Leukemia inhibitory factor is dysregulated in the endometrium and uterine flushing fluid of patients with adenomyosis during implantation window

Transcription

1 Leukemia inhibitory factor is dysregulated in the endometrium and uterine flushing fluid of patients with adenomyosis during implantation window Yu Xiao, Ph.D., Xiao Sun, M.D., Xiuli Yang, M.D., Jun Zhang, M.D., Qing Xue, M.D., Bocen Cai, M.D., and Yingfang Zhou, M.D. Department of Obstetrics and Gynecology, Peking University First Hospital, Beijing, People s Republic of China Objective: To determine whether the expression of leukemia inhibitory factor during the implantation window in endometrial tissue and uterine flushing fluid of patients with adenomyosis differs from that of healthy fertile women. Design: Experimental study using endometrial tissue and uterine flushing fluid. Setting: Peking University First Hospital, People s Republic of China. Patient(s): There were 28 patients with adenomyosis and 27 control fertile women. Intervention(s): Uterine flushing fluid and endometrial samples were collected during the implantation window, defined as 7 to 9 days after ovulation. Main Outcome Measure(s): Leukemia inhibitory factor levels in uterine flushing fluid were measured by enzymelinked immunosorbent assay. Leukemia inhibitory factor messenger RNA expression in eutopic endometrium was quantified by real-time reverse transcriptase polymerase chain reaction. Leukemia inhibitory factor protein expression was evaluated with semiquantitative immunohistochemistry. Result(s): Leukemia inhibitory factor levels were significantly lower in the uterine flushing fluid of patients with adenomyosis with a history of infertility. Leukemia inhibitory factor messenger RNA and protein also were significantly lower in patients with adenomyosis, compared with control. Leukemia inhibitory factor immunostaining intensity was significantly lower in patients with adenomyosis, compared with control. Conclusion(s): Leukemia inhibitory factor is dysregulated in the endometrium and uterine flushing fluid of women with adenomyosis during the implantation window. (Fertil Steril Ò 2010;94:85 9. Ó2010 by American Society for Reproductive Medicine.) Key Words: Leukemia inhibitory factor (LIF), adenomyosis, endometriosis, implantation window Adenomyosis is a common disease in women of reproductive age. The incidence of adenomyosis is high in women in their mid-30s and older. In the majority of patients, the common triad of symptoms is dysmenorrhea, abnormal uterine bleeding, and an enlarged, tender uterus. However, 35% of adenomyotic cases are asymptomatic (1). Infertility is a less common symptom but is increasingly observed in clinical practice, as more women delay their first pregnancy until later in life. Consequently, adenomyosis is more frequently encountered in the fertility clinic during diagnostic workup. Embryo implantation in the uterus is a critical step in the establishment of pregnancy. In humans, embryo implantation involves the apposition and adherence of the embryo to the uterine luminal epithelium, followed by proliferation and Received November 13, 2008; revised and accepted March 3, 2009; published online April 9, Y.X. has nothing to disclose. X.S. has nothing to disclose. X.Y. has nothing to disclose. J.Z. has nothing to disclose. Q.X. has nothing to disclose. B.C. has nothing to disclose. Y.Z. has nothing to disclose. Supported by a research grant from the Beijing Municipal Science and Technology Commission (HO ). Reprint requests: Yingfang Zhou, M.D., Department of Obstetrics and Gynecology, Peking University First Hospital, No. 1 Xianmen St., Westen District, Beijing , People s Republic of China (FAX: þ ; zhouyf8853@yahoo.com.cn). transmigration across this epithelium and ultimate invasion into the decidualizing stroma. The endometrium becomes receptive for a limited period, between 5 and 10 days after the LH surge (2). Leukemia inhibitory factor (LIF) is among many factors produced by the endometrium during this window of implantation. Thus, LIF has been proposed as a molecular marker of receptive endometrium (3 5). Leukemia inhibitory factor is a pleiotropic cytokine of the interleukin-6 family, and it affects many different cell types. Cells expressing LIF receptors include neurons, megakaryocytes, macrophages, adipocytes, hepatocytes, osteoblasts, myoblasts, kidney or breast epithelial cells, and some tumor cell lines derived from these tissues (6). In mid-late secretory phase human endometrium, LIF is expressed predominantly in the glandular and luminal epithelium (7 9). Leukemia inhibitory factor protein is detected in uterine flushing fluid. Expression is maximal in the mid-late secretory phase of the menstrual cycle, yet reduced in uterine flushing fluid from women with unexplained infertility, compared with control fertile women (10, 11). In this study, we used enzyme-linked immunosorbent assay (ELISA) and quantitative measures of messenger RNA (mrna) and protein to evaluate the role of endometrial LIF during the window of receptivity in women with adenomyosis /$36.00 Fertility and Sterility â Vol. 94, No. 1, June doi: /j.fertnstert Copyright ª2010 American Society for Reproductive Medicine, Published by Elsevier Inc.

