Leukemia inhibitory factor is dysregulated in the endometrium and uterine flushing fluid of patients with adenomyosis during implantation window
|
|
- Brendan McBride
- 5 years ago
- Views:
Transcription
1 Leukemia inhibitory factor is dysregulated in the endometrium and uterine flushing fluid of patients with adenomyosis during implantation window Yu Xiao, Ph.D., Xiao Sun, M.D., Xiuli Yang, M.D., Jun Zhang, M.D., Qing Xue, M.D., Bocen Cai, M.D., and Yingfang Zhou, M.D. Department of Obstetrics and Gynecology, Peking University First Hospital, Beijing, People s Republic of China Objective: To determine whether the expression of leukemia inhibitory factor during the implantation window in endometrial tissue and uterine flushing fluid of patients with adenomyosis differs from that of healthy fertile women. Design: Experimental study using endometrial tissue and uterine flushing fluid. Setting: Peking University First Hospital, People s Republic of China. Patient(s): There were 28 patients with adenomyosis and 27 control fertile women. Intervention(s): Uterine flushing fluid and endometrial samples were collected during the implantation window, defined as 7 to 9 days after ovulation. Main Outcome Measure(s): Leukemia inhibitory factor levels in uterine flushing fluid were measured by enzymelinked immunosorbent assay. Leukemia inhibitory factor messenger RNA expression in eutopic endometrium was quantified by real-time reverse transcriptase polymerase chain reaction. Leukemia inhibitory factor protein expression was evaluated with semiquantitative immunohistochemistry. Result(s): Leukemia inhibitory factor levels were significantly lower in the uterine flushing fluid of patients with adenomyosis with a history of infertility. Leukemia inhibitory factor messenger RNA and protein also were significantly lower in patients with adenomyosis, compared with control. Leukemia inhibitory factor immunostaining intensity was significantly lower in patients with adenomyosis, compared with control. Conclusion(s): Leukemia inhibitory factor is dysregulated in the endometrium and uterine flushing fluid of women with adenomyosis during the implantation window. (Fertil Steril Ò 2010;94:85 9. Ó2010 by American Society for Reproductive Medicine.) Key Words: Leukemia inhibitory factor (LIF), adenomyosis, endometriosis, implantation window Adenomyosis is a common disease in women of reproductive age. The incidence of adenomyosis is high in women in their mid-30s and older. In the majority of patients, the common triad of symptoms is dysmenorrhea, abnormal uterine bleeding, and an enlarged, tender uterus. However, 35% of adenomyotic cases are asymptomatic (1). Infertility is a less common symptom but is increasingly observed in clinical practice, as more women delay their first pregnancy until later in life. Consequently, adenomyosis is more frequently encountered in the fertility clinic during diagnostic workup. Embryo implantation in the uterus is a critical step in the establishment of pregnancy. In humans, embryo implantation involves the apposition and adherence of the embryo to the uterine luminal epithelium, followed by proliferation and Received November 13, 2008; revised and accepted March 3, 2009; published online April 9, Y.X. has nothing to disclose. X.S. has nothing to disclose. X.Y. has nothing to disclose. J.Z. has nothing to disclose. Q.X. has nothing to disclose. B.C. has nothing to disclose. Y.Z. has nothing to disclose. Supported by a research grant from the Beijing Municipal Science and Technology Commission (HO ). Reprint requests: Yingfang Zhou, M.D., Department of Obstetrics and Gynecology, Peking University First Hospital, No. 1 Xianmen St., Westen District, Beijing , People s Republic of China (FAX: þ ; zhouyf8853@yahoo.com.cn). transmigration across this epithelium and ultimate invasion into the decidualizing stroma. The endometrium becomes receptive for a limited period, between 5 and 10 days after the LH surge (2). Leukemia inhibitory factor (LIF) is among many factors produced by the endometrium during this window of implantation. Thus, LIF has been proposed as a molecular marker of receptive endometrium (3 5). Leukemia inhibitory factor is a pleiotropic cytokine of the interleukin-6 family, and it affects many different cell types. Cells expressing LIF receptors include neurons, megakaryocytes, macrophages, adipocytes, hepatocytes, osteoblasts, myoblasts, kidney or breast epithelial cells, and some tumor cell lines derived from these tissues (6). In mid-late secretory phase human endometrium, LIF is expressed predominantly in the glandular and luminal epithelium (7 9). Leukemia inhibitory factor protein is detected in uterine flushing fluid. Expression is maximal in the mid-late secretory phase of the menstrual cycle, yet reduced in uterine flushing fluid from women with unexplained infertility, compared with control fertile women (10, 11). In this study, we used enzyme-linked immunosorbent assay (ELISA) and quantitative measures of messenger RNA (mrna) and protein to evaluate the role of endometrial LIF during the window of receptivity in women with adenomyosis /$36.00 Fertility and Sterility â Vol. 94, No. 1, June doi: /j.fertnstert Copyright ª2010 American Society for Reproductive Medicine, Published by Elsevier Inc.
