The subcortical maternal complex controls symmetric division of mouse zygotes by

Size: px
Start display at page:

Download "The subcortical maternal complex controls symmetric division of mouse zygotes by"

Transcription

1 The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1, Yingchun Ou-Yang 1, Zhen-Bo Wang 1, Ping Zheng 3, Min-Sheng Zhu 4, Haibin Wang 1, Qing-Yuan Sun 1, Jurrien Dean 5,6, Lei Li 1,6 1 State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing , China. 2 University of Chinese Academy of Sciences, Beijing , China. 3 State Key laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan , China. 4 Model Animal Research Center and MOE Key Laboratory of Model Animal for Disease Study, Nanjing University, Nanjing , China. 5 Laboratory of Cellular and Developmental Biology, NIDDK, National Institutes of Health, Bethesda, MD , USA 6 To whom correspondence should be addressed: J.D.( jurriend@helix.nih.gov) or L.L. ( lil@ioz.ac.cn).

2 Yu et al., page 2 Supplementary Figure 1. Localization of the SCMC and Establishing Tle6 mutant mice. (a) Mouse early embryos were fixed in the oviduct, embedded in paraffin and sectioned (4 m). The paraffin sections were stained with rabbit anti-tle6 and imaged with confocal microscopy. Scale bar, 20 m. (b) The serial pictures were from the time lapse imaging of TLE6-eGFP (Supplementary Movie 1). Normal mouse zygotes were microinjected with the mrna of Tle6-eGFP, cultured for 2-3 hr, and imaged with the UltraVIEW VoX confocal imaging system. Scale bar, 20 m. (c) Representative images of the proximity ligation assay (PLA) with rabbit anti-tle6 and -FLOPED antibodies in eggs and different stage embryos. PLA experiments were

3 Yu et al., page 3 performed as in (Fig. 1d). Scale bar, 50 m. (d) Schematic representation of normal and Tle6 null alleles after targeting with positive (PGK-Neo) and negative (MC1Tk) selectable markers in which 2.1 kbp and 4.5 kbp homologous arms (thicker lines) were placed 5' and 3', respectively, to the Neo cassette. 5' and 3' probes outside of the targeting construct were used to confirm correct targeting. PCR genotyping was performed with primers P1 and P2 for the normal allele (499 bp) and P1 and P3 for the null allele (875 bp). Arabic numbers indicate exons (light-blue boxes). Arrows indicate cleavage sites of the Nhe1 restriction enzyme. (e) Southern hybridization of embryonic stem cell DNA detected the normal allele as a 16.9 kbp fragment with either the 5' or the 3' probe. The Tle6 null allele was detected as 9 kbp and 8.2 kbp fragments with the 5' and 3' probes, respectively. (f) PCR genotyping of mouse tail DNA detected the normal allele (499 bp) with P1 and P2 and the null allele (875 bp) with P1 and P3 primers. (g) Eggs were recovered from hormonally stimulated control (n=14) and Tle6 Null (n=8) females hr after hcg administration. The data represent the number of eggs (mean ± s.e.m.). NS, no statistical difference in Student s t-test, >0.05. (h) Zygotes were isolated from control and Tle6 Null females mated with normal males hr after hcg administration and cultured an additional hr. The progression to 2-cell embryos was assessed morphologically. The data represent the percent of 2-cell embryos (mean ± s.e.m., n=2) observed at 2 hr intervals.

4 Yu et al., page 4 Supplementary Figure 2. Spindle formation and early cleavage in the embryos from null females. (a) Zygotes were isolated from control (Floped +/- ) and Floped Null females hr and hr after hcg, respectively, and cultured to mitosis. After fixation, the embryos were stained with FITC labeled mouse anti- -tubulin, Hoechest (DNA) and rabbit anti-floped antibody (magenta), which was used to distinguish zygotes from control and Floped Null females. Scale bar, 20 m. (b) Similar to (a), but zygotes were obtained from control (Mater +/- ) and Mater Null females and stained with rabbit anti-mater antibody. Scale bar, 20 m. (c) The percent (mean ± s.e.m.; n, 3) of zygotes initiating asymmetric division at anaphase in vitro from control and null females was assessed morphologically. (d) The percent (mean ± s.e.m.) of 2-cell embryos (cultured in vitro) with asymmetric cell division from control (n=11) and null females (TLE6 Null, n=3; FLOPED Null and MATER Null, n=4) was assessed morphologically.

