1 Lucia Fassone, 1 Agi Gedeon, 2 Emiel A. M. Janssen, 3 Silvia
Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF
PRESENT
SYSU-CHINA@iGEM PRESENT ipscs SafeGuard Fang Yiming He Dawei Zhao Yuchen Chen Haoqi Sun Mengyi Possibility of Regeneration 3 Promising Prospect in Medical Application 4 (http://www2.estrellamountain.edu/)
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Transient cold shock enhances zinc-finger nuclease mediated gene disruption
nature methods Transient cold shock enhances zincfinger nuclease mediated gene disruption Yannick Doyon, Vivian M Choi, Danny Xia, Thuy D Vo, Philip D Gregory & Michael C Holmes Supplementary figures and
Dysfunctional Cardiac Mitochondrial Bioenergetic, Lipidomic, and Signaling in a Murine Model of Barth Syndrome*
Dysfunctional Cardiac Mitochondrial Bioenergetic, Lipidomic, and Signaling in a Murine Model of Barth Syndrome* Michael A. Kiebish 1,5, Kui Yang 1, Xinping Liu 1, David J. Mancuso 1, Shaoping Guan 1, Zhongdan
Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
The Beauty of the Skin
The Beauty of the Skin Rose-Anne Romano, Ph.D Assistant Professor Department of Oral Biology School of Dental Medicine State University of New York at Buffalo The Big Question How do approximately 50 trillion
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
International Graduate Research Programme in Cardiovascular Science
1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
CAP-1002: Cardiosphere-Derived Cells PPMD s 2018 End Duchenne Tour St. Paul, MN. 1 Capricor, Inc. PPMD s 2018 End Duchenne Tour April 2018
CAP-1002: Cardiosphere-Derived Cells PPMD s 2018 End Duchenne Tour St. Paul, MN NASDAQ: CAPR 1 Capricor, Inc. PPMD s 2018 End Duchenne Tour April 2018 April 2018 Forward-Looking Statements Statements in
SUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
Capricor Therapeutics. NASDAQ: CAPR October 2017
Capricor Therapeutics NASDAQ: CAPR October 2017 Forward-Looking Statements Statements in this presentation regarding the efficacy, safety, and intended utilization of Capricor's product candidates; the
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow
Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Effects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
Supplementary Information. Mitochondrial electron transport chain and biogenesis * *
MitoNEET-driven alterations in adipocyte mitochondrial activity reveal a crucial adaptive process that preserves insulin sensitivity in obesity Christine M. Kusminski, William L. Holland, Kai Sun, Jiyoung
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Cardiac Health in Duchenne: What we are Learning from Cardiac MRI
Cardiac Health in Duchenne: What we are Learning from Cardiac MRI 24 th Annual Duchenne Connect Conference Parent Project Muscular Dystrophy Scottsdale, AZ June 29, 2018 Kan N. Hor, MD Director of Cardiac