2 MATERIALS AND METHODS Patients and Samples There were 28 patients with adenomyosis and 27 control women. These patients were selected from March 2007 to July 2008 in the Department of Obstetrics and Gynecology, Peking University First Hospital. The preoperative diagnosis of adenomyosis was based on typical clinical presentations, enlarged uterus revealed by vaginal ultrasound examination and/or high level of serum CA-125. For all patients, the adenomyosis was confirmed by two histopathologists. Of these patients, 11 presented with dysmenorrhea and 21 with a history of infertility of 2 to 11 years (mean 3.9 years). The control group was healthy women scheduled for tubal ligation, undergoing testing for tubal patency, or women without adenomyosis who had hysterectomy for pathologic changes of the cervix. All women had regular menstrual cycles without steroid treatment or other medication for at least 3 months before the collection of tissue. The mean ages of subjects in each group were years (adenomyosis) and years (control), and there were no significant differences between groups in age or cycle phase. On the day of operation, uterine flushing fluid was collected and endometrial tissue was obtained by curettage from women who gave informed consent. Approval was given by the human ethics committee of Peking University First Hospital, Beijing, China. Uterine flushing was performed before laparoscopy and according to a previously described protocol (12). The procedure involves placing a sterile speculum in the vagina, visualizing the cervical os, and positioning an insemination catheter into the uterine lumen. The catheter is connected to a 10-mL syringe filled with 3.5 ml of sterile normal saline solution. The saline solution is slowly infused into the uterine cavity and aspirated, and the procedure is repeated five times, to achieve turbulent flow and homogeneous distribution of sample within the fluid. The fluid was then collected and centrifuged at 3 g for 3 minutes, and the tissue pellet was immediately frozen to preserve for laboratory examination. All samples were histologically confirmed, and the phase of the menstrual cycle was determined by preoperative history and histologic examination. Tissue Processing and Immunohistochemistry Tissue samples were processed and sectioned onto slides. Slide-mounted sections were stained with hematoxylin and eosin for histologic dating of the menstrual cycle via the Noyes method by an experienced gynecologic pathologist (13). Each tissue specimen was classified according to an idealized 28-day reproductive cycle. For immunohistochemical staining, tissues were formalinfixed and paraffin-embedded, then sectioned and mounted onto slides. Immunolabeling was performed by the avidin biotin peroxidase complex (ABC) method. In brief, sections were incubated in primary antibody, human LIF affinity chromatography purified goat anti-lif IgG (1:100, AF-250-NA; R&D Systems, Minneapolis, MN), at 4 C for 12 hours, rinsed, then incubated with secondary antibody, biotinylated donkey anti-goat IgG (1:200; Santa Cruz Biotechnology, Santa Cruz, CA) for 30 minutes. After another rinse, sections were incubated in ABC complex for 30 minutes. Peroxidase binding sites were visualized by subsequent reaction with diaminobenzidine. For a negative control, phosphate-buffered solution was substituted for the primary antibody in the above protocols. Immunolabeling for LIF was evaluated semiquantitatively, by the following equation: HSCORE ¼ S Pi (i þ 1), where i is the intensity of staining with a value of 1 (weak), 2 (moderate), or 3 (strong), and Pi is the percentage of stained cells (up to 100%) (14). Furthermore, immunolabel in cellular compartments within each section was scored blindly by two independent observers. Enzyme-linked Immunosorbent Assay for LIF Leukemia inhibitory factor ELISAwas performed with flushed uterine samples, in duplicate. The ELISA was carried out with a Quantikine R&D Systems kit (DLF00) and according to manufacturer s instructions. In each 96-well assay plate, assay diluent (RD1U) was added at 50 ml per well, followed by 200 ml of standard, control, or sample. Plates were then incubated at 37 C for 2 hours. After incubation, wells were aspirated and rinsed three times with wash buffer with use of a squirt bottle. Next, 200 ml of conjugate was added to each well and incubated for 2 hours at room temperature. Plates were again rinsed, and 200 ml substrate solution was added. After 20 minutes, stop solution was added to terminate the reaction, and plates were read by a model 550 enzyme-labeling instrument (Bio- Rad Instruments, Hercules, CA) at 450 nm. Quantitative Analysis of LIF mrna Total RNA from 50 to 100 mg of endometrial tissue samples was extracted by TRIzol reagent (Sigma, St. Louis, MO), following the manufacturer s protocol. The RNA purity was verified by A260/A280 with use of an ultraviolet spectrophotometer, which was supposed to result in 1.8 to 2.0. One microgram of RNA was used to generate complementary DNA (cdna) with the Superscript Z First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Real-time (RT) quantitative polymerase chain reaction (PCR) was performed with the ABI 7900 Sequence Detection System and the ABI TaqMan Gene Expression system (Applied Biosystems, Foster City, CA). Reactions were performed in a total volume of 50 ml of a mixture containing 4 mmol/l primers, 2 mmol/l TaqMan probe, 1 ml 10 mmol/l deoxyribonucleoside triphosphate, 1 ml ROX reference dye II (51), and 5 ml cdna. Sequences of primers and TaqMan probes are summarized in Table 1. The expression level of LIF was normalized by using glyceraldehyde- 3-phosphate dehydrogenase (GAPDH). The following RT-PCR protocol was used: 10 minutes at 95 C (preparative denaturalization), then 40 cycles of amplification for 15 seconds at 95 C (RT inactivation and initial activation), and 1 minute at 60 C (annealing and extension). To avoid detection of nonspecific PCR products, the purity of each amplified product was confirmed by melting curve analysis according to the manufacturer s manual. One sample of the cdna 86 Xiao et al. LIF and adenomyosis Vol. 94, No. 1, June 2010
3 TABLE 1 Primer sequences and TaqMan probes used in quantitative RT-PCR for LIF. Primer/probe Sequence LIF Forward 5 0 -CAGTGCCAATGCCCTCTTTATT-3 0 Reverse 5 0 -CCACCAGCTTGGCCTTCTC-3 0 Probe 5 0 -(FAM) CTATGTGGCCCCAACGTGACGGAC(TAMRA)-3 0 GAPDH Forward 5 0 -CAGTCAGCCGCATCTTCTTTT-3 0 Reverse 5 0 -GTGACCAGGCGCCCAATAC-3 0 Probe 5 0 -(FAM) CGTCGCCAGCCGAGCCACA (TAMRA)-3 0 was diluted by 1:10, 1:100, 1:1,000, 1:10,000, 1:100,000, and 1:1,000,000 for the substitute of the standard sample to prepare the standard curves. For the PCR run, a standard curve was established with use of these serial dilutions of each corresponding external standard, and the derived concentration was calculated from the standard curve by the instrument software. Results were presented as the ratio of the amounts of LIF amplification product over GAPDH amplification product according to the cycles of threshold for each sample. Each value was calculated as an average of three independent PCRs. Experiments were conducted under identical conditions, and results were presented as mean SD. Statistical Analysis Statistical analysis was performed with SPSS 11 software (SPSS, Inc., Chicago, IL). Biologic parameters were presumed to exist in a normal distribution. Therefore, one-tailed t-tests were used to test significance, and results are reported as means SD. Because results for LIF levels in uterine flushing did not conform to normal distribution, the differences between groups were also assessed with a nonparametric Mann- Whitney U test, and results are reported as median (25%, 75% quartile range). For evaluation of relationships between the tested variables, Spearman s rank-order correlation coefficients (r s ) and their probability (P) levels were computed. For all tests, P<.05 was considered statistically significant. RESULTS Leukemia Inhibitory Factor positive Immunolabel in Human Endometrium Leukemia inhibitory factor positive immunolabeling was predominant in endometrial luminal and glandular epithelium, and in some stromal cells (Fig. 1). In Figure 1, uterine tissue architecture is indicated. The HSCORE of adenomyotic endometrium ( ) was significantly lower than that of control endometrium ( ) (Table 2). The HSCORE of endometrium in infertile patients with adenomyosis ( ) was significantly lower than that of control endometrium, but the HSCORE of endometrium in patients with dysmenorrhea and adenomyosis ( ) was not significantly different from that of control endometrium. Leukemia Inhibitory Factor Levels Measured by ELISA Table 2 presents measures of LIF in uterine flushing fluid from women with adenomyosis (median ¼ pg/ml, 25% 75 % quartile range ¼ pg/ml) and normal controls (median ¼ pg/ml, 25% 75% quartile range ¼ pg/ml). There was no significant difference of LIF levels in uterine flushing fluid of patients with adenomyosis compared with control (P>.05). However, LIF levels in infertile patients with adenomyosis (median ¼ pg/ml, 25% 75% quartile range ¼ pg/ml) was significantly lower than those of the controls. Leukemia inhibitory factor levels in uterine flushing fluid of patients with adenomyosis with dysmenorrhea (median ¼ pg/ml, 25% 75% quartile range ¼ pg/ml) were not significantly different compared with those of the controls. Leukemia Inhibitory Factor mrna Levels Measured by RT-PCR The LIF mrna expression is expressed as a ratio of LIF/ GAPDH. Leukemia inhibitory factor mrna was significantly lower in patients with adenomyosis ( ) than in controls ( ); P<.05 (Table 2). Leukemia inhibitory factor mrna expression in infertile patients with adenomyosis ( ) was significantly lower than that of controls ( ). The LIF mrna expression in patients with dysmenorrhea and adenomyosis ( ) was not significantly different from that of controls. Correlation Analysis The intensity of LIF immunostaining in patients with adenomyosis was correlated significantly with both LIF levels in flushing fluid (r s ¼ 0.415, P¼.028) and LIF mrna levels in endometria (r s ¼ 0.391, P¼.040). Similar results were found in a subgroup analysis of infertile patients (for flushing fluid r s ¼ 0.497, P¼.022, and for endometria r s ¼ 0.488, P¼.025). In controls, the intensity of LIF immunostaining was positively correlated with both LIF levels in flushing fluid (r s ¼ 0.414, P¼.032) and LIF mrna levels in endometria (r s ¼ 0.383, P¼.048) too. DISCUSSION Leukemia inhibitory factor is an essential cytokine for successful egg implantation during human reproduction. This Fertility and Sterility â 87
4 FIGURE 1 Leukemia inhibitory factor immunolabeling in the endometrium during the implantation window. Positive immunolabeling for LIF (brown precipitate) occurs predominantly in the endometrial luminal and glandular epithelium, as well as in some stromal cells. Original magnification, 400. L ¼ lumen; G ¼ gland; S ¼ stroma. (A) Leukemia inhibitory factor expression in the endometrium of patients with adenomyosis. (B) Leukemia inhibitory factor expression in the endometrium of normal controls. cytokine is a secreted glycoprotein that occurs naturally in a range of molecular weights, from 38 to 67 kda. These different forms result from different glycosylation of a core 20 kda protein. Leukemia inhibitory factor is expressed in various embryonic and adult tissues (15) and occurs in relatively high levels in uterine tissue. Discovery of LIF in mouse endometrium has turned the attention of researchers toward its possible role in fecundity. Studies have shown that LIF is the key molecule in the implantation process during mouse reproduction. Other studies revealed that LIF was absolutely required for embryo implantation in mice (16). Leukemia inhibitory factor expression was partially and temporally distinct in the mouse uterus during embryo implantation. Furthermore, LIF was also predominantly confined to uterine epithelium and was an important factor influencing embryonic attachment to the epithelium (17). In humans, LIF mrna is present in the endometrium, and a rise in LIF expression coincides with the implantation window (18). Mouse LIF also is expressed by endometrial luminal and glandular epithelium during the implantation window. Interestingly, our results show that LIF was confined to luminal epithelial cells in the mid-late secretory phase of human endometrium. A recent study also reported intense immunoreactivity to LIF in both luminal and glandular epithelium during the implantation window (5, 19). The present study is the first to report LIF concentrations in uterine flushing fluid and endometrium of women with adenomyosis during the implantation window. This report is the first to explore the relationship between LIF, implantation, and adenomyosis. To that end, we have reported LIF immunoreactivity in endometrial tissue during the implantation window, in both control subjects and patients with adenomyosis. Interestingly, we found significantly lower LIF immunolabeling intensity in women with adenomyosis, compared with fertile controls. Furthermore, the dysregulation of both LIF mrna and protein in the endometrium during the implantation window suggests that adenomyosis may be associated with impaired implantation. Given this result, it is possible that adenomyosis may influence hormonal and immunologic environments enough to decrease receptivity of the eutopic endometrium. Another main result of our study is that LIF was detected in the uterine flushing fluid of women during the implantation window. This result suggests that LIF is secreted into the human uterine lumen (5). However, there is conflicting evidence for the role of LIF in uterine receptivity. Some studies report lower LIF levels in uterine flushing fluid and lower LIF immunoreactivity in endometrial samples from women with primary unexplained infertility, compared with fertile women. Lower LIF secretion in endometrial explants from infertile women during the implantation window also have been shown (18, 20). Miko1ajczyk et al. (20) found that LIF concentrations in uterine flushing fluid during the implantation window were lower in women with infertility compared with healthy controls, and almost half of infertile women had lower levels of LIF in the uterine cavity compared with controls. A striking result is that women with idiopathic infertility showed LIF deficiency even more pronounced than infertile patients with known etiology. In contrast, other studies reported no change in endometrial LIF mrna or secretion from endometrial biopsy specimens acquired from infertile women, when compared with fertile controls (21, 22). In our study, we found that women with adenomyosis showed lower LIF levels in uterine flushing fluid compared with controls, although this difference failed to reach statistical significance. However, patients with adenomyosis with a history of infertility showed significantly lower levels in uterine flushing fluid, compared 88 Xiao et al. LIF and adenomyosis Vol. 94, No. 1, June 2010
5 TABLE 2 Leukemia inhibitory factor levels in the endometrium and uterine flushing fluid. Groups No. LIF (HSCORE) (mean ± SD) LIF mrna (mean ± SD) LIF (pg/ml), M (25%, 75%) Adenomyosis (10.19, 38.68) Infertile (10.50, 29.08) Dysmenorrhea (13.10, 43.32) Control (13.60, 44.56) Note: M (25%, 75%) ¼ median (25%, 75% quartile range). with fertile controls. Leukemia inhibitory factor mrna and protein both showed significantly lower levels in patients with adenomyosis, especially in those with a history of infertility. It might be speculated that patients with adenomyosis with a history of infertility may be associated with impaired implantation. Our data show that, either in patients with adenomyosis or in controls, the intensity of LIF immunostaining was significantly correlated with both LIF levels in flushing fluid and LIF mrna levels in endometria. Similar results were found in a subgroup analysis of infertile patients. These results suggest that LIF is secreted into the human uterine lumen from eutopic endometrium. Uterine receptivity and implantation are complex processes requiring the coordinated expression of many molecules by the embryo and uterus during implantation (4, 22, 23). Currently, there are no endometrial markers for infertility. Our study showed that adenomyotic endometrium shows abnormalities in production of LIF, which may contribute to altered uterine receptivity and ultimate infertility. REFERENCES 1. Bird CC, McElin TW, Manalo-Estrella P. The elusive adenomyosis of the uterus revisited. Am J Obstet Gynecol 1972;112: Navot D, Bergh PA, Williams M, Garrisi GJ, Guzman I, Sandler B, et al. An insight into early reproductive processes through the in vivo model of ovum donation. J Clin Endocrinol Metab 1991;72: Giudice LC. Potential biochemical markers of uterine receptivity. Hum Reprod 1999;14: Sharkey AM, Smith SK. The endometrium as a cause of implantation failure. Best Pract Res Clin Obstet Gynaecol 2003;17: Aghajanova L. Leukemia inhibitory factor and human embryo implantation. Ann N Y Acad Sci 2004;1034: Heinrich PC, Behrmann I, Haan S, Hermanns HM, M uller-newen G, Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 2003;374: Dimitriadis E, Sharkey AM, Tan YL, Salamonsen LA, Sherwin JR. Immunolocalisation of phosphorylated STAT3, interleukin 11 and leukaemia inhibitory factor in endometrium of women with unexplained infertility during the implantation window. Reprod Biol Endocrinol 2007;5: Dimitriadis E, Stoikos C, Stafford-Bell M, Clark I, Paiva P, Kovacs G, et al. Interleukin-11, IL-11 receptor alpha and leukemia inhibitory factor are dysregulated in endometrium of infertile women with endometriosis during the implantation window. J Reprod Immunol 2006;69: Dimitriadis E, White CA, Jones RL, Salamonsen LA. Cytokines, chemokines and growth factors in endometrium related to implantation. Hum Reprod Update 2005;11: Mikolajczyk M, Wirstlein P, Skrzypczak J. The impact of leukemia inhibitory factor in uterine flushing on the reproductive potential of infertile women a prospective study. Am J Reprod Immunol 2007;58: Ledee-Bataille N, Lapree-Delage G, Taupin JL, Dubanchet S, Frydman R, Chaouat G. Concentration of leukaemia inhibitory factor (LIF) in uterine flushing fluid is highly predictive of embryo implantation. Hum Reprod 2002;17: Miko1ajczyk M, Skrzypczak J, Szymanowski K, Wirstlein P. The assessment of LIF in uterine flushing a possible new diagnostic tool in states of impaired fertility. Reprod Biol 2003;3: Noyes RW, Dickmann Z, Clewe TH, Bonney WA. Pronuclear ovum from a patient using an intrauterine contraceptive device. Science 1965;12: Harrington DJ, Lessey BA, Rai V, Bergqvist A, Kennedy S, Manek S, et al. Tenascin is differentially expressed in endometrium and endometriosis. J Pathol 1999;187: Takahashi Y, Takahashi M, Carpino N, Jou ST, Chao JR, Tanaka S, et al. Leukemia inhibitory factor regulates trophoblast giant cell differentiation via Janus kinase 1 signal transducer and activator of transcription 3 suppressor of cytokine signaling 3 pathway. Mol Endocrinol 2008;22: Rodriguez CI, Cheng JG, Liu L, Stewart CL. Cochlin, a secreted von Willebrand factor type a domain-containing factor, is regulated by leukemia inhibitory factor in the uterus at the time of embryo implantation. Endocrinology 2004;145: Rungsiwiwut R, Rungarunlert S, Numchaisrika P, Pruksananonda K, Techakumphu M, Virutamasen P. Effect of leukemia inhibitory factor (LIF) on the quality of in vitro produced mouse blastocysts and subsequent derivation of embryonic stem (ES) cells. J Med Assoc Thai 2008;91: Haines BP, Voyle RB, Rathjen PD. Intracellular and extracellular leukemia inhibitory factor proteins have different cellular activities that are mediated by distinct protein motifs. Mol Biol Cell 2000;11: Aghajanova L, Stavreus-Evers A, Nikas Y, Hovatta O, Landgren BM. Coexpression of pinopodes and leukemia inhibitory factor, as well as its receptor, in human endometrium. Fertil Steril 2003;79: Mikolajczyk M, Wirstlein P, Skrzypczak J. Leukaemia inhibitory factor and interleukin 11 levels in uterine flushings of infertile patients with endometriosis. Hum Reprod 2006;21: Illera MJ, Juan L, Stewart CL, Cullinan E, Ruman J, Lessey BA. Effect of peritoneal fluid from women with endometriosis on implantation in the mouse model. Fertil Steril 2000;74: Sherwin JR, Smith SK, Wilson A, Sharkey AM. Soluble gp130 is up-regulated in the implantation window and shows altered secretion in patients with primary unexplained infertility. J Clin Endocrinol Metab 2002;87: Sherwin JR, Sharkey AM, Cameo P, Mavrogianis PM, Catalano RD, Edassery S, et al. Identification of novel genes regulated by chorionic gonadotropin in baboon endometrium during the window of implantation. Endocrinology 2007;148: Fertility and Sterility â 89
Gynecology & Obstetrics
Gynecology & Obstetrics Gynecology & Obstetrics Kamal and Hafez, 2014, 4:2 DOI; 10.4172/2161-0932.1000201 ISSN: 2161-0932 Research Article Open Access Effect of Uterine Flushing Leukemia Inhibitory Factor
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationReceived 12 December 2010; revised 5 July 2011; accepted 16 July 2011 ABSTRACT
Iranian Biomedical Journal 15 (3): 66-72 (July 11) Semi-Quantitative Analysis of HOXA11, Leukemia Inhibitory Factor and Basic Transcriptional Element Binding Protein 1 mrna Expression in the Mid-Secretory
More informationThe production of leukaemia inhibitory factor by human endometrium: presence in uterine flushings and production by cells in culture
hrep$$0212 Human Reproduction vol.12 no.3 pp.569 574, 1997 The production of leukaemia inhibitory factor by human endometrium: presence in uterine flushings and production by cells in culture S.M.Laird
More informationSuperovulation with human menopausal gonadotropins is associated with endometrial gland-stroma dyssynchrony*
aes FERTILITY AND STERILITY Vol. 61, No.4, April 1994 Copyright ee) 1994 The American Fertility Society Printed on acid-free paper in U. S. A. r I Superovulation with human menopausal gonadotropins is
More information(,, ) , ; : αvβ3, -9(MMP-9) A P450 IgG IgA ; : HOXA10 HOXA11, MMP-2 MMP-9 ; 17β- (17β- HSDs), EMs : R : A : X(2014)
34 7 Vol.34 No.7 2014 7 Jul. 2014 Reproduction & Contraception doi 10.7669/j.issn.0253-357X.2014.07.0590 E-mail randc_journal@163.com ( 510515) () αvβ3-9(mmp-9) A P450 IgG IgA HOXA10 HOXA11 MMP-2 MMP-9
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationThe Soil Test for Your Endometrium : the Endometrial Function Test (EFT )
The Soil Test for Your Endometrium : the Endometrial Function Test (EFT ) Harvey J. Kliman, MD, PhD Yale University School of Medicine A healthy pregnancy is like a successful garden. The successful garden
More informationDecreased Expression of Angiogenin in the Eutopic Endometrium from Women with Advanced Stage Endometriosis
J Korean Med Sci 2008; 23: 802-7 ISSN 1011-8934 DOI: 10.3346/jkms.2008.23.5.802 Copyright The Korean Academy of Medical Sciences Decreased Expression of Angiogenin in the Eutopic Endometrium from Women
More informationService de Gynécologie-Obstétrique et Médecine de la Reproduction, Hôpital Antoine Béclère, Clamart, France
FERTILITY AND STERILITY VOL. 79, NO. 4, APRIL 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Assessment of leukemia
More informationSee external label 2 C 8 C 96 tests B-HCG (Total) Cat #
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationStem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD
Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna
More informationPh.D. THESIS ENDOMETRIAL HYPERPLASIAS IN PERIMENOPAUSE SUMMARY
UNIVERSITY OF MEDICINE AND PHARMACY OF CRAIOVA FACULTY OF MEDICINE Ph.D. THESIS ENDOMETRIAL HYPERPLASIAS IN PERIMENOPAUSE SUMMARY SCIENTIFIC COORDINATOR: PROF. DR. MIHAI B. BRĂILA, Ph.D. Ph.D. Graduand:
More informationManaging infertility when adenomyosis and endometriosis co-exist
Managing infertility when adenomyosis and endometriosis co-exist Jinhua Leng Beijing,China Endometriosis Endometriosis (EM) is a common, benign, ovary hormone-dependent gynecologic disorder which affects
More informationThe Maternal and Child Health Hospital of Jiangxi Province, Nanchang, China
Effects of modified Shoutaiwai recipe on integrin β3 and leukemia-inhibitory factor in endometrium of controlled ovarian hyperstimulation mice during the implantation window X.Y. Chen 1, J. Chen 1, Z.Y.
More information(A) [DOI] /j.issn
Med J Chin PLA, Vol. 41, No. 3, March 1, 2016 175 [ ] 30 SD 5 (A) (B) (C) (D) (E) 0.206 0.514 1.028mg/(kg d) ELISA HE Masson (TGF- ) 9(MMP-9) C D E A B (P
More informationEndometriosis is an enigmatic disease of unknown origin.
The Depolarized Expression of the Alpha-6 Integrin Subunit in the Endometria of Women With Endometriosis María del Mar Vernet-Tomás, MD, PhD, Carlos Tomás Pérez-Ares, MD, PhD, Núria Verdú, MD, María Teresa
More informationIndian Journal of Basic and Applied Medical Research; September 2015: Vol.-4, Issue- 4, P
Original article: To study post intrauterine insemination conception rate among infertile women with polyp and women with normal uterine endometrium cavity 1Dr. Archana Meena, 2 Dr. Renu Meena, 3 Dr. Kusum
More informationStem Cells and The Endometrium. Director, Division of Reproductive Endocrinology and infertility
Stem Cells and The Endometrium Hugh S. Taylor, M.D. Director, Division of Reproductive Endocrinology and infertility Nothing to disclose Stem Cells Cells that are capable of both self-renewal and have
More informationThe significance of lymphocytic-leukocytic infiltrates in interpreting late luteal phase endometrial biopsies
FERTILITY AND STERILITY Copyright 1982 The American Fertility Society Vol. 37, No. 6, June 1982 Printed in U.S A. The significance of lymphocytic-leukocytic infiltrates in interpreting late luteal phase
More informationClomiphene citrate versus letrozole: molecular analysis of the endometrium in women with polycystic ovary syndrome
Clomiphene citrate versus letrozole: molecular analysis of the endometrium in women with polycystic ovary syndrome Kedra L. Wallace, Ph.D., Venessia Johnson, R.N., Victoria Sopelak, Ph.D., and Randall
More informationERA Endometrial Receptivity Analysis Operations Manual
ERA Endometrial Receptivity Analysis Operations Manual L_I_001_ERA_GHQ_EN_v1.0 Date of issue: 21 August 2017 Author: Alejandro Rincón Bertolín Authorized by: María Ruiz Alonso // Igenomix Quality Department
More informationAn Overview of Uterine Factors That Influence Implantation
An Overview of Uterine Factors That Influence Implantation Bulent Urman, M.D. Dept. of Obstetrics and Gynecology Koc University School of Medicine Assisted Reproduction Unit, American Hospital, ISTANBUL
More informationGnRHа/PMSG/HCG. GnRHx (PMSG/HCG) : ) [Pregnant Monoposal Serum Gonadotropine = GnRHx (PMSG/HCG)]
(1384 ) 15-21 1 GnRHа/PMSG/HCG 3 2 1 * 1 2 3 GnRHx (PMSG/HCG) :... (N=30) ( ) : ) [Pregnant Monoposal Serum Gonadotropine = GnRHx (PMSG/HCG)]. ( ) (... :.(P
More informationEndometrial BCL6 Testing for Prediction of In Vitro Fertilization Outcomes: A Cohort Study
Endometrial BCL6 Testing for Prediction of In Vitro Fertilization Outcomes: A Cohort Study Laura Dopson Almquist, MD Department of Obstetrics and Gynecology, Greenville Health System Greenville, SC Disclosure
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationFemale Reproductive System. Lesson 10
Female Reproductive System Lesson 10 Learning Goals 1. What are the five hormones involved in the female reproductive system? 2. Understand the four phases of the menstrual cycle. Human Reproductive System
More informationMohamed El Kadi, Mohamed Hassan and Roaa Kamal Salem. Department of Obstetrics and Gynecology Ain Shams University
The Role of Transforming Growth Factor β 2 Gene Expression as a Predictor of Implantation Failure Mohamed El Kadi, Mohamed Hassan and Roaa Kamal Salem Department of Obstetrics and Gynecology Ain Shams
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationVascular endothelial growth factor and matrix metalloproteinase-2 expedite formation of endometriosis in the early stage ICR mouse model
Vascular endothelial growth factor and matrix metalloproteinase-2 expedite formation of endometriosis in the early stage ICR mouse model Xiu-E Lu, M.D., Wei-Xuan Ning, M.D., Min-Yue Dong, M.D., Ai-Xia
More informationIncreased expression of nuclear factor kappa-b p65 subunit in adenomyosis
Original Article Obstet Gynecol Sci 216;59(2):123-129 http://dx.doi.org/1.5468/ogs.216.59.2.123 pissn 2287-8572 eissn 2287-858 Increased expression of nuclear factor kappa-b p65 subunit in adenomyosis
More informationEndometrial expression of HCG/LH receptor in infertile women with repeated implantation failure
Original Article J Womens Med 2011;4(1):6-10 doi: 10.5468/jwm.2011.4.1.6 pissn 2005-0321 eissn 2233-6222 Endometrial expression of HCG/LH receptor in infertile women with repeated implantation failure
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationExpression of interleukin-10 in patients with adenomyosis
Expression of interleukin-10 in patients with adenomyosis Fei Wang, M.D., Ph.D., Hui Li, Ph.D., Zhongli Yang, M.D., Xuelian Du, M.D., Ph.D., Min Cui, M.D., Ph.D., and Zeqing Wen, M.D. Department of Obstetrics
More informationChapter 7 Infertility, Contraception, and Abortion
Chapter 7 Infertility, Contraception, and Abortion Infertility Incidence Affects about 10% to 15% of reproductive-age population Subfertility: prolonged time to conceive Sterility: inability to conceive
More informationTITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
More informationInflammatory changes of the endometrium in patients with minimal-to-moderate endometriosis*t
FERTILITY AND STERILITY Vol. 62, No.5, November 1994 Copyright e 1994 The American Fertility Society Printed on acid.. free paper in U. S. A Inflammatory changes of the endometrium in patients with minimal-to-moderate
More informationVascular endothelial growth factor (VEGF) in endometriosis
Human Reproduction vol.13 no.6 pp.1686 1690, 1998 Vascular endothelial growth factor (VEGF) in endometriosis Jacques Donnez 1, Pierre Smoes, Stéphane Gillerot, Françoise Casanas-Roux and Michelle Nisolle
More informationClinical aspect of endometrial injury!
Clinical aspect of endometrial injury! Zeev Shoham, M.D. Department of Obstetrics and Gynecology Kaplan Hospital, Rehovot, Israel Implantation Process Good morphology embryo Normal uterus & receptive endometrium
More informationFSH (Rodent) ELISA Kit
FSH (Rodent) ELISA Kit Catalog Number KA2330 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationProgesterone responsiveness is not downregulated in adenomyosis.
Progesterone responsiveness is not downregulated in adenomyosis. Takehiro Hiraoka Yasushi Hirota Tomoko Saito-Fujita Hirofumi Haraguchi Miyuki Harada Tetsuya Hirata Kaori Koga Osamu Hiraike Tomoyuki Fujii
More informationOriginal Article. KEY WORDS: Doppler, endometrial thickness, in-vitro fertilization
Original Article Predictive value of endometrial thickness, pattern and sub-endometrial blood flows on the day of hcg by 2D Doppler in in-vitro fertilization cycles: A prospective clinical study from a
More informationIndex. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationWhat is the Pathogenesis of Endometriosis?
Endometriosis Epigenetics and Stem Cells Hugh S. Taylor, MD Director of Reproductive Endocrinology and Infertility Yale University School of dicine What is the Pathogenesis of Endometriosis? Theories for
More informationPALM-COEIN: Your AUB Counseling Guide
PALM-COEIN: Your AUB Counseling Guide 10 million+ Treat the cause, not the symptom In the U.S, more than 10 million women between the ages of 35 and 49 are affected by AUB 1 Diagnosis Cause Structural
More informationCombination therapeutic effects of high intensity focused ultrasound and Metformin for the treatment of adenomyosis
2104 Combination therapeutic effects of high intensity focused ultrasound and Metformin for the treatment of adenomyosis YANMEI HOU, ZHENLI QIN, KEFENG FAN, YANHUA XU and XIAOGE HUANG Department of Gynaecology
More informationRealizing dreams booklet.indd 1 5/20/ :26:52 AM
Realizing dreams. 18891booklet.indd 1 5/20/2010 11:26:52 AM The Journey To Parenthood The first Gator Baby was born in 1988 through the in vitro fertilization program at the University of Florida. Since
More informationFibroblast growth factor-1 expression in the endometrium of patients with repeated implantation failure after in vitro fertilization
European Review for Medical and Pharmacological Sciences 2013; 17: 398-402 Fibroblast growth factor-1 expression in the endometrium of patients with repeated implantation failure after in vitro fertilization
More informationHIV-1 p24 ELISA Kit. purified polyclonal antibody raised against the full length recombinant p24 is used.