5 Yu et al., page 5 Supplementary Figure 3. Formation of the cytoplasmic F-actin meshwork in the null zygotes. (a) Zygotes at different mitotic stage from Tle6 Null females hr after hcg, cultured to different mitotic stages, stained with Alexa Fluor 546 labeling phalloidin and Hoechest 33342, and imaged by cofocal microscope. A Range Indicator in color look-up table (LUTs) was used to depict the fluorescence intensity of F-actin. To examine the cytoplasmic F-actin, the fluorescence signal of cortical F-actin was saturated. White is the unsaturated and red is the saturated F-actin fluorescence. Scale bar, 20 m. (b) Zygotes were isolated from control and Mater Null females hr after hcg, and cultured to mitotic stages. After fixation, the embryos were stained with FITC labeled mouse anti- -tubulin, phalloidin labeled with Alexa Fluor 546 and Hoechst and imaged by cofocal microscope. Scale bar, 50 m. (c) As (b) but with zygotes from Floped Null females. Scale bar, 20 m.

6 Yu et al., page 6 Supplementary Figure 4. The subcortical F-actin in SCMC null oocytes. (a) Mouse oocytes were recovered from control and Tle6 Null females hr after hcg, respectively. After fixation, the oocytes were mixed and stained with mouse anti-pan-actin, rabbit anti-tle6 antibodies and phalloidin labeled with Alexa Fluor 546. TLE6 staining was used to distinguish oocytes from control and Tle6Null females. F-actin was labeled with phalloidin (red) and used a Rainbow Indicator in color LUTs to depict the fluorescence intensity. Scale bar, 20 m. (b) Paired oocytes from control and Tle6 Null females were recovered and stained as in (a). The immunofluorescence intensity (mean ± s.e.m.) of subcortical F-actin was analyzed with ZEN elite 2011 and calculated by using the control as 100%. The number of paired oocytes was 25. NS indicates no statistically significant differences using Student s t-test, >0.05. (c) Eggs from control and Tle6 Null females were microinjected with UtrCH-eGFP mrna, cultured for 7-14 hr and imaged at the GV, Anaphase I and MⅡstages with UltraVIEW VoX confocal system. Enlarged images indicated the thickness of cortical F-actin. Scale bar, 20 m. (d) Bar graph (mean ± s.e.m.) showed the cortical F-actin thickness of oocytes at GV (control, 29; Tle6 Null, 17), Anaphase I (control, 10; Tle6 Null, 12) and MⅡ(control, 11; Tle6 Null, 15) stages from control and Tle6 Null females. NS indicates no statistically significant differences using Student s t-test, p >0.05.

7 Yu et al., page 7 Supplementary Figure 5. The defect of actin in SCMC mutant zygotes. (a) Zygotes at similar developmental stages (interphase) were recovered from control (Mater +/- ) and Mater Null females hr and hr after hcg, respectively. After fixation and incubation with mouse anti-pan-actin, rabbit anti-mater antibodies and phalloidin labeled with Alexa Fluor 546, embryo were imaged by confocal microscopy. MATER staining was used to distinguish zygotes from control and Mater Null females. Scale bar, 20 m. (b) Similar to (a), but the zygotes were obtained from control (Floped +/- ) and Floped Null females and stained with rabbit anti-floped antibody. Scale bar, 20 m. (c) Zygotes from control (Mater +/- ) and Mater Null females were recovered and stained with DNase I labeled with Alexa Fluor 488 (G-actin) and rabbit anti-mater antibody. Scale bar, 20 m. (d) Similar with (c), but zygotes were from control (Floped +/- ) and Floped Null females and were distinguished using anti-floped antibody. Scale bar, 20 m.

