Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow
|
|
|
- Elinor Welch
- 6 years ago
- Views:
Transcription
1 Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic heart rate conditions were retrieved from and plotted for a number of rat strains relevant to our studies: Brown Norway (BN), Fawn Hooded Hypertensive (FHH), Spontaneously Hypertensive (SHR), Salt Sensitive (SS) and Wistar Kyoto (WKY). n>10 per genotype; see also at ANOVA with post-hoc Tukey: **, P<0.01; ***, P<0.001.
2 a basal maximum coronary flow vs systolic blood pressure ml/g/min b mmhg cor=0.1, P=0.191 basal maximum Coronary flow vs diastolic blood pressure ml/g/min c mmhg cor=0.07, P=0.36 basal maximum Coronary flow vs left ventricle relaxation ml/g/min mmhg/s cor= 0.34, P=4.6e 06 Supplementary Fig. 2. Correlation of maximal coronary flow (CF) with systolic blood pressure (a), diastolic blood pressure (b) and left ventricular relaxation (c) across the F2 rat population (n=172). CF indexed to heart weight is shown on the Y axis. X-axes: a, systolic blood pressure (mmhg); b, diastolic blood pressure (mmhg); c) rate of change of LV pressure during diastole (mmhg/s).
3 a b ml/g/min SHR SHR/ /BN BN Supplementary Fig. 3. Coronary flow and myocyte area by parental rat genotype at the 2q34 locus (peak SNP, Chr 2: 191,677,064 bp) in the F2 population. SHR, homozygous for SHR genotype; SHR/BN, heterozygous for SHR and BN genotypes; ; BN, homozygous for BN genotypee (n=172 in total, n >30 per genotype). b, n=7, one-way ANOVA, no significant difference.
4 Supplementary Fig. 4. Mapping of blood pressure indices and of heart weight indexed to body weight to the genome using in the F2 intercross (n=172). Rat autosomes are listed on the x-axis and the y-axis shows the posterior probability for an association at a locus. None of these indices mapped to the CF locus on chromosome 2.
5 Ctss mutation in SHR rat Chr2: , G>T position 751 of the transcript ENSRNOT (ensembl version 59): glycine > cysteine at amino acid 251 of rat Ctss. BN Rat -KEAVATKGPVSVGIDDASHSSFFLYQSGVY- SHR RAT -KEAVATKGPVSVCIDDASHSSFFLYQSGVY- Human -KEAVANKGPVSVGVD-ARHPSFFLYRSGVY- Mouse -KEAVATKGPVSVGID-ASHSSFFFYKSGVY- Dog -KEAVANKGPVSVAID-ASHYSFFLYRSGVY- Chicken -KDAVANVGPVSVAID-ATQPTFFLYRSGVY- ZFish -KQAVASVGPISVAID-ATRPQFVLYHSGVY- Supplementary Fig. 5. Protein variation in SHR rat Ctss gene. There is a G>T variant at position 751 of the rat Ctss transcript which is predicted to be damaging and is conserved between rat, human and mouse but not between rat, dog, chicken or zebrafish (ZFish). The Ctss gene, is expressed most highly in B cells and monocytes: see also at
6 Supplementary Fig. 6. Sub-cellular localization of wild type and L53F mutant WARS2 and expression of Wars2 protein across rat tissues. a) Confocal microscopy localization of wild type (WT) WARS2 and L53F mutant WARS2 (L53F) to the mitochondria. HUVEC cells weree transfected with either WT WARS2 or WARS2(L53F) conjugated to GFP. Scale bar=20μm. Colocalisation of WT and L53F WARS2 to the mitochondria was shown by counter-staining with the mitochondrial protein COX4. b) Immunoblot of Wars22 and Tom20 (mitochondria) expression in cell lines (lanes 1 and 2) and across rat tissues (laness 3-14). 1, HEK cells + vector; 2, HEK cells + Flag-WARS2 (red arrow); 3, brain; 4, heart; 5, kidney; 6, liver; 7, lung; 8, pancreas; 9, soleus muscle; 10, quadriceps muscle; 11, ntestine; 12,, spleen; 13,, testis; 14, ovary. And see php?hpm_id=10352.
7 Supplementary Fig. 7. WARS2 and WARS2(L53F) protein isoforms and WARS, WARS2 and WARS2(L53F) enzyme activity (c). a and b, WARS2(L53F) mutant protein consistently exhibits a greater proportion of the faster migrating bandd (a), which can be observed following a dephosphorylation event. Incubation of WARS2 wild typee (WT) or L53F mutant (both Flag tagged) with calf-intestinal alkaline phosphatase (CIP) did not induce a band shift as compared to incubation with bovine serum albumin (BSA). In contrast phosphorylated FLAG-Spry2 protein shows a clear band shift following dephosphorylation byy CIP. Hencee the WARS2 isoform with the slower migration does not represent a phosphorylation event. The lower isoform was found in greater abundance in the mitochondria (data not shown). c, In vitro enzyme assay of canonical ARS enzyme activity for WARS, WARS2 and WARS2(L53F). n=3, one-way ANOVA with Tukey's multiple comparisons test. ***, P <0.001; *, P <0.05.