HIV-1 p24 ELISA Kit 80-001 1 kit 96 assays This kit can measure the amount of HIV-1 Gag p24 antigen in cell culture medium handily by a sandwich ELISA (Enzyme Linked Immunosorbent Assay) method. p24 antigen
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationREPRODUCTIVE ENDOCRINOLOGY
REPRODUCTIVE ENDOCRINOLOGY Expression of heparin-binding epidermal growth factor like growth factor and its receptors in the human fallopian tube and endometrium after treatment with mifepristone Xiao
More informationStage 4 - Ovarian Cancer Symptoms
WELCOME Stage 4 - Ovarian Cancer Symptoms University of Baghdad College of Nursing Department of Basic Medical Sciences Overview of Anatomy and Physioloy II Second Year Students Asaad Ismail Ahmad,
More informationLH (Rodent) ELISA Kit
LH (Rodent) ELISA Kit Catalog Number KA2332 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationQuestion Bank III - BHMS
Question Bank III - BHMS Sub:- Ob/Gy -Paper-II 1. Give the definition of Puberty. 2. Enumerate five important physical changes evident during puberty. 3. Write down the vaginal changes during puberty.
More informationH. J. Kliman S. Honig D. Walls M. Luna J. C. McSweet Alan B. Copperman
J Assist Reprod Genet (2006) 23:299 303 DOI 10.1007/s10815-006-9061-1 PHYSIOLOGY Optimization of endometrial preparation results in a normal endometrial function test r (EFT r ) and good reproductive outcome
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationFrequency of menses. Duration of menses 3 days to 7 days. Flow/amount of menses Average blood loss with menstruation is 60-80cc.
Frequency of menses 24 days (0.5%) to 35 days (0.9%) Age 25, 40% are between 25 and 28 days Age 25-35, 60% are between 25 and 28 days Teens and women over 40 s cycles may be longer apart Duration of menses
More informationReceived, June 29, 1904; accepted for publication
THE AMEBICAN JOURNAL OF CLINICAL PATHOLOGY Copyright 1964 by The Williams & Wilkins Co. Vol. 42, No. 0 Printed in U.S.A. CARCINOMA IN SITU OF THE ENDOMETRIUM ISABELLE A. BUEHL, M.D., PRANK VELLIOS, M.D.,
More informationDetection of aromatase cytochrome P-450 in endometrial biopsy specimens as a diagnostic test for endometriosis
FERTILITY AND STERILITY VOL. 72, NO. 6, DECEMBER 1999 Copyright 1999 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Detection of aromatase
More informationme LUTEINIZED UNRUPTURED FOLLICLE SYNDROME AND ENDOMETRIOSIS
FERTILITY AND STERILITY Copyright c 980 The American Fertility Society Vol. 33,, JanuaEY 980 Printed in U.S.A. me LUTEINIZED UNRUPTURED FOLLICLE SYNDROME AND ENDOMETRIOSIS W. PAULDMOWSKI, M.D.,.PH.D.*
More informationhcg (Human) CLIA Kit Catalog Number KA assays Version: 01 Intended for research use only
hcg (Human) CLIA Kit Catalog Number KA2799 96 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationINDICATIONS OF IVF/ICSI
PROCESS OF IVF/ICSI INDICATIONS OF IVF/ICSI IVF is most clearly indicated when infertility results from one or more causes having no other effective treatment; Tubal disease. In women with blocked fallopian
More informationTSH (Human) ELISA Kit
TSH (Human) ELISA Kit Catalog Number KA0197 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationDefective Soil for a Fertile Seed? Altered Endometrial Development Is Detrimental to Pregnancy Success
Defective Soil for a Fertile Seed? Altered Endometrial Development Is Detrimental to Pregnancy Success Jemma Evans 1 *., Natalie J. Hannan 1,2., Cassandra Hincks 1, Luk J. F. Rombauts 3,4, Lois A. Salamonsen
More informationIntracrine Androgens Enhance Decidualization and Modulate Expression of Human
Intracrine Androgens Enhance Decidualization and Modulate Expression of Human Endometrial Receptivity Genes. Authors: Douglas A Gibson 1, Ioannis Simitsidellis 1, Fiona L Cousins 1*, Hilary O.D. Critchley
More informationMICROWELL ELISA LUTEINIZING HORMONE (LH) ENZYMEIMMUNOASSAY TEST KIT LH ELISA. Cat # 4225Z
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationOptimizing Fertility and Wellness After Cancer. Kat Lin, MD, MSCE
Optimizing Fertility and Wellness After Cancer Kat Lin, MD, MSCE University Reproductive Care University of Washington Nov. 6, 2010 Optimism in Numbers 5-year survival rate 78% for all childhood cancers
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationHypertrophy of cardiac muscle in the left ventricular chamber.
The increase in the size of cells and consequently in the size of the affected organ. caused by specific hormone stimulation or by increased functional demand. ü ü Pregnancy: an adaptive response muscular
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationMODERN TRENDS. Biochemical evaluation of endometrial function at the time of implantation CYTOKINES. Edward E. Wallach, M.D.
FERTILITY AND STERILITY VOL. 78, NO. 2, AUGUST 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. MODERN TRENDS Edward
More informationMouse C3 (Complement Factor 3) ELISA Kit
Mouse C3 (Complement Factor 3) ELISA Kit Cat. No.:DEIA8289 Pkg.Size:96T Intended use The Mouse C3 (Complement Factor 3) ELISA Kit is a highly sensitive two-site enzyme linked immunoassay (ELISA) for measuring
More informationEndometrial advancement after triggering with recombinant or urinary HCG: a randomized controlled pilot study
Reproductive BioMedicine Online (2010) 21, 50 55 www.sciencedirect.com www.rbmonline.com ARTICLE Endometrial advancement after triggering with recombinant or urinary HCG: a randomized controlled pilot
More informationIs the fallopian tube better than the uterus? Evidence on intrauterine insemination versus fallopian sperm perfusion
F, V & V IN OBGYN, 2010, MONOGRAPH: 36-41 Artificial insemination Is the fallopian tube better than the uterus? Evidence on intrauterine insemination versus fallopian sperm perfusion Arne SUNDE 1, Jarl
More informationThe impact of HSF on endometrium
ORIGINAL ARTICLE The impact of HSF on endometrium The impact of HSF on endometrium Hongchu Bao 1, Guichan Wang 2, Xin Huang 1, Meimei Wang 1, Xinrong Wang 1, Cuifang Hao 1 * 1 Department of Reproductive
More informationNegative effect of P72 polymorphism on p53 gene in IVF outcome in patients with repeated implantation failure and pregnancy loss
Negative effect of P72 polymorphism on p53 gene in IVF outcome in patients with repeated implantation failure and pregnancy loss Belén Lledo, Azahara Turienzo, Jose A. Ortiz, Ruth Morales, Jorge Ten, Joaquin
More informationSurgical treatment of hydrosalpinx improves the expressions of estrogen receptor and progesterone receptor in the endometrium in implantation window.
