Supplementary Materials for

Size: px

Start display at page:

Download "Supplementary Materials for"

Virgil Lynch
5 years ago
Views:

1 advances.sciencemag.org/cgi/content/full/3/8/e /dc1 Supplementary Materials for Impaired DNA replication derepresses chromatin and generates a transgenerationally inherited epigenetic memory Adam Klosin, Kadri Reis, Cristina Hidalgo-Carcedo, Eduard Casas, Tanya Vavouri, Ben Lehner This PDF file includes: Published 16 August 2017, Sci. Adv. 3, e (2017) DOI: /sciadv fig. S1. Expression of the daf-21p::mcherry reporter in the progeny of animals treated with RNAi targeting different subunits of the DNA polymerase complex and its associated proteins. fig. S2. Increased transgene expression in div-1 mutants. fig. S3. Maternal div-1 deficiency results in elevated transgene expression in the offspring. fig. S4. Transgene up-regulation following pole-2 knockdown is suppressed in the mes-2;met-2;set-25 triple-mutant background. fig. S5. Impaired DNA replication reduces H3K27me3 levels on multiple loci. fig. S6. Global reduction of repressive histone marks and a gain of activating histone marks in late embryos. fig. S7. Knockdown of pole-2 results in reduction of H3K27me3 mark and increase in H3K4me3 in early embryonic chromatin. fig. S8. Reduction in H3K9me3 mark in mutant L1s detected by Western blot. fig. S9. Passage of the transgenic array through impaired replication for a single generation is sufficient to trigger a multigenerational effect. fig. S10. Quantification of H3K27me3 in interphase nuclei. table S1. List of genes whose knockdown results in upregulation of daf- 21p::mCherry transgene. table S2. C. elegans strains used in this study. table S3. Primers used in qpcr analyses. table S4. Transgenes tested for derepression with div-1(rnai).

2 Supplementary Figures and Tables fig. S1. Expression of the daf-21p::mcherry reporter in the progeny of animals treated with RNAi targeting different subunits of the DNA polymerase complex and its associated proteins. Quantification of mcherry fluorescence. L4 larvae carrying the daf-21p::mcherry transgene were fed with RNAi targeting the indicated genes for 24 hours (no upregulation in the parents was observed under these conditions). Offspring embryos were extracted, allowed to hatch overnight in M9 buffer and imaged under fluorescence microscope. Arrested embryos were not included in the quantification. Sample size: control, 110; rfc-1, 176; rfc-3, 129; Y47D3A.29, 11; rpa-2, 161; lrr-1, 151; pole-2, 221; div-1, 157; pole-1, 32. P-values: **** p< , ** p<0.01, * p<0.05, ns p> 0.05 (Wilcoxon rank test). Y-axes in log scale. Sample size indicated below each boxplot. All values are normalised to the median of the control.

10 8 6 4 2 **** WT B daf-21p::mcherry fig.

mutant embryos synchronized at the 4-cell

3 A daf-21p::mcherry WT div-1 (or148) Relative daf-21p::mcherry Fluorescence **** WT B daf-21p::mcherry fig. S2. Increased transgene expression in div-1 mutants. a, Expression of daf- 21p::mCherry in mutant embryos synchronized at the 4-cell stage and allowed to develop for 6.5 hours at 20 C. The delay in development in was estimated to be approximately one hour based on embryo morphology. Sample size: WT, 43;, 35. b, Expression of daf-21p::mcherry in adult mutant div-1 (or148) worms is elevated in all tissues.

4 mcherry mcherry (1) (2) F1 mcherry(+/-) F1 div-1(or148/) mcherry(+/-) daf-21p::mcherry Fluorescence Relative to (1) **** (1) (2) mcherry mcherry (3) (4) F1 mcherry(+/-) F1 div-1(or148/) mcherry(+/-) daf-21p::mcherry Fluorescence Relative to (1) ns (3) (4) ; mcherry (5) (6) div-1(or148/) F1 mcherry (+/-) F1 ; mcherry div-1(or148/or148) mcherry (+/-) daf-21p::mcherry Fluorescence Relative to (1) ns (5) (6) Supplementary figure 3 fig. S3. Maternal div-1 deficiency results in elevated transgene expression in the offspring. The indicated crosses were performed in parallel and the resulting male cross-progeny imaged and mcherry expression quantified. Images show representative F1 animals with their genotype indicated. The genotype of the parents is given above each image. Animals were paired such that the daf-21p::mcherry transgene in the F1 worms is derived from the same population of parents. Sample size: (1) 51, (2) 57, (3) 48, (4) 45, (5) 50, (6) 54.