8 Yu et al., page 8 Supplementary Figure 6. F-actin regulators in SCMC null oocytes and zygotes. (a) Zygotes and oocytes at similar developmental stages from control and Tle6 Null females were fixed and stained with rabbit anti-arp2 antibody. Scale bar, 10 m. (b) Zygotes at similar developmental stages from control and Tle6 Null females were fixed and stained with rabbit anti-cdc42 antibody. Scale bar, 10 m. (c) Zygotes at similar developmental stages from control and Tle6 Null and Floped Null females and stained with rabbit anti-fmn2 antibody. Scale bar, 10 m. (d) Zygotes at similar developmental stages from control and Tle6 Null and Floped Null females were fixed and stained with rabbit anti-cofilin antibody. Scale bar, 20 m. (e) Immunoblots of egg and zygote lysates at similar developmental stages from control and Tle6 Null female mice were probed with rabbit anti-profilin 1, rabbit anti-arp2, mouse anti-arp3, rabbit anti-cdc42 and rabbit anti-gapdh antibodies. (f) The abundance (mean ± s.e.m.; n=3) of Profilin 1, Arp2, Arp3 and CDC42 in control and Tle6 Null eggs and zygotes was determined by the intensity of the immunoblot bands. The abundance of the protein in control was set as 100%. (g) The abundance (mean ± s.e.m. n=2) of phosphorylated Cofilin-S3 was determined by the intensity of the immunoblot of mitotic zygotes (prophase, metaphase and telophase) from control and Tle6 Null females. The abundance of pcofilin in control at prometaphase was set as 100%. (h) Normal (Norm) and Tle6 Null ovary lysates were immunoprecipitated with Tle6(α-TLE) antibodys. Input, ovary lysates from normal females; Norm, normal ovary lysates; Null, Tle6 Null ovary lysates.

9 Yu et al., page 9 Supplementary Figure 7. Full scans of western blots in main Figures. (a) Full blots of Figure 2c. (b) Full blots of Figure 3c. (c) Full blots of Figure 7a. (d) full blots of Figure 7c. (e) Full blots of Figure 7d.

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Cell Division Questions. Mitosis and Meiosis

Cell Division Questions. Mitosis and Meiosis Cell Division Questions Mitosis and Meiosis 1 10 Do not write outside the box 5 Figure 3 shows a pair of chromosomes at the start of meiosis. The letters represent alleles. Figure 3 E E e e F F f f 5 (a)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

TRPM8 in the negative regulation of TNFα expression during cold stress

TRPM8 in the negative regulation of TNFα expression during cold stress in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1*

More information

Supplementary figures

Supplementary figures Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary

More information

Supplementary Figure 1. Mother centrioles can reduplicate while in the close association

Supplementary Figure 1. Mother centrioles can reduplicate while in the close association C1-GFP distance (nm) C1-GFP distance (nm) a arrested HeLa cell expressing C1-GFP and Plk1TD-RFP -3 s 1 2 3 4 5 6 7 8 9 11 12 13 14 16 17 18 19 2 21 22 23 24 26 27 28 29 3 b 9 8 7 6 5 4 3 2 arrested HeLa

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants

Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig

More information

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre

More information

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

LAB. MITOSIS AND CANCER PART 1. NORMAL MITOSIS IN PLANTS FIGURE 1. DIAGRAMATIC GUIDE TO THE STAGES OF MITOSIS

LAB. MITOSIS AND CANCER PART 1. NORMAL MITOSIS IN PLANTS FIGURE 1. DIAGRAMATIC GUIDE TO THE STAGES OF MITOSIS Period Date LAB. MITOSIS AND CANCER One of the basic tenets of biology is that all new cells come from living cells. New cells are formed by the process of cell division which includes both the division

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1 The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEENTRY INFORTION DOI: 1.138/ncb2577 Early Telophase Late Telophase B icrotubules within the ICB (percent of total cells in telophase) D G ultinucleate cells (% total) 8 6 4 2 2 15 1 5 T without gaps

More information

Why do cells reproduce?

Why do cells reproduce? Outline Cell Reproduction 1. Overview of Cell Reproduction 2. Cell Reproduction in Prokaryotes 3. Cell Reproduction in Eukaryotes 1. Chromosomes 2. Cell Cycle 3. Mitosis and Cytokinesis Examples of Cell

More information

Biology 4A Laboratory MITOSIS Asexual Reproduction OBJECTIVE

Biology 4A Laboratory MITOSIS Asexual Reproduction OBJECTIVE Biology 4A Laboratory MITOSIS Asexual Reproduction OBJECTIVE To study the cell cycle and understand how, when and why cells divide. To study and identify the major stages of cell division. To relate the