Biomedical Research 2013; 24 (1): 72-76 ISSN 0970-938X Surgical treatment of hydrosalpinx improves the expressions of estrogen receptor and progesterone receptor in the endometrium in implantation window.
More informationbleeding Studies naar de diagnostiek van endom triumcarcinoom bij vrouwen met postm nopauzaal bloedverlies. Studies on the
Studies on the diagnosis of endometria cancer in women with postmenopausal bleeding. Studies naar de diagnostiek va endometriumcarcinoom bij vrouwen m postmenopauzaal bloedverlies. Studies on the diagnosis
More informationTHE POSSIBLE EFFECT OF HYDROSALPINX FLUID HUMAN EMBRYOS
Prof D. Loutradis 1 st Obstetrics and Gynecology Department of University of Athens Alexandra Maternity Hospital THE POSSIBLE EFFECT OF HYDROSALPINX FLUID HUMAN EMBRYOS Tubal factor Infertility IVF was
More information5/5/2010. Infertility FINANCIAL DISCLOSURE. Infertility Definition. Objectives. Normal Human Fertility. Normal Menstrual Cycle
Infertility FINANCIAL DISCLOSURE I HAVE NO FINANCIAL INTEREST IN ANY OF THE PRODUCTS MENTIONED IN MY PRESENTATION Bryan K. Rone, M.D. University of Kentucky Obstetrics and Gynecology I AM RECEIVING COMPENSATION
More informationDepartment of Immunology and Gnotobiology, Institute of Microbiology v. v. i., Academy of Sciences of the Czech Republic, Prague, Czech Republic 4
Original Article Leukaemia Inhibitory Factor (LIF) Gene Mutations in Women Diagnosed with Unexplained Infertility and Endometriosis Have a Negative Impact on the IVF Outcome A Pilot Study (leukaemia inhibitory
More informationMedicaid Family Planning Waiver Services CPT Codes and ICD-10 Diagnosis Codes
CPT Code Description of Covered Codes Evaluation and Management 99384FP 99385FP Family planning new visit 99386FP 99394FP 99395FP Family planning established visit 99396FP 99401FP HIV counseling (pre-test)
More informationGonadotrophin-releasing hormone agonist combined with high-intensity focused ultrasound ablation for adenomyosis: a clinical study
DOI: 10.1111/1471-0528.14736 www.bjog.org Uterine Fibroids & Adenomyosis Gonadotrophin-releasing hormone agonist combined with high-intensity focused ultrasound ablation for adenomyosis: a clinical study
More informationThe effect of oral contraceptive pills on markers of endometrial receptivity*t
FERTILITY AND STERILITY Copyright ic 1996 American Society for Reproductive Medicine Vol. 65, No.3, March 1996 Printed on acid-free paper in U. s. A. The effect of oral contraceptive pills on markers of
More informationCorresponding author: X. Cai
Endometrial expression of telomerase, progesterone, and estrogen receptors during the implantation window in patients with recurrent implantation failure N. Long 1,2, N. Liu 1, X.L. Liu 1, J. Li 2, B.Y.
More informationNF-κB p65 (Phospho-Thr254)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual
More informationIVM in PCOS patients. Introduction (1) Introduction (2) Michael Grynberg René Frydman
IVM in PCOS patients Michael Grynberg René Frydman Department of Obstetrics and Gynecology A. Beclere Hospital, Clamart, France Maribor, Slovenia, 27-28 February 2009 Introduction (1) IVM could be a major
More informationSurgical treatment of hydrosalpinx improves the expressions of integrin αvβ3 and L-selectin ligand in the endometrium in implantation window
Biomedical Research 2012; 23 (2): 301-306 Surgical treatment of hydrosalpinx improves the expressions of integrin αvβ3 and L-selectin ligand in the endometrium in implantation window Yiping Zhong #, Jin
More informationPERSONALIZED MEDICINE APPLIED TO ENDOMETRIAL RECEPTIVITY AND EMBRYO TRANSFER
PERSONALIZED MEDICINE APPLIED TO ENDOMETRIAL RECEPTIVITY AND EMBRYO TRANSFER Felipe Vilella; PhD. Miguel Servet Researcher at IUIVI/INCLIVA Lab Manager at IVI Foundation felipe.vilella@ivi.es Carlos Simon;
More informationWelcome. IV INTERNATIONAL WORKSHOP ON OPTIMIZING INFERTILITY TREATMENTS Sao Paulo, Brazil September 3-6, Visit
Welcome IV INTERNATIONAL WORKSHO ON OTIMIZING INFERTILITY TREATMENTS Sao aulo, Brazil September 3-6, 2003 Visit www.seronosymposia.org The role of the endometrium in implantation in human beings rof. Antonio
More informationMouse GLP-2 EIA FOR LABORATORY USE ONLY
YK142 Mouse GLP-2 EIA FOR LABORATORY USE ONLY Kasumigaseki place, 3-6-7, Kasumigaseki, Chiyoda-ku, Tokyo 100-0013 Japan http://www.sceti.co.jp/english/export e-mail exp-pet@sceti.co.jp
More informationResearch Article Investigation of Tenascin Expression in Endometriosis
International Scholarly Research Network ISRN Pathology Volume 2012, Article ID 873759, 5 pages doi:10.5402/2012/873759 Research Article Investigation of Tenascin Expression in Endometriosis Zehra Sema
More informationAn analysis of endometrial biopsies performed for infertility
FERTILITY AND STERILITY Copyright" 1987 The American Fertility Society Vol. 48, No.5, November 1987 Printed in U.S.A. An analysis of endometrial biopsies performed for infertility Bert J. Davidson, M.D.,
More information, MMP 9. genes expression in the endometrium of women with impaired reproduction
FOLIA HISTOCHEMICA ET CYTOBIOLOGICA Vol. 45 Supp. 1 2007 pp. 143-148 TGF superfamily and MMP 2 TIMP 1 genes the endometrium of women with impaired reproduction Jana Skrzypczak 1 Przemys³aw Wirstlein 1
More informationOutline. Male Reproductive System Testes and Sperm Hormonal Regulation
Outline Male Reproductive System Testes and Sperm Hormonal Regulation Female Reproductive System Genital Tract Hormonal Levels Uterine Cycle Fertilization and Pregnancy Control of Reproduction Infertility
More information