5 mes-2 (bn11); met-2 (n4256); set-25 (n5021) control (RNAi) pole-2 (RNAi) control (RNAi) pole-2 (RNAi) same contrast adjusted contrast control (RNAi) pole-2 (RNAi) Relative daf-21p::mcherry Fluorescence **** 4.3 x RNAi: control pole-2 adjusted contrast mes-2 (bn11); met-2 (n4256); set-25 (n5021) control (RNAi) pole-2 (RNAi) Relative daf-21p::mcherry Fluorescence mes-2 (bn11) met-2 (n4256) set-25 (n5021) **** 1.8 x RNAi: control pole-2 fig. S4. Transgene up-regulation following pole-2 knockdown is suppressed in the mes-2;met-2;set-25 triple-mutant background. Representative images and quantification of daf-21p::mcherry transgene expression in the hatched progeny derived from parents of the indicated genotypes fed for 24 hours with either control or pole-2 RNAi. Sample size: (control, 239, pole-2, 282), mes-2, met-2, set-25 (control, 153, pole- 2, 72).

6 fig. S5. Impaired DNA replication reduces H3K27me3 levels on multiple loci. H3K27me3 was quantified by ChIP-QPCR at the indicated loci using the primers listed in Supplementary table 3 in and div-1 mutant gravid adults. P-values calculated using two-sided T-test.

7 H3K27me3 H3K4me3 DAPI H3K9me3 DAPI DAPI DAPI H3K36me3 H3K27me3 Relative Fluorescence Intensity p= n: H3K9me3 Relative Fluorescence Intensity p= n: H3K4me3 Relative Fluorescence Intensity p= n: H3K36me3 Relative Fluorescence Intensity p= n: fig. S6. Global reduction of repressive histone marks and a gain of activating histone marks in late embryos. Representative images and quantification of histone modification levels in and nuclei of late embryos. Fold change relative to and p-values (two sided t-test) indicated for each comparison.

H3K4me3 H3K27me3 A DAPI H3K27me3 control pole-2

Fluorescence Intensity 5 4 3 2 1 0 control

H3K27me3 mark and increase in H3K4me3 in early

Representative images and quantification of

8 H3K4me3 H3K27me3 A DAPI H3K27me3 control pole-2 Relative Fluorescence Intensity H3K27me3 1.3x p= B DAPI control pole-2 Relative Fluorescence Intensity control pole-2 n: H3K4me3 1.6x p= control pole-2 n: fig. S7. Knockdown of pole-2 results in reduction of H3K27me3 mark and increase in H3K4me3 in early embryonic chromatin. Representative images and quantification of histone modification levels in control and pole-2 (RNAi) early embryos. Average of each embryo after subtracting the background is plotted. Fold change relative to control and p-values (two sided t-test) indicated for each comparison.

9 fig. S8. Reduction in H3K9me3 mark in mutant L1s detected by Western blot. Quantification of the western blot using anti-h3k9me3 antibody (ab8898) and anti-h3(ab1791). Samples are from synchronised and L1s.

10 F1 F2 F3 F4 div-1 (or148/or148) div-1 (or148/+) mcherry (+/-) mcherry (+/-) mcherry (+/-) mcherry (+/-) Relative Fluorescence Intensity p= 1.3e-10 p= 0 F5 F6 F1 F div-1 (or148/or148) 2.5 (+/+) RRY (+/-) (+/+) RRY (+/-) (+/+) RRY (+/+) (+/+) RRY (+/+) div-1 (or148/+) mcherry (+/-) mcherry (+/-) Relative Fluorescence Intensity 1.5 p= 1.3e-10 p= p= p= p= 9 (+/+) RRY (+/+) (+/+) RRY (+/+) F1 F3 F4 F5 F6 fig. S9. Passage of the transgenic array through impaired replication for a single generation is sufficient to trigger a multigenerational effect. Crossing scheme and quantification of transgene expression. Male worms homozygous for the daf- 21p::mCherry array where crossed to hermaphrodites carrying either a wild-type (denoted as div-1 (+)) or mutant allele. Expression was quantified in hermaphrodite F1 progeny of both crosses and the F1 males where crossed to wild-type hermaphrodites. Single F2 cross-progeny L4 hermaphrodites expressing mcherry where transferred to separate wells. Two days later, adults worms were removed and genotyped and F3 progeny of worms identified as wild-type were subsequently followed

11 and analyzed. From each well identified as wild-type, six F3 hermaphrodites at L4 stage were isolated and segregation of mcherry examined in their offspring to identify F3 animals that were homozygous for mcherry. Equal number of F4 progeny from each identified F3 mcherry (+) animal were pooled and used in the measurement of fluorescence intensity (at F4) and to generate subsequent generations. Expression in the F3 animals was compared based on fluorescence intensity in the pharynx to circumvent the high noise of expression observed in old animals. In F1, F4, F5 and F6 generations, expression was measured in whole animals (mean fluorescence intensity).