More information

Supplemental Information. Fluorescence-based visualization of autophagic activity predicts mouse embryo

Supplemental Information. Fluorescence-based visualization of autophagic activity predicts mouse embryo Supplemental Information Fluorescence-based visualization of autophagic activity predicts mouse embryo viability Satoshi Tsukamoto*, Taichi Hara, Atsushi Yamamoto, Seiji Kito, Naojiro Minami, Toshiro Kubota,

More information

The form of cell division by which gametes, with half the number of chromosomes, are produced. Chromosomes

The form of cell division by which gametes, with half the number of chromosomes, are produced. Chromosomes & Karyotypes The form of cell division by which gametes, with half the number of chromosomes, are produced. Homologous Chromosomes Pair of chromosomes (maternal and paternal) that are similar in shape,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

The Cell Cycle CHAPTER 12

The Cell Cycle CHAPTER 12 The Cell Cycle CHAPTER 12 The Key Roles of Cell Division cell division = reproduction of cells All cells come from pre-exisiting cells Omnis cellula e cellula Unicellular organisms division of 1 cell reproduces

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

The Chromosomes of a Frimpanzee: An Imaginary Animal

The Chromosomes of a Frimpanzee: An Imaginary Animal The Chromosomes of a Frimpanzee: An Imaginary Animal Introduction By now, you have heard the terms chromosome, mitosis, and meiosis. You probably also know that chromosomes contain genetic information

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

The Cell Cycle and How Cells Divide

The Cell Cycle and How Cells Divide The Cell Cycle and How Cells Divide 1 Phases of the Cell Cycle The cell cycle consists of Interphase normal cell activity The mitotic phase cell divsion INTERPHASE Growth G 1 (DNA synthesis) Growth G 2

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

Unit 6: Study Guide Cell Division. diploid gene allele interphase (G1, S, G2) prophase metaphase anaphase

Unit 6: Study Guide Cell Division. diploid gene allele interphase (G1, S, G2) prophase metaphase anaphase Unit 6: Study Guide Cell Division 1. Define: chromatin chromosome chromatid pair (sister chromatid) centromere spindle fibers haploid diploid gene allele interphase (G1, S, G2) prophase metaphase anaphase

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct

More information

To General Embryology Dr: Azza Zaki

To General Embryology Dr: Azza Zaki Introduction To General Embryology The Human Development is a continuous process that begins when an ovum from a female is fertilized by a sperm from a male. Cell division, growth and differentiation transform

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Courtheoux et al., http://www.jcb.org/cgi/content/full/jcb.200902093/dc1 S1 Figure S2. Visualization of multiple merotelic attachments.

More information

klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach

klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach DOI: 10.1038/ncb1891 A. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach embryos let hatch overnight transfer to RNAi plates; incubate 5 days at 15 C RNAi food L1 worms adult worms

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx

More information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Posch et al., http://www.jcb.org/cgi/content/full/jcb.200912046/dc1 Figure S1. Biochemical characterization of the interaction between

More information

Unit 4: Cell Division Guided Notes

Unit 4: Cell Division Guided Notes Unit 4: Cell Division Guided Notes 1 Chromosomes are structures that contain material When Eukaryotes are not dividing, DNA and Proteins are in a mass called: When the cell divides, it condenses and becomes

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Mitosis Flap Book Excludes Prometaphase

Mitosis Flap Book Excludes Prometaphase Mitosis Flap Book Excludes Prometaphase TEACHER S INSTRUCTIONS 1) Choose one of the foldables from the choices below. Three Color Choices Black & White Cells without Chromosomes Choose this option if you

More information

How do living things Sexually Reproduce?

How do living things Sexually Reproduce? How do living things Sexually Reproduce? Besides animals, what other things reproduce sexually? Think of a family that has both biological parents and has 2 or more children #1 Consider what the parents

More information

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally

Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally Developmental Cell, Volume 22 Supplemental Information Kinesin-1 Prevents Capture of the Oocyte Meiotic Spindle by the Sperm Aster Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R.