2 MATERIALS AND METHODS Patients and Samples There were 28 patients with adenomyosis and 27 control women. These patients were selected from March 2007 to July 2008 in the Department of Obstetrics and Gynecology, Peking University First Hospital. The preoperative diagnosis of adenomyosis was based on typical clinical presentations, enlarged uterus revealed by vaginal ultrasound examination and/or high level of serum CA-125. For all patients, the adenomyosis was confirmed by two histopathologists. Of these patients, 11 presented with dysmenorrhea and 21 with a history of infertility of 2 to 11 years (mean 3.9 years). The control group was healthy women scheduled for tubal ligation, undergoing testing for tubal patency, or women without adenomyosis who had hysterectomy for pathologic changes of the cervix. All women had regular menstrual cycles without steroid treatment or other medication for at least 3 months before the collection of tissue. The mean ages of subjects in each group were years (adenomyosis) and years (control), and there were no significant differences between groups in age or cycle phase. On the day of operation, uterine flushing fluid was collected and endometrial tissue was obtained by curettage from women who gave informed consent. Approval was given by the human ethics committee of Peking University First Hospital, Beijing, China. Uterine flushing was performed before laparoscopy and according to a previously described protocol (12). The procedure involves placing a sterile speculum in the vagina, visualizing the cervical os, and positioning an insemination catheter into the uterine lumen. The catheter is connected to a 10-mL syringe filled with 3.5 ml of sterile normal saline solution. The saline solution is slowly infused into the uterine cavity and aspirated, and the procedure is repeated five times, to achieve turbulent flow and homogeneous distribution of sample within the fluid. The fluid was then collected and centrifuged at 3 g for 3 minutes, and the tissue pellet was immediately frozen to preserve for laboratory examination. All samples were histologically confirmed, and the phase of the menstrual cycle was determined by preoperative history and histologic examination. Tissue Processing and Immunohistochemistry Tissue samples were processed and sectioned onto slides. Slide-mounted sections were stained with hematoxylin and eosin for histologic dating of the menstrual cycle via the Noyes method by an experienced gynecologic pathologist (13). Each tissue specimen was classified according to an idealized 28-day reproductive cycle. For immunohistochemical staining, tissues were formalinfixed and paraffin-embedded, then sectioned and mounted onto slides. Immunolabeling was performed by the avidin biotin peroxidase complex (ABC) method. In brief, sections were incubated in primary antibody, human LIF affinity chromatography purified goat anti-lif IgG (1:100, AF-250-NA; R&D Systems, Minneapolis, MN), at 4 C for 12 hours, rinsed, then incubated with secondary antibody, biotinylated donkey anti-goat IgG (1:200; Santa Cruz Biotechnology, Santa Cruz, CA) for 30 minutes. After another rinse, sections were incubated in ABC complex for 30 minutes. Peroxidase binding sites were visualized by subsequent reaction with diaminobenzidine. For a negative control, phosphate-buffered solution was substituted for the primary antibody in the above protocols. Immunolabeling for LIF was evaluated semiquantitatively, by the following equation: HSCORE ¼ S Pi (i þ 1), where i is the intensity of staining with a value of 1 (weak), 2 (moderate), or 3 (strong), and Pi is the percentage of stained cells (up to 100%) (14). Furthermore, immunolabel in cellular compartments within each section was scored blindly by two independent observers. Enzyme-linked Immunosorbent Assay for LIF Leukemia inhibitory factor ELISAwas performed with flushed uterine samples, in duplicate. The ELISA was carried out with a Quantikine R&D Systems kit (DLF00) and according to manufacturer s instructions. In each 96-well assay plate, assay diluent (RD1U) was added at 50 ml per well, followed by 200 ml of standard, control, or sample. Plates were then incubated at 37 C for 2 hours. After incubation, wells were aspirated and rinsed three times with wash buffer with use of a squirt bottle. Next, 200 ml of conjugate was added to each well and incubated for 2 hours at room temperature. Plates were again rinsed, and 200 ml substrate solution was added. After 20 minutes, stop solution was added to terminate the reaction, and plates were read by a model 550 enzyme-labeling instrument (Bio- Rad Instruments, Hercules, CA) at 450 nm. Quantitative Analysis of LIF mrna Total RNA from 50 to 100 mg of endometrial tissue samples was extracted by TRIzol reagent (Sigma, St. Louis, MO), following the manufacturer s protocol. The RNA purity was verified by A260/A280 with use of an ultraviolet spectrophotometer, which was supposed to result in 1.8 to 2.0. One microgram of RNA was used to generate complementary DNA (cdna) with the Superscript Z First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Real-time (RT) quantitative polymerase chain reaction (PCR) was performed with the ABI 7900 Sequence Detection System and the ABI TaqMan Gene Expression system (Applied Biosystems, Foster City, CA). Reactions were performed in a total volume of 50 ml of a mixture containing 4 mmol/l primers, 2 mmol/l TaqMan probe, 1 ml 10 mmol/l deoxyribonucleoside triphosphate, 1 ml ROX reference dye II (51), and 5 ml cdna. Sequences of primers and TaqMan probes are summarized in Table 1. The expression level of LIF was normalized by using glyceraldehyde- 3-phosphate dehydrogenase (GAPDH). The following RT-PCR protocol was used: 10 minutes at 95 C (preparative denaturalization), then 40 cycles of amplification for 15 seconds at 95 C (RT inactivation and initial activation), and 1 minute at 60 C (annealing and extension). To avoid detection of nonspecific PCR products, the purity of each amplified product was confirmed by melting curve analysis according to the manufacturer s manual. One sample of the cdna 86 Xiao et al. LIF and adenomyosis Vol. 94, No. 1, June 2010

3 TABLE 1 Primer sequences and TaqMan probes used in quantitative RT-PCR for LIF. Primer/probe Sequence LIF Forward 5 0 -CAGTGCCAATGCCCTCTTTATT-3 0 Reverse 5 0 -CCACCAGCTTGGCCTTCTC-3 0 Probe 5 0 -(FAM) CTATGTGGCCCCAACGTGACGGAC(TAMRA)-3 0 GAPDH Forward 5 0 -CAGTCAGCCGCATCTTCTTTT-3 0 Reverse 5 0 -GTGACCAGGCGCCCAATAC-3 0 Probe 5 0 -(FAM) CGTCGCCAGCCGAGCCACA (TAMRA)-3 0 was diluted by 1:10, 1:100, 1:1,000, 1:10,000, 1:100,000, and 1:1,000,000 for the substitute of the standard sample to prepare the standard curves. For the PCR run, a standard curve was established with use of these serial dilutions of each corresponding external standard, and the derived concentration was calculated from the standard curve by the instrument software. Results were presented as the ratio of the amounts of LIF amplification product over GAPDH amplification product according to the cycles of threshold for each sample. Each value was calculated as an average of three independent PCRs. Experiments were conducted under identical conditions, and results were presented as mean SD. Statistical Analysis Statistical analysis was performed with SPSS 11 software (SPSS, Inc., Chicago, IL). Biologic parameters were presumed to exist in a normal distribution. Therefore, one-tailed t-tests were used to test significance, and results are reported as means SD. Because results for LIF levels in uterine flushing did not conform to normal distribution, the differences between groups were also assessed with a nonparametric Mann- Whitney U test, and results are reported as median (25%, 75% quartile range). For evaluation of relationships between the tested variables, Spearman s rank-order correlation coefficients (r s ) and their probability (P) levels were computed. For all tests, P<.05 was considered statistically significant. RESULTS Leukemia Inhibitory Factor positive Immunolabel in Human Endometrium Leukemia inhibitory factor positive immunolabeling was predominant in endometrial luminal and glandular epithelium, and in some stromal cells (Fig. 1). In Figure 1, uterine tissue architecture is indicated. The HSCORE of adenomyotic endometrium ( ) was significantly lower than that of control endometrium ( ) (Table 2). The HSCORE of endometrium in infertile patients with adenomyosis ( ) was significantly lower than that of control endometrium, but the HSCORE of endometrium in patients with dysmenorrhea and adenomyosis ( ) was not significantly different from that of control endometrium. Leukemia Inhibitory Factor Levels Measured by ELISA Table 2 presents measures of LIF in uterine flushing fluid from women with adenomyosis (median ¼ pg/ml, 25% 75 % quartile range ¼ pg/ml) and normal controls (median ¼ pg/ml, 25% 75% quartile range ¼ pg/ml). There was no significant difference of LIF levels in uterine flushing fluid of patients with adenomyosis compared with control (P>.05). However, LIF levels in infertile patients with adenomyosis (median ¼ pg/ml, 25% 75% quartile range ¼ pg/ml) was significantly lower than those of the controls. Leukemia inhibitory factor levels in uterine flushing fluid of patients with adenomyosis with dysmenorrhea (median ¼ pg/ml, 25% 75% quartile range ¼ pg/ml) were not significantly different compared with those of the controls. Leukemia Inhibitory Factor mrna Levels Measured by RT-PCR The LIF mrna expression is expressed as a ratio of LIF/ GAPDH. Leukemia inhibitory factor mrna was significantly lower in patients with adenomyosis ( ) than in controls ( ); P<.05 (Table 2). Leukemia inhibitory factor mrna expression in infertile patients with adenomyosis ( ) was significantly lower than that of controls ( ). The LIF mrna expression in patients with dysmenorrhea and adenomyosis ( ) was not significantly different from that of controls. Correlation Analysis The intensity of LIF immunostaining in patients with adenomyosis was correlated significantly with both LIF levels in flushing fluid (r s ¼ 0.415, P¼.028) and LIF mrna levels in endometria (r s ¼ 0.391, P¼.040). Similar results were found in a subgroup analysis of infertile patients (for flushing fluid r s ¼ 0.497, P¼.022, and for endometria r s ¼ 0.488, P¼.025). In controls, the intensity of LIF immunostaining was positively correlated with both LIF levels in flushing fluid (r s ¼ 0.414, P¼.032) and LIF mrna levels in endometria (r s ¼ 0.383, P¼.048) too. DISCUSSION Leukemia inhibitory factor is an essential cytokine for successful egg implantation during human reproduction. This Fertility and Sterility â 87

4 FIGURE 1 Leukemia inhibitory factor immunolabeling in the endometrium during the implantation window. Positive immunolabeling for LIF (brown precipitate) occurs predominantly in the endometrial luminal and glandular epithelium, as well as in some stromal cells. Original magnification, 400. L ¼ lumen; G ¼ gland; S ¼ stroma. (A) Leukemia inhibitory factor expression in the endometrium of patients with adenomyosis. (B) Leukemia inhibitory factor expression in the endometrium of normal controls. cytokine is a secreted glycoprotein that occurs naturally in a range of molecular weights, from 38 to 67 kda. These different forms result from different glycosylation of a core 20 kda protein. Leukemia inhibitory factor is expressed in various embryonic and adult tissues (15) and occurs in relatively high levels in uterine tissue. Discovery of LIF in mouse endometrium has turned the attention of researchers toward its possible role in fecundity. Studies have shown that LIF is the key molecule in the implantation process during mouse reproduction. Other studies revealed that LIF was absolutely required for embryo implantation in mice (16). Leukemia inhibitory factor expression was partially and temporally distinct in the mouse uterus during embryo implantation. Furthermore, LIF was also predominantly confined to uterine epithelium and was an important factor influencing embryonic attachment to the epithelium (17). In humans, LIF mrna is present in the endometrium, and a rise in LIF expression coincides with the implantation window (18). Mouse LIF also is expressed by endometrial luminal and glandular epithelium during the implantation window. Interestingly, our results show that LIF was confined to luminal epithelial cells in the mid-late secretory phase of human endometrium. A recent study also reported intense immunoreactivity to LIF in both luminal and glandular epithelium during the implantation window (5, 19). The present study is the first to report LIF concentrations in uterine flushing fluid and endometrium of women with adenomyosis during the implantation window. This report is the first to explore the relationship between LIF, implantation, and adenomyosis. To that end, we have reported LIF immunoreactivity in endometrial tissue during the implantation window, in both control subjects and patients with adenomyosis. Interestingly, we found significantly lower LIF immunolabeling intensity in women with adenomyosis, compared with fertile controls. Furthermore, the dysregulation of both LIF mrna and protein in the endometrium during the implantation window suggests that adenomyosis may be associated with impaired implantation. Given this result, it is possible that adenomyosis may influence hormonal and immunologic environments enough to decrease receptivity of the eutopic endometrium. Another main result of our study is that LIF was detected in the uterine flushing fluid of women during the implantation window. This result suggests that LIF is secreted into the human uterine lumen (5). However, there is conflicting evidence for the role of LIF in uterine receptivity. Some studies report lower LIF levels in uterine flushing fluid and lower LIF immunoreactivity in endometrial samples from women with primary unexplained infertility, compared with fertile women. Lower LIF secretion in endometrial explants from infertile women during the implantation window also have been shown (18, 20). Miko1ajczyk et al. (20) found that LIF concentrations in uterine flushing fluid during the implantation window were lower in women with infertility compared with healthy controls, and almost half of infertile women had lower levels of LIF in the uterine cavity compared with controls. A striking result is that women with idiopathic infertility showed LIF deficiency even more pronounced than infertile patients with known etiology. In contrast, other studies reported no change in endometrial LIF mrna or secretion from endometrial biopsy specimens acquired from infertile women, when compared with fertile controls (21, 22). In our study, we found that women with adenomyosis showed lower LIF levels in uterine flushing fluid compared with controls, although this difference failed to reach statistical significance. However, patients with adenomyosis with a history of infertility showed significantly lower levels in uterine flushing fluid, compared 88 Xiao et al. LIF and adenomyosis Vol. 94, No. 1, June 2010

5 TABLE 2 Leukemia inhibitory factor levels in the endometrium and uterine flushing fluid. Groups No. LIF (HSCORE) (mean ± SD) LIF mrna (mean ± SD) LIF (pg/ml), M (25%, 75%) Adenomyosis (10.19, 38.68) Infertile (10.50, 29.08) Dysmenorrhea (13.10, 43.32) Control (13.60, 44.56) Note: M (25%, 75%) ¼ median (25%, 75% quartile range). with fertile controls. Leukemia inhibitory factor mrna and protein both showed significantly lower levels in patients with adenomyosis, especially in those with a history of infertility. It might be speculated that patients with adenomyosis with a history of infertility may be associated with impaired implantation. Our data show that, either in patients with adenomyosis or in controls, the intensity of LIF immunostaining was significantly correlated with both LIF levels in flushing fluid and LIF mrna levels in endometria. Similar results were found in a subgroup analysis of infertile patients. These results suggest that LIF is secreted into the human uterine lumen from eutopic endometrium. Uterine receptivity and implantation are complex processes requiring the coordinated expression of many molecules by the embryo and uterus during implantation (4, 22, 23). Currently, there are no endometrial markers for infertility. Our study showed that adenomyotic endometrium shows abnormalities in production of LIF, which may contribute to altered uterine receptivity and ultimate infertility. REFERENCES 1. Bird CC, McElin TW, Manalo-Estrella P. The elusive adenomyosis of the uterus revisited. Am J Obstet Gynecol 1972;112: Navot D, Bergh PA, Williams M, Garrisi GJ, Guzman I, Sandler B, et al. An insight into early reproductive processes through the in vivo model of ovum donation. J Clin Endocrinol Metab 1991;72: Giudice LC. Potential biochemical markers of uterine receptivity. Hum Reprod 1999;14: Sharkey AM, Smith SK. The endometrium as a cause of implantation failure. Best Pract Res Clin Obstet Gynaecol 2003;17: Aghajanova L. Leukemia inhibitory factor and human embryo implantation. Ann N Y Acad Sci 2004;1034: Heinrich PC, Behrmann I, Haan S, Hermanns HM, M uller-newen G, Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 2003;374: Dimitriadis E, Sharkey AM, Tan YL, Salamonsen LA, Sherwin JR. Immunolocalisation of phosphorylated STAT3, interleukin 11 and leukaemia inhibitory factor in endometrium of women with unexplained infertility during the implantation window. Reprod Biol Endocrinol 2007;5: Dimitriadis E, Stoikos C, Stafford-Bell M, Clark I, Paiva P, Kovacs G, et al. Interleukin-11, IL-11 receptor alpha and leukemia inhibitory factor are dysregulated in endometrium of infertile women with endometriosis during the implantation window. J Reprod Immunol 2006;69: Dimitriadis E, White CA, Jones RL, Salamonsen LA. Cytokines, chemokines and growth factors in endometrium related to implantation. Hum Reprod Update 2005;11: Mikolajczyk M, Wirstlein P, Skrzypczak J. The impact of leukemia inhibitory factor in uterine flushing on the reproductive potential of infertile women a prospective study. Am J Reprod Immunol 2007;58: Ledee-Bataille N, Lapree-Delage G, Taupin JL, Dubanchet S, Frydman R, Chaouat G. Concentration of leukaemia inhibitory factor (LIF) in uterine flushing fluid is highly predictive of embryo implantation. Hum Reprod 2002;17: Miko1ajczyk M, Skrzypczak J, Szymanowski K, Wirstlein P. The assessment of LIF in uterine flushing a possible new diagnostic tool in states of impaired fertility. Reprod Biol 2003;3: Noyes RW, Dickmann Z, Clewe TH, Bonney WA. Pronuclear ovum from a patient using an intrauterine contraceptive device. Science 1965;12: Harrington DJ, Lessey BA, Rai V, Bergqvist A, Kennedy S, Manek S, et al. Tenascin is differentially expressed in endometrium and endometriosis. J Pathol 1999;187: Takahashi Y, Takahashi M, Carpino N, Jou ST, Chao JR, Tanaka S, et al. Leukemia inhibitory factor regulates trophoblast giant cell differentiation via Janus kinase 1 signal transducer and activator of transcription 3 suppressor of cytokine signaling 3 pathway. Mol Endocrinol 2008;22: Rodriguez CI, Cheng JG, Liu L, Stewart CL. Cochlin, a secreted von Willebrand factor type a domain-containing factor, is regulated by leukemia inhibitory factor in the uterus at the time of embryo implantation. Endocrinology 2004;145: Rungsiwiwut R, Rungarunlert S, Numchaisrika P, Pruksananonda K, Techakumphu M, Virutamasen P. Effect of leukemia inhibitory factor (LIF) on the quality of in vitro produced mouse blastocysts and subsequent derivation of embryonic stem (ES) cells. J Med Assoc Thai 2008;91: Haines BP, Voyle RB, Rathjen PD. Intracellular and extracellular leukemia inhibitory factor proteins have different cellular activities that are mediated by distinct protein motifs. Mol Biol Cell 2000;11: Aghajanova L, Stavreus-Evers A, Nikas Y, Hovatta O, Landgren BM. Coexpression of pinopodes and leukemia inhibitory factor, as well as its receptor, in human endometrium. Fertil Steril 2003;79: Mikolajczyk M, Wirstlein P, Skrzypczak J. Leukaemia inhibitory factor and interleukin 11 levels in uterine flushings of infertile patients with endometriosis. Hum Reprod 2006;21: Illera MJ, Juan L, Stewart CL, Cullinan E, Ruman J, Lessey BA. Effect of peritoneal fluid from women with endometriosis on implantation in the mouse model. Fertil Steril 2000;74: Sherwin JR, Smith SK, Wilson A, Sharkey AM. Soluble gp130 is up-regulated in the implantation window and shows altered secretion in patients with primary unexplained infertility. J Clin Endocrinol Metab 2002;87: Sherwin JR, Sharkey AM, Cameo P, Mavrogianis PM, Catalano RD, Edassery S, et al. Identification of novel genes regulated by chorionic gonadotropin in baboon endometrium during the window of implantation. Endocrinology 2007;148: Fertility and Sterility â 89