12 Relative Fluorescence Intensity H3K27me3 interphase 1.5 x p= fig. S10. Quantification of H3K27me3 in interphase nuclei. Only interphase nuclei in each embryo from Figure 3 were taken into account to calculate the H3K27me3 fluorescence intensity average that was plotted. Fold -change relative to and p-values (two sided t-test) are indicated.

13 table S1 (Part 1 of 3). List of genes whose knockdown results in upregulation of daf- 21p::mCherry transgene. Most affected generation indication of the generation at which the strongest effect of knockdown on transgene expression was observed, G0 in parental generation, G1 in offspring, G0, G1 equally in parents and offspring. Last column indicates overlap with following RNAi screens: T - Towbin et al. 2012, R - Robert et al. 2005, N - Nollen et al. 2004, L - Lamitina et al. 2006, G - Guisbert et al

14 table S1 (Part 2 of 3).

15 table S1 (Part 3 of 3). F58A4.5 clec>161 Collectin Other G0, G1 F58E2.9 srz$23& Serpentine receptor class Z Other G0 L H19N07.1 erfa>3 Ortholog of human GSPT2&GSPT1 Other G0 R, N K08D12.1 pbs$1& Protease subunt Other G0 N K08E4.1 spt$5& Transcription factor Other G0 L K12C11.2 smo$1& Ortholog of SUMO Other G0, G1 M28.5 phi$9& Small nuclear ribonucleoprotein Other G0 N M7.1 let$70& Class I E2 ubiquitination enzyme Other G0 R07G3.1 cdc$42& RHO GTPase Other G1 R12B2.5 mdt$15& Mediator subunit Other G0 G W01D2.2 nhr$61& DNA binding transcription factor Other G0 N W09G12.5 F38A1.8 Signal recognition particle receptor Other G0 ZK328.5 npp$10& Nuclear core complex Other G0 Supplementary(Table(1.(List(of(genes(whose(knockdown(result(in(upregulation(of(daf$ table S2. C. elegans strains used in this study. Strain name N2 EU538 MT17463 MT13293 SS186 CB1301 BCN1049 BCN1050 BCN6101 BCN6105 BCN6112 BCN6123 BCN6129 BCN6130 Genotype wild-type III set-25(n5021) III met-2(n4256) III mes-2(bn11) unc-4(e120)/mnc1 dpy-10(e128) unc- 52(e444) II unc-54(e1301) I crgis1004[daf-21p::gfp::unc- 54 3'UTR; unc-119(+)] crgis1002[daf-21p::mcherry::unc-54 3'UTR; unc-119(+)] III crgis1002 IV set-25(n5021) III crgis1002 IV met-2(n4256) III crgis1002 IV met-2(n4256) set-25(n5021) III crgis1002 IV mes-2(bn11) unc-4(e120)/mnc1 dpy-10(e128) unc- 52(e444)II crgis1002 IV mes-2(bn11) unc-4(e120)/mnc1 dpy-10(e128) unc- 52(e444)II met-2(n4256) set-25(n5021) III crgis1002 IV Supplementary!Table!2.!Strains!used!in!this!study.!!

16 table S3. Primers used in qpcr analyses. pdaf-21 fwd: GCAGCATCTTCTTCGTCCTC, pdaf-21 rev GAAAAATTGAGGGCAGGTGA mcherry fwd: AAGGGCGAGGAGGATAACAT mcherry rev: ACATGAACTGAGGGGACAGG ppmp-3 fwd: TGTTCACTCACAGCCAGCTC, ppmp-3 rev: ACCATCCCATTCAAACCAAA. pcdc-42 fwd: AGTTGTTTTGGCCATTTTGC, pcdc-42 rev: TGAAAACGAATTGCGAAACA. cdc-42 fwd: GCCTGAAATTTCGCATCATT, cdc-42 rev: TCCTTTGCCAACTTCTCTCC sra-25 fwd: ATCCCACTACAACCCCAGGT, sra-25 rev: GACTACCGTGCGGAAATCAT.! table S4. Transgenes tested for derepression with div-1(rnai).

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental