Does the Y chromosome have a role in M ullerian aplasia?

Transcription

1 Does the Y chromosome have a role in M ullerian aplasia? Maria Sandbacka, M.Sc., a Jodie Painter, Ph.D., a,b Minna Puhakka, M.D., c Mervi Halttunen, M.D., d Hannele Laivuori, M.D., c,e and Kristiina Aittom aki, M.D. a,c a Folkh alsan Institute of Genetics, University of Helsinki, Helsinki, Finland; b Genetic Epidemiology, Queensland Institute of Medical Research, Brisbane, Australia; c Department of Clinical Genetics, Helsinki University Central Hospital, Helsinki, Finland; d Department of Obstetrics and Gynecology, Helsinki University Central Hospital, Helsinki, Finland; and e Department of Medical Genetics, University of Helsinki, Finland Objective: To investigate whether Y chromosomal genetic material has a role in the development of M ullerian aplasia in Finland. We have studied the gene and 38 additional male-specific fragments covering areas of both the long and short arms of the Y chromosome in Finnish patients with M ullerian aplasia. Design: A retrospective study. Setting: University hospital and genetic laboratory. Patient(s): A sample set of 110 Finnish patients with well-diagnosed M ullerian aplasia and 20 healthy relatives (13 mothers, 4 fathers, and 3 sisters from different families) were included in the study. One hundred healthy female controls with a background of at least one normal pregnancy with delivery were used as controls. Intervention(s): Blood samples for DNA extraction. Main Outcome Measure(s): Detection of Y chromosomal fragments by polymerase chain reaction in female patients with M ullerian aplasia. Result(s): None of the female patients showed presence of the earlier reported gene or 38 additional Y chromosomal markers. Conclusion(s): Our results indicate that the studied Y-specific fragments, namely and 38 Y chromosomal markers, are not responsible for the syndrome in these Finnish patients with M ullerian aplasia. (Fertil Steril Ò 2010;94: Ó2010 by American Society for Reproductive Medicine.) Key Words: M ullerian aplasia,, Y chromosome M ullerian aplasia features primarily congenital absence of the vagina and functional uterus. Most patients with M ullerian aplasia have the normal female chromosome constitution (46,XX), hormonally active functioning ovaries, and normal secondary sexual characteristics. In Finland a population-based study showed that the minimum incidence of M ullerian aplasia is one in 5,000 newborn girls (1). The majority of these patients have Mayer-Rokitansky-K uster- Hauser (MRKH) syndrome, the most common form of M ullerian aplasia, which is characterized by vaginal aplasia, rudimentary uterine horns, and normal or hypoplastic fallopian tubes (2). A less common form is total M ullerian aplasia, where all M ullerian derivatives (uterus, upper vagina, and fallopian tubes) are absent. Renal and skeletal anomalies occur in 10% to 40% of all patients with M ullerian aplasia (3). Received November 17, 2008; revised February 2, 2009; accepted February 3, 2009; published online March 26, M.S. has nothing to disclose. J.P. has nothing to disclose. M.P. has nothing to disclose. M.H. has nothing to disclose. H.L. has nothing to disclose. K.A. has nothing to disclose. Supported by Victoria Foundation, Medicinska Underst odsf oreningen Liv och H alsa Foundation, P aivikki and Sakari Sohlberg Foundation in Finland. Reprint requests: Maria Sandbacka, M.Sc., Folkh alsan Institute of Genetics, Biomedicum Helsinki, P.O. Box 63, FIN University of Helsinki, Helsinki, Finland (FAX: ; maria. sandbacka@helsinki.fi). The etiology of M ullerian aplasia is complex. Familial clustering has been noted but is rare, and the most favored hypothesis is multifactorial inheritance (4). This is strengthened by the fact that M ullerian anomalies were not found in female children born to patients with M ullerian aplasia through surrogacy (5). Several candidate genes, such as the anti- M ullerian hormone gene (AMH) and its receptor (AMHR) (6 8), as well as members of the WNT and HOXA gene families (9 11), have been investigated for mutations in patients with M ullerian aplasia. Given that only three patients have mutations in WNT4, the cause of the syndrome for the majority of the patients remains unknown. During early embryonic development in males the anti- M ullerian hormone (AMH) causes the regression of the M ullerian ducts shortly after initiation of SRY (sex-determining region Y) expression. In M ullerian aplasia the partial regression of the M ullerian duct derivatives resembles this phenomenon, which in males is regulated by a number of genes, including SRY residing on the Y chromosome. Recently, Plevraki et al. (12) reported the presence of fragments of a Y chromosomal gene, testis-specific protein 1-Ylinked (), in two out of six females in whom MRKH syndrome was diagnosed. The biologic function of is unclear, but it is a candidate oncogene for gonadoblastoma and is supposed to function as a proliferation factor during spermatogenesis (13). Although it may not be per se 120 Fertility and Sterility â Vol. 94, No. 1, June /$36.00 Copyright ª2010 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

2 that causes the M ullerian aplasia syndrome, this finding suggests that the presence of Y chromosomal fragments could play a role in the etiology of M ullerian aplasia. The aim of this study was to investigate whether male-specific Y chromosome fragments were present in Finnish patients with M ullerian aplasia, and therefore have a role in development of M ullerian aplasia. In addition to attempting to amplify fragments of the gene, we also included 38 additional loci to cover most areas of the male-specific Y chromosome. The sample set we investigated includes 110 patients with M ullerian aplasia and 20 relatives, which comprises, to our knowledge, a significantly larger sample series than in any published studies concerning this syndrome to date. MATERIALS AND METHODS Blood samples were collected from 110 Finnish patients with M ullerian aplasia and 20 relatives (13 mothers, 4 fathers, and 3 sisters from different families) through the Departments of Obstetrics and Gynecology of the five University Hospitals (Helsinki, Kuopio, Oulu, Tampere, and Turku) in Finland. Genomic DNA was extracted with use of the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN) according to the manufacturer s recommendation. One hundred female control samples were collected from the Department of Obstetrics and Gynecology of the Helsinki University Hospital, and women who provided these samples had at least one normal pregnancy with delivery. Healthy male controls (four for the studies and one for the additional Y chromosomal fragment studies) were obtained from the Finnish Red Cross for validation of the polymerase chain reaction (PCR) method and for verification of sequencing products. The study protocol has been approved by the Finnish Ministry of Social Affairs and Health and by the Ethics Committee of the Department of Obstetrics and Gynecology, Helsinki University Hospital, Finland. The presence of the gene fragment (NT_011878, NCBI) was initially analyzed by PCR with two primer pairs (Fig. 1, combinations A and B) according to Plevraki et al. (12). In brief, the first PCR was performed with use of primers Y1.5 (5 0 CTA GAC CGC AGA GGC GCC AT 3 0 ) and Y1.6 (5 0 TAG TAC CCA CGC CTG CTC CGG 3 0 ). A second reaction (nested PCR) using the above PCR product as a template then was performed with flanking primers Y1.7 (5 0 CAT CCA GAG CGT CCC TGG CTT 3 0 ) and Y1.8 (5 0 CTT TCC ACA GCC ACA TTT GTC 3 0 )(Fig. 1, combination B). In contrast to Plevraki et al., we obtained fragments in all female samples for both of these reactions but of a different size than in the male samples. Therefore, we attempted to optimize the specificity of the PCR fragments by using the same primers, Y1.5, Y1.6, Y1.7, and Y1.8 primers, in two other combinations. Only primer combination Y1.5 and Y1.8 (Fig. 1, combination C) gave a -specific product FIGURE 1 Polymerase chain reaction primers used for amplification of the gene (NT_011878, NCBI) according to Plevraki et al. (12). Base positions of the primers ( ) are Y1.5 ( ), Y1.6 ( ), Y1.7 ( ), and Y1.8 ( ). The primers were used in three different combinations (A, B, and C). We obtained a -specific PCR product using primer combination C. Exon1 Intron1-2 Y1.5 Primer combination A (216 bp) Y1.6 Y1.7 Primer combination B (175 bp) Y1.8 Y1.5 Primer combination C (195 bp) Y1.8 confirmed by sequencing. All samples were analyzed subsequently with this primer combination. Each PCR was performed in a 15-mL reaction mix containing 133 nmol of each deoxynucleoside-triphosphate (dntp) (Finnzymes, Espoo, Finland), 667 nmol of forward and reverse primers, 1 PCR buffer including MgCl 2, 0.5 units AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), and 100 ng of patient, relative, and control DNA or 50 ng of male control DNA. Amplification conditions were as follows: 10 minutes of initial denaturation at 95 C, followed by 35 cycles of 30 seconds at 95 C, 64 C, and 72 C, respectively, followed by final extension at 72 C for 10 minutes. Amplification products were verified by electrophoresis through 1.5% agarose gels and visualized by staining with ethidium bromide. Product sizes were determined with use of a size marker (Quick-Load 100 base pair [bp] DNA Ladder; New England BioLabs, Ipswich, MA). Negative and positive controls were run concurrently. To verify whether the amplified fragments were from the gene, fragments from four male controls were sequenced with BigDye version (Applied Biosystems) and compared with the UCSC database with BLAT searches ( Amplification products of the gene in females were carefully sequenced and compared with the UCSC database. Additional Y Chromosomal Markers In addition to, 38 loci covering both the long and short arms of the Y chromosome (Fig. 2) were analyzed for all samples. The analyzed loci included a set of 33 Y chromosomal markers (sy84, sy134, sy117, sy102, sy151, sy94, sy88, sy283, sy157, sy158, sy81, sy182, sy147, sy86, sy105, sy82, Y6PHc54pr, sy97, sy14, sy254, sy95, sy127, sy149, Fr15-lipr, Y6HP52pr, Y6D14pr, sy160, sy144, sy255, sy159, sy277, Y6HP35pr, and sy145), which we refer to as the Y panel. To further improve the coverage of the Y chromosome, more loci were found for the short arm by searching the NCBI UniSTS database Fertility and Sterility â 121

3 FIGURE 2 Location of the Y chromosomal markers. SH1 SH2 YSA6.7 YSA7.3 GDB: sy1250 centromere YLA14.6 heterochromatin AZFa AZFb AZFc PAR2 PAR1 sy14(sry) sy81 sy82 sy84 Y6HP35pr sy86 sy88 sy182 sy151 sy94 sy95 sy97 sy102 sy105 Y6D14pr sy117 Y6PHc54pr sy127 sy134 sy144 sy145 Fr15-lipr Y6HP52pr sy147 sy149 sy254 sy255 sy277 sy283 sy157 sy158 sy159 sy160 (GDB:187630; sy1250). Primers were designed with use of the UCSC BLAT search genome database and the Primer3 program for two loci on the short arm (YSA6.7; YSA7.3) and one on the long arm (YLA14.6) (Table 1). Additionally, primers for two PCR fragments (SH1 and SH2; Table 1) were designed within the exonic regions of the short stature homeobox containing gene (SHOX, NM_006883; GeneID:6473, NCBI). The SHOX gene is located in the pseudoautosomal regions (PAR1) of both the X and Y chromosome; therefore these products served as positive amplification controls for both female and male samples. Seven of the Y chromosomal loci (SH1, SH2, YSA6.7, YSA7.3, GDB:187630, sy1250, and YLA 14.6) were PCR amplified with use of the same reaction conditions as for the fragment. Specific annealing temperatures are given in Table 1. These amplification products were sequenced to verify their Y chromosomal specificity. The Y panel was run as either single or multiplex reaction (detailed protocols available on request), with 160 to 200 ng of patient, relative, and control DNA and 50 ng of male control DNA per reaction. Amplification conditions for