8 Supplementary Fig. 8. Expression of WARS2, HARS22 and LARS2, cell morphology and number after gene silencing using sirnas in endothelial cells. a, Relative WARS2, HARS2 and LARS2 gene expression in endothelial cells (ECs) after siwars2 (siw2), sihars2 (sih2), silars2 or sinon-targeting (sint) (n=3 per condition, t-test). b, EC morphology after sint, siw2, sih2 and sil2 treatment. Scale bar = 200 μm. c, Relativee cell number after sint, sih2 and sil2 treatment. n=3, one-way ANOVAA with Tukey's multiple comparisonss test. **, P< 0.01; ***, P<0.001
9 Supplementary Fig. 9. Expression of wars2 in zebrafish and its knockdownn by morpholinos. Western blot of 5dpf zebrafish whole body lysates in control samples (1) and in fish with morpholino-mediatedd wars2 knockdown (lane 2: 0.25 ngg morpholino, lane 3: 0.5 ng morpholino, and lane 4: 1 ng morpholino).
10 Supplementary Fig. 10. Gross phenotype of wars2 MO injected embryos at 24 and 48 hours post fertilization. wars2 knockdown has very little effect on gross morphology at 24 hpf, but at 48 hpf gross defects including cardiacc edema andd a curved body axis become evident, dependent on the wars2 MO dose. Scale bar=1 mm.
11 Percent survival 100 wars2 MO 1 ng 80 wars2 MO 1 ng + Tg(ubi:gal4,UAS:Hsa.WARS2) 60 Control Time (dpf) *** Supplementary Fig. 11. Expression of transgenic WARS2 rescues death of zebrafish with knockdown of wars2. Survival of zebrafish embryos expressing the Gal4 transcription activator under control of the ubiquitin (ubi) promoter injected with wars2 morpholino (1 ng) with or without a transgenic construct encoding human WARS2 under control of the upstream activating sequence (UAS) enhancer. Only zebrafish with strong expression of the α- crystallin:yfp marker (indicating successful incorporation of the WARS2 transgene) and green fluorescent hearts (marker for the ubi:gal4 genotype) were included for analysis in the wars2 MO 1 ng + Tg(ubi:gal4, UAS:Has.WARS2) group. N=42 for wars2 MO 1ng, 8 for wars2 MO 1ng + Tg(ubi:gal4m UAS:Has.WARS2), and 30 for the Control group. ***: P< by Log-Rank (Mantel-Cox) test.
12 Supplementary Fig. 12. Prevalence and spatial distribution of vascular defects in embryos injected with different doses of the wars2 morpholino. The vasculature of Tg(flk:GFP) embryos was systematically scored for vascular defects at 48 hpf, and the location was noted as the number of the somite (counting from the head) where the defect was observed. a-b: ***: P<0.001 vs control by Bonferroni post-test after r one-way ANOVA. N=27-35 embryos per group. c-d: N=15-19 embryos per group.
13 Supplementary Fig. 13. Optical slices of hearts from 4dpf Tg(myl7:GFP;flk:dsRed) zebrafish embryos. Embryos challenged with 1 ng of the wars2 morpholino showed a clear separation (arrows) of the endocardium (red) and myocardium (green). A: atrium, O: outflow tract, V: ventricle. Scale bar=30μm.
14 Supplementary Fig. 14. Confocal images optically sectioned at a depth of 2 µm into the wall of isolated hearts of 4dpf Tg(myl7:GFP;flk:dsRed) zebrafish embryos. In control embryos there are numerous infiltrations of endothelial cells (red) interspersed between myocardial (green) trabeculae (arrowheads), which are almost completely absent in hearts lacking Wars2. Blue: Hoechst staining. A: atrium, O: outflow tract, V: ventricle. Scale bar=50μm.
15 Supplementary Fig. 15. Genotyping of Wars2 in germline targeted rats and Wars2 expression levels by genotype. (a) Genotyping of thee 8bp deletion in wild type BN(Wars22 +/+ ) -/+ and heterozygous gene targeted BN(Wars2 ) rats. Lane e 1, homozygous wildtype Wars2 +/+ ; lanes 2-6, heterozygous Wars2 -/ + ; Lane 7, marker (50bp, 100bp and 150bp). (b) gene expression of Wars2 in the heart of BN(Wars2 +/+ ), F1(Wars2 -/+ ), F1(Wars2 -/L53F ) and SHR (Wars2 L5 53F/L53F ) rats. n=3, one-way ANOVA with Tukey'ss multiple comparisons test. **, P<0.01; ***, P<
16 a b +/L53F -/L53F +/L53 3F -/L53F Supplementary Fig. 16. Inhibition of Wars2 causes diminished capillary density and complexity in the rat. a, Capillary density on whole mount short axis section (showed in number of capillaries per mm 2 ) in F1 rats (n= =5/genotype). b, Capillary complexity (quantified by fractal dimension analysis) in F1 rats (n=5 rats/genotype). t-test. **, P<0.01; ****, P<0.0001;
17 sint siw2 Supplementary Fig. 17. Live dead assay in HUVEC. HUVEC cells were treated with sirna that was non targetting (NT) or against WARS2 (siw2) and cells were harvested 72 h post transfection for flow cytometry analysis by labeling with Image-iT DEAD Green viability stain. With knock-down of WARS2 there was a right shift indicating a higher percentage of dead cells in accordance with the data using a different assay of cell death (main text, Fig. 4). The experiment was repeated with similar results.
18 Supplementary Fig. 18. Original uncropped blots. a,, Figure 1i (WARS2). b, Figure 1i (GAPDH). c, Figure 4d. Top left, FLAG-WARS2, IP: Cox11; top right, FLAG-WARS2, WCL; bottom, Cox11, IP: Cox11.
19 +/L53F (n=7) -/L53F (n=13) p-value EF (%) 76.3 ± ± LVIDed (mm) 6.7 ± ± LVIDes (mm) 3.3 ± ± AWTed (mm) 2 ± ± AWTes (mm) 3.1 ± ± PLVWed (mm) 1.8 ± ± PLVWes (mm) 3.0 ± ± Supplementary Table 1. Echocardiographic data in F1(Wars2(+/L53F)) and F1(Wars2(- /L53F)) rats. Left ventricular internal diameter, LVID; anterior wall thickness, AWT; posterior left ventricular wall thickness, PLVW; end diastole, ed; end systole, es.
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
tom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom
a 24hpf c 48hpf d e 60hpf f g 72hpf h i j k ISV ISV Figure 1. Vascular integrity defects and endothelial regression in mutant emryos. (a,c,e,g,i) Bright-field and (,d,f,h,j) corresponding fluorescent micrographs
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
SUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
SUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
Expanded View Figures
MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation
The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation Anita Becker-Heck#, Irene Zohn#, Noriko Okabe#, Andrew Pollock#, Kari Baker Lenhart,
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary information
Supplementary information 1 Supplementary Figure 1. CALM regulates autophagy. (a). Quantification of LC3 levels in the experiment described in Figure 1A. Data are mean +/- SD (n > 3 experiments for each
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
SUPPLEMENTARY INFORMATION
Supplementary Information included with Nature MS 2008-02-01484B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Fetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2.
3562-RG-1 Supplementary Figure 1 Fetal gene upregulation by 1-wk is significantly increased in mice lacking RGS2. ANP(Nppa) /BNP(Nppb) A-type and B-type natriuretic peptide; β-mhc (Myh7) beta myosin heavy
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10353 Supplementary Figure 1. Mutations of UBQLN2 in patients with ALS and ALS/dementia. (a) A mutation, c.1489c>t (p.p497s), was identified in F#9975. The pedigree is shown on the left
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. A B C (A) Schematic representation of the new constructs designed for local camp imaging.
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Transient cold shock enhances zinc-finger nuclease mediated gene disruption
nature methods Transient cold shock enhances zincfinger nuclease mediated gene disruption Yannick Doyon, Vivian M Choi, Danny Xia, Thuy D Vo, Philip D Gregory & Michael C Holmes Supplementary figures and
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Figure 1. c Human
Supplementary Figure 1 a b c Human Mouse d Gapdh Amino acid sequence and baseline expression of MYDGF N-terminal signal peptides (S-scores) and signal peptide cleavage sites (C-scores) of (a) human MYDGF
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
WDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity
Manuscript EMBO-2010-76298 Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Yuki Fujita, Shota Endo, Toshiyuki Takai and Toshihide Yamashita Corresponding author: Toshihide
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
supplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
Supplemental Figures Legends and Supplemental Figures. for. pirna-guided slicing of transposon transcripts enforces their transcriptional
Supplemental Figures Legends and Supplemental Figures for pirn-guided slicing of transposon transcripts enforces their transcriptional silencing via specifying the nuclear pirn repertoire Kirsten-ndré
Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,