More information

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Chapter 8: Cellular Reproduction

Chapter 8: Cellular Reproduction Chapter 8: Cellular Reproduction 1. The Cell Cycle 2. Mitosis 3. Meiosis 2 Types of Cell Division 2n 1n Mitosis: occurs in somatic cells (almost all cells of the body) generates cells identical to original

More information

a Control IgG Intestine c Testis b Thymus 1 3 2 S S 2 1 3 4 4 Figure S1 The wild-type mouse (C57BL/6J) organs (intestine, thymus and testis) were frozen in liquid nitrogen and sectioned at 5 µm on a cryostat.

More information

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

UNC-Duke Biology Course for Residents Fall Cell Cycle Effects of Radiation

UNC-Duke Biology Course for Residents Fall Cell Cycle Effects of Radiation UNC-Duke Biology Course for Residents Fall 2018 1 Cell Cycle: Sequence of changes in a cell starting with the moment the cell is created by cell division, continuing through the doubling of the DNA and

More information

1. The diagram shows four stages in mitosis. Only one pair of homologous chromosomes is shown. A B C D ... (1) ... (1)

1. The diagram shows four stages in mitosis. Only one pair of homologous chromosomes is shown. A B C D ... (1) ... (1) 1. The diagram shows four stages in mitosis. Only one pair of homologous chromosomes is shown. X A B C D (a) Place stages A, B, C and D in the correct order.... (b) Name the structures labelled X.... Describe

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

supplementary information

supplementary information DOI:.38/ncb1963 a wild 5.3kb 11.2kb targeting vector stop PCR primer KKpn NNhe targeted allele 5.7kb 6.8kb probe b d (g) 35 3 25 2 genomic Southern blot Kpn I digest Nhe I digest / / / / / / 11.2 kb 5.7

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

Cell Division. Learning Objectives: Introduction. Revised Fall 2018

Cell Division. Learning Objectives: Introduction. Revised Fall 2018 Revised Fall 2018 Cell Division Learning Objectives: 1. Define cell cycle and the ordered sequence of events in the cell cycle (Interphase and The divisional phase or M phase) 2. Explain the stages in

More information

Gametogenesis. To complete this worksheet, select: Module: Continuity Activity: Animations Title: Gametogenesis. Introduction

Gametogenesis. To complete this worksheet, select: Module: Continuity Activity: Animations Title: Gametogenesis. Introduction Gametogenesis To complete this worksheet, select: Module: Continuity Activity: Animations Title: Gametogenesis Introduction 1. a. Define gametogenesis. b. What cells are gametes? c. What are the two cell

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.

More information

The Cell Cycle Guided Reading

The Cell Cycle Guided Reading Name Date Period 1. List three things that multi-celled organisms need cell division for. a. b. c. 2. Why do single-celled organisms need to go through cell division? 3. What is the cell cycle? 4. True

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Chromosomes and Cell Cycle

Chromosomes and Cell Cycle Chromosomes and Cell Cycle Cell Basics There are trillions of cells in your body Cells are microscopic Cells have DNA inside a structure called the nucleus The nucleus is enclosed by a structure called

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Meiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number

Meiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number Meiosis Formation of gamete = egg & sperm Occurs only in ovaries and tees Makes cells with haploid chromosome number Meiosis Diploid= Full set of chromosomes 46 chromosomes in humans Found in most body

More information

BIOH122 Session 26 Gametogenesis. Introduction. 1. a. Define gametogenesis. b. What cells are gametes?

BIOH122 Session 26 Gametogenesis. Introduction. 1. a. Define gametogenesis. b. What cells are gametes? BIOH122 Session 26 Gametogenesis Introduction 1. a. Define gametogenesis. b. What cells are gametes? c. What are the two cell division processes that occur during the cell cycle? d. Define the cell cycle.

More information

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype

More information

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,

More information

Supplementary table 1

Supplementary table 1 Supplementary table 1 S. pombe strain list Fig. 1A JX38 h + ade6-m216 nda3-km311 PX476 PW775 PX545 PX546 h- ade6-m216 sgo2::ura4 + nda3-km311 h 9 mad2::ura4 + nda3-km311 h + ade6-m21 nda3-km311 rad21 +

More information

Biology is the only subject in which multiplication is the same thing as division

Biology is the only subject in which multiplication is the same thing as division Biology is the only subject in which multiplication is the same thing as division 2007-2008 The Cell Cycle: Cell Growth, Cell Division Ch. 10 Where it all began You started as a cell smaller than a period

More information