the multiplex PCRs were as follows: 5 minutes of initial denaturation at 95 C, followed by 35 cycles of 30 seconds at 95 C, 45 seconds at 54 C, and 2 minutes at 65 C, followed by final extension at 65 C for 10 minutes. The sizes of the PCR products were verified by electrophoresis. RESULTS We have studied the earlier reported fragment (12) in 110 Finnish patients with M ullerian aplasia. By the use of PCR amplification, none of our patients showed the presence of this fragment (results summarized in Table 2). In our hands, the first round of amplification with primer combination A resulted, as expected, in a 216-bp fragment in all male samples (relatives and controls) (Fig. 3; part 1, section A). The amplification fragments from four healthy male controls were verified by sequencing as specific. Surprisingly, the primer combination A resulted also in amplification products ranging from 250 to 700 bp in all female (patient, relative, and control) samples (Fig. 3; part 1, section A). The PCR products from two patients were sequenced, and the results showed matches to chromosome 9 instead of chromosome Y. The subsequent nested PCR, using the first PCR as a template, was performed with primer combination B. This reaction resulted in specific amplification of a 175-bp fragment in all males (relatives and controls) (Fig. 3; part 1, section B). This fragment was verified to be specific by sequencing the PCR product from two of the healthy male controls. In females the nested PCR resulted in amplification fragments ranging from 250 to 700 bp, similar as for the A primer combination (Fig. 3; part 1, section B). The amplified fragments were seen in all females (patients, relatives, and controls) and were sequenced from five of the patients. BLAT searches returned matches to sequences located on various chromosomes, including the Y, but at different locations. One patient sequence returned as positive, but when the analyses were repeated the fragment was absent. Attempts to optimize the annealing temperature by gradient PCR to avoid unspecific primer binding and inconsistent results (positive alternating with negative ones for the same samples) had no effect on the amplification of the A and B primer combinations. Our BLAT searches then confirmed primer Y1.6 (used in the A combination) and primer Y1.7 (used in the B combination) to have several matches on the 122 Sandbacka et al. Y chromosome in M ullerian aplasia Vol. 94, No. 1, June 2010

4 TABLE 1 Additional Y chromosomal markers for improved chromosomal coverage. Primer name Primer sequence ( ) bp Base position on Y PCR annealing temperature SH1 a F: CCAGAAAAGCAAGGACGGTA C R: TGGTCCTTGAACAAATGCAC SH2 a F: AGGACGTGAAGTCGGAGGAC C R: GGGTAATGGGTCTCGTCGAA YSA6.7 F: TGATTGCTGATGTGGTGTGA C R: TTGCTTTCAGGGATGACACA YSA7.3 F: TGACATCTGAGGTTGGGTGA C R: GGTTTTCAACCAGGGGAGAT GDB: b F: AAATCTGTACATTCCTAACAGCG C R: TGCAAAGGATGGATTTTTGT sy1250 b F: TTTTTCTAACCTTGCCTGCG C R: TGCAGAGAAGCAGCCTACAA YLA14.6 F: AATGCAATGTTGCTCCACAA C R: GGGAAACAAGTCGGAATGAA a Positive control fragment situated in the SHOX gene located in the pseudoautosomal region (PAR1) of both the X and Y chromosome. b According to NCBI UniSTS database. Y chromosome, therefore giving false-positive results in PCR. Primer combinations A and B thereafter were not used in further investigations. Our BLAT searches proved primers Y1.5 and Y1.8 to have matches only on the Y chromosome in the desired gene and therefore were combined into primer combination C. In our studies, the C primer combination resulted in amplification of a 195-bp fragment (Fig. 3; part 1, section C). The PCR products from four male controls were verified by sequencing to be specific. The C fragment was present in all male samples (relatives and controls) but absent from all female samples (patients, relatives, and controls). TABLE 2 Presence of the gene fragment and additional Y chromosomal loci in Finnish patients with M ullerian aplasia. Marker name Patients with M ullerian aplasia (N [ 110) Female relatives (N [ 16) Female controls (N [ 100) Males (N [ 8 a ) þ SH1 b þ þ þ þ SH2 b þ þ þ þ Y panel c þ YSA6.7 þ YSA7.3 þ GDB: þ sy1250 þ YLA14.6 þ Note: þ¼positive amplification of PCR fragment; ¼no amplification of PCR fragment. a Four male relatives (fathers) and four healthy male controls. b Positive control fragment located in the pseudoautosomal region of both the X and Y chromosome. c Panel including 33 Y chromosomal markers. Fertility and Sterility â 123

5 FIGURE 3 An example of PCR amplification of the gene (1) and seven additional Y fragments (2) in a patient with M ullerian aplasia (P), healthy female control (C F ), and healthy male (C M ). The gene was amplified with (A) primer combination A; (B) subsequent nested PCR with primer combination B; (C) primer combination C. Lanes D, SH1, and E, SH2, represent positive control fragments located within the pseudoautosomal region. The additional Y-specific fragments are (F) YSA6.7, (G) YSA7.3, (H) GDB:187630, (I) sy1250, (J) YLA14. SM ¼ size marker (100 1,000 bp). Studies on 38 Other Y Chromosomal Markers The results of analyzing 38 specific loci covering both arms of the Y chromosome are summarized in Table 2. All samples showed presence of the SHOX fragments included as positive reaction controls (Fig. 3; part 2, sections D E). Although male samples always gave strong and specific amplification of all 38 Y specific markers, none of the females showed presence of these (Fig. 3; part 2, sections F J). Bands were obtained in both patients with M ullerian aplasia and female controls for some markers within the Y panel (data not shown). These were not the same size as in male samples, and when sequenced they were not Y specific. A very small number of females, both patients and controls, showed bands the same size as for males with some primer pairs, but in multiple repetition of the analyses the bands were variably present and absent. Sequencing confirmed that these fragments were not Y specific. DISCUSSION We have investigated the possible presence of Y chromosomal material in an extensive set of Finnish patients in whom M ullerian aplasia was diagnosed. Our PCR results show no amplification of the gene or 38 additional Y-specific fragments in patient samples. This indicates that the fragment, earlier suggested by Plevraki et al. (12) to be involved in the etiology of M ullerian aplasia, is not present in our sample set and is not responsible for the syndrome in these Finnish patients. Our investigation of additional loci covering areas of the male-specific Y chromosome showed no evidence of Y chromosome sequences in patients with M ullerian aplasia. Strict precautions for avoiding contamination were taken throughout the analyses. Each PCR reaction contained null samples, as well as positive (healthy male) and negative (females with a background of at least one normal pregnancy with delivery) controls. The reactions were performed by several coworkers using different work spaces and PCR machines to prevent contamination risks. Even with such precautions, with the use of the nested PCR protocol, we found a few positive results alternating with negative ones in female samples. By sequencing, these fragments were shown to be unspecific. Similarly inconsistent results based on nested PCR were reported by Alvarez-Nava et al. (14). In their evaluation of the presence of the gene presence in 12 patients with M ullerian aplasia, two healthy female controls showed positive gene amplification after second-round PCR. Taken together, positive gene amplification in a nested PCR reaction always should be verified by sequencing. The size of the amplified fragment alone does not guarantee the specificity of the product. The structure of the human Y chromosome is highly polymorphic and repetitive, thereby making the investigation of specific fragments complicated and time consuming. In addition, the high homology between specific areas of the Yand X chromosomes makes the investigation even more challenging. The unspecific amplification of the gene in female patients and controls seen in our study, as well as in the study by Alvarez-Nava et al. (14), forces us to doubt the involvement of the gene in the etiology of M ullerian aplasia suggested by Plevraki et al. (12). Even after repeated PCR reactions and optimization, we could not identify a specific fragment in any of our patient samples. Our extended study of other Y-specific loci also showed the absence of specific amplification in female patients. The structural anomalies of the female reproductive duct in Finnish patients with M ullerian aplasia therefore cannot be explained by the involvement of the studied Y chromosomal material. 124 Sandbacka et al. Y chromosome in M ullerian aplasia Vol. 94, No. 1, June 2010

6 M ullerian aplasia is a malformation syndrome significantly affecting female adult life. The cause of the syndrome is unknown. This is not unexpected as secondary sex determination is a complex phenomenon, and its regulation is poorly understood in females. Recent publications show that there is much to be discovered concerning the genetic programming of the gonads and the M ullerian ducts (15 17). It is possible that genes involved in M ullerian aplasia will have much larger significance and will prove important for embryonic development in other tissues. Many other congenital malformations or malformation syndromes indeed may be explained by the same genes. Recently, two loss-of-function mutations (E226G; R83C) and one substitution mutation with dominant negative effect (L12P) were found in the WNT4 gene in three patients with MRKH syndrome (18 20). This gives us an example of the increase in complexity concerning urogenital disorders. The patients with MRKH with WNT4 mutations showed signs of androgen excess, suggesting that WNT4 deficiency might be a clinical entity distinct from the typical MRKH syndrome. Work excluding WNT4 mutations in the classical form of the syndrome also supports this hypothesis (21, 22). The anti-m ullerian hormone and its receptor are considered key players in the regression of the M ullerian ducts. It has been shown that in mice overexpression of human AMH results in a female phenotype resembling MRKH syndrome (23), supporting the hypothesis of AMH involvement in M ullerian aplasia. The expression of AMH is conserved among mammalian species and is tightly regulated in a developmental and tissue-specific manner, but despite intense study the factors that determine this complex expression pattern still are not understood fully. Although we found no evidence of Y chromosome specific material in Finnish patients with M ullerian aplasia, we cannot completely exclude its possible role in the disorder. On the basis of the clinical phenotype with partial or complete regression of the M ullerian ducts, the hypothesis of male-specific gene expression in patients with M ullerian aplasia is worth consideration in future studies. Acknowledgments: Pauli Kajanoja, M.D., Ph.D., and Hille Eroila, M.D., are acknowledged for their expertise during the initiation of the M ullerian aplasia project in Finland. Harriet von Koskull, Ph.D., at the Helsinki University Central Hospital, Laboratory of Prenatal Diagnosis, Helsinki, Finland, is warmly thanked for sharing information on the Y chromosome markers. Mid-wife Marja-Leena J arvinen is acknowledged for handling patient data and laboratory technician Hanna Nurmi for excellent laboratory assistance. REFERENCES 1. Aittom aki K, Eroila H, Kajanoja P. A population-based study of the incidence of M ullerian aplasia in Finland. Fertil Steril 2001;76: Oppelt P, Renner SP, Kellermann A, Brucker S, Hauser GA, Ludwig KS, et al. Clinical aspects of Mayer-Rokitansky-Kuester-Hauser syndrome: recommendations for clinical diagnosis and staging. Hum Reprod 2006;21: Griffin JE, Edwards C, Madden JD, Harrod MJ, Wilson JD. Congenital absence of the vagina. The Mayer-Rokitansky-K uster-hauser syndrome. Ann Intern Med 1976;85: Simpson JL. Genetics of the female reproductive ducts. Am J Med Genet 1999;89: Petrozza JC, Gray MR, Davis AJ, Reindollar RH. Congenital absence of the uterus and vagina is not commonly transmitted as a dominant genetic trait: outcomes of surrogate pregnancies. Fertil Steril 1997;67: Resendes BL, Sohn SH, Stelling JR, Tineo R, Davis AJ, Gray MR, et al. Role for anti-m ullerian hormone in congenital absence of the uterus and vagina. Am J Med Genet 2001;98: Zenteno JC, Carranza-Lira S, Kofman-Alfaro S. Molecular analysis of the anti-m ullerian hormone, the anti-m ullerian hormone receptor, and galactose-1-phosphate uridyl transferase genes in patients with the Mayer-Rokitansky-K uster-hauser syndrome. Arch Gynecol Obstet 2004;269: Oppelt P, Strissel PL, Kellermann A, Seeber S, Humeny A, Beckmann MW, et al. DNA sequence variations of the entire anti- M ullerian hormone (AMH) gene promoter and AMH protein expression in patients with the Mayer-Rokitanski-K uster-hauser syndrome. Hum Reprod 2005;20: Timmreck LS, Pan HA, Reindollar RH, Gray MR. WNT7A mutations in patients with M ullerian duct abnormalities. J Pediatr Adolesc Gynecol 2003;16: Lalwani SI, Wu H, Reindollar RH, Gray MR. HOXA10 mutations in congenital absence of uterus and vagina. Fertil Steril 2008;89: Karnis MF, Stelling JR, Lalwani SI, Bhagavath B, Pan HA, Davis AJ, et al. Mutation analysis of the HOXA13 gene in patients with congenital absence of the uterus and vagina. J Soc Gynecol Invest 2000;7:172A. 12. Plevraki E, Kita M, Goulis DG, Hatzisevastou-Loukidou H, Lambropoulos AF, Avramides A. Bilateral ovarian agenesis and the presence of the testis-specific protein 1-Y-linked gene: two new features of Mayer-Rokitansky-K uster-hauser syndrome. Fertil Steril 2004;81: Lau Y, Chou P, Iezzoni J, Alonzo J, Komuves L. Expression of a candidate gene for the gonadoblastoma locus in gonadoblastoma and testicular seminoma. Cytogenet Cell Genet 2000;91: Àlvarez-Nava F, Soto M, Fernandez E, Zenteno JC. Nested polymerase chain reaction not ready for gold standard status yet! [letter]. Fertil Steril 2004;82: Cederroth CR, Pitetti JL, Papaioannou MD, Nef S. Genetic programs that regulate testicular and ovarian development. Mol Cell Endocrinol 2007; : Hong X, Luense LJ, McGinnis LK, Nothnick WB, Christenson LK. Dicer1 is essential for female fertility and normal development of the female reproductive system. Endocrinology. 2008;149: Klattig J, Englert C. The M ullerian duct: recent insights into its development and regression. Sex Dev 2007;1: Biason-Lauber A, Konrad D, Navratil F, Schoenle EJ. Brief report: a WNT4 mutation associated with mullerian-duct regression and virilization in a 46,XX woman. N Engl J Med 2004;351: Biason-Lauber A, De Filippo G, Konrad D, Scarano G, Nazzaro A, Schoenle EJ. WNT4 deficiency a clinical phenotype distinct from the classic Mayer Rokitansky Kuster Hauser syndrome: a case report. Hum Reprod 2007;22: Philibert P, Biason-Lauber A, Rouzier R, Pienkowski C, Paris F, Konrad D, et al. Identification and functional analysis of a new WNT4 gene mutation among 28 adolescent girls with primary amenorrhea and Mullerian duct abnormalities: a French collaborative study. J Clin Endocrinol Metab 2008;93: Clement-Ziza M, Khen N, Gonzales J, Cretolle-Vastel C, Picard J-Y, Tullio-Pelet A, et al. Exclusion of WNT4 as a major gene in Rokitansky- K uster-hauser anomaly. Am J Med Genet 2005;137A: Cheroki C, Krepischi-Santos AC, Rosenberg C, Jehee FS, Mingroni- Netto RC, Filho IP, et al. Report of a del22q11 in a patient with Mayer-Rokitansky-K uster-hauser (MRKH) anomaly and exclusion of WNT-4, RAR-gamma, and RXR-alpha as major genes determining MRKH anomaly in a study of 25 affected women. Am J Med Genet 2006;140A: Jamin SP, Arango NA, Mishina Y, Hanks MC, Behringer RR. Genetic studies of the AMH/MIS signalling pathway for M ullerian duct regression. Mol Cell Endocrinol 2003;211:15 9. Fertility and Sterility â 125