Mosaicism in human embryos: Etiology and pregnancy outcome Santi Munné

Size: px

Start display at page:

Download "Mosaicism in human embryos: Etiology and pregnancy outcome Santi Munné"

Irene Reeves
6 years ago
Views:

1 Mosaicism in human embryos: Etiology and pregnancy outcome Santi Munné

2 disclosure - Chief Scientific Officer of CooperGenomics - Reprogenetics (PGS/PGD company), sold to Cooper - Recombine (Carrier Screening company), sold to Cooper - Phosphorus (genomics as a service) - MedAnswers (DTC advise on genetics and infertility) - Board advisors PreVivo (alternative to IVF)

3 Learning objectives What is the best technique to detect mosaicism? What is the incidence of mosaicism? What is the chance of mosaics to reach term? Different types of mosaics have different ongoing potential?

4 PGS PGD v.2 Methods for Comprehensive Chromosome Screening

5 Comparison of current PGS platforms % embryos FISH qpcr acgh Embryo Vu SNP array hr-ngs Total Independent Data Signals* ,700 26,000 32, ,000 Resolution in Mb arm 20M 6M 20M 6M 3M Misdiagnosis aneuploides (a-f) 7% 1% 2% 3% d 2% 0% Unbalanced translocations (g) 2% custom no yes no yes yes Partial aneuploidies 5% no no yes some yes yes Polyploidy 2% yes no no no yes yes Mosaicism (h, i) 20% 20% no 4% no no 20% Miscarriage rate (j, k) 10-20% 20% 13% unk unk 11% a Gutierrez-Mateo et al (2011) Fertil Steril, b Scott et al. (2012), c Treff et al. (2012) Fertil Steril 97:819 24, d unpublished 7 misdiagnoses of 265 samples; e Kung et al. (2015) Reprod Biomed Online,, f Wells et al. (2014) J Med Genet, g Yeobah et al. (2015) ASRM, h Greco et al (2016) NEJM, i Tormasi et al (2015) PGDIS, ASRM. J Rodriguez-Purata et al. (2016) JARG; k Friedenthal et al. (2017) ESHRE * 24M reads per run, 24 samples per run, 30% reads lost = 700,000 reads per sample

Procedures Evolution of PGS techniques 25000 20000

09 10 11 12 13 14 15 16 17(*) Year PGS data from

6 Procedures Evolution of PGS techniques NGS acgh FISH (*) Year PGS data from Reprogenetics ( ) + Genesis Genetics (2017) (*) annualized

7 High Resolution NGS

8 High Resolution Next Generation Sequencing (hr-ngs) Thousands of DNA fragments are mapped to each chromosome ATTAGACTTAGCCTAGATTCCAATGACTGA Normal Chromosome 8

9 High Resolution Next Generation Sequencing (hr-ngs) Normal Trisomy Mosaic Chromosome 8 Chromosome 109 Enables Reliable Detection of Mosaicism

Kung et al. 2015 (Reprogenetics) Fiorentino et al.

10 Kung et al (Reprogenetics) Fiorentino et al Validation of hr-ngs by reanalysis of blastocysts Original Analysis method Reanalysis method Sample acgh NGS Same biopsy acgh NGS Same biopsy Confirmed Euploid Confirmed abnormal TOTAL 44/44 108/ /152 67/67 141/ /208 Wells et al (Reprogenetics) acgh NGS Separate biopsy 13/13 28/28 41/41 Total 100% Sensitivity 100% Specificity 0% Error rate Kung, Munné, Wells et al. (2015) Biomed Reprod Online; Fiorentino et al. (2014) F&S; Wells, Kung, Munné et al. (2014) J Med Genetics;

11 Comparison between NGS and acgh: by Type of Abnormality Reanalysis by acgh Original (NGS) Euploid Aneuploid Segmental Ref Euploid ,2 Aneuploid ,2 Mosaic Polyploid Segmental Translocation (1) Ribustello et al. 2016, PGDIS, (2) Ribustello (2015) ESHRE (3) Bauckman (2016) ESHRE

12 NGS advantages Higher dynamic range than other techniques allows: Detection of triploidy 69,XYY and 69,XXY Detection of mosaics (20-80% range of abnormal cells or 1/5) Higher resolution than other techniques (1.5Mb)

13 Detection of Mosaicism By hr-ngs

14 Mosaicism: Common in day 3 embryos 30% of day-3 embryos were mosaic by FISH. The majority with all cells abnormal: 3[13]1[16]2[18]1[21]3[22] 1[13]1[16]1[18]1[21]1[22] <49% abnormal % abnormal % abnormal 528 1[13]1[16]2[18]2[21]1[22] 3[13]1[16]2[18]1[21]3[22] Munné S, Grifo J, Cohen J, Weier HUG Am J Hum Genet 1994; 55: Munné S, Weier HUG, Grifo J, Cohen J Biol. Reprod. 1994; 51: Colls et al. Fertil Steril 2007;88: [13]1[16]2[18]2[21]2[22] 1[13]1[16]2[18]2[21]1[22] 2[13]1[16]2[18]1[21]1[22] 1[16] 2[13]2[16]2[18]2[21]2[22] 2[13]3[18]1[21]1[22]

15 Higher dynamic range allows NGS to detect mosaics hr NGS Higher dynamic range acgh

16 Example: Mosaic trisomy 5 Full trisomy limit Full monosomy limit

17 Mosaicism by NGS: Mixing Experiment 46,XX 46,XY: -16, +18

18 90% 46,XX: 10% 46,XY; -16, +18

19 80% 46,XX: 20% 46,XY; -16, +18

20 70% 46,XX: 30% 46,XY; -16, +18

21 60% 46,XX: 40% 46,XY; -16, +18

22 50% 46,XX: 50% 46,XY; -16, +18

23 40% 46,XX: 60% 46,XY; -16, +18

24 30% 46,XX: 70% 46,XY; -16, +18

25 20% 46,XX: 80% 46,XY; -16, +18

26 10% 46,XX: 90% 46,XY; -16, +18

Multiple tissue analysis of Blastocysts (Walmsley et al.

NGS % euploid ICM % euploid tissues* 71 embryos 252 tissues

11% 42% mosaic segmental 41% 60% mosaic aneuploid 44% 37%

27 Multiple tissue analysis of Blastocysts (Walmsley et al. 2016) ICM plus 2-5 TE biopsies per embryo analyzed, analyzed by NGS % euploid ICM % euploid tissues* 71 embryos 252 tissues complete aneuploid 0% 4% complete segmental 0% 20% Mosaic complex 11% 42% mosaic segmental 41% 60% mosaic aneuploid 44% 37% Walmsley et al. (2016) ESHRE * Each embryo was biopsied 2-5 times, each time is a tissue

28 Multiple tissue analysis of Blastocysts (Huang et al. 2017) ICM plus 3 TE biopsies per embryo analyzed by acgh % euploid ICM % euploid tissues* complete aneuploid (n=26) 0% 0% complete segmental (n=33) 0% 3% Mosaics (n=0) N/A N/A Huang et al. (2017) J Assist Reprod Genet (2017) 34: * Each embryo was biopsied 4 times, each time is a tissue

29 N = 103,405 embryos. Reprogenetics and Genesis Genetics data to 1/2017 * Complex: >2 full abnormalities Mosaicism rates by high resolution NGS Data from >100,000 embryos Egg donor < >42 Normal 59% 53% 44% 31% 19% 14% Mosaic 16% 18% 17% 13% 10% 8% Aneuploid (± mosaic) 18% 20% 28% 38% 41% 33% Complex (*) 7% 8% 10% 17% 28% 44% Polyploid 1% 1% 1% 1% 1% 1% Total embryos analyzed Mosaics are MITOTIC and therefore do not increase with age Mosaics + Aneuploid and Mosaic show constant rates through age

Types of abnormalities and maternal age by karyomapping analysis 100% 80% 60% 40% 20% 15% 36% 52% 24% 24% 26% Meiotic Errors Mitotic Errors 0% < 34

30 Types of abnormalities and maternal age by karyomapping analysis 100% 80% 60% 40% 20% 15% 36% 52% 24% 24% 26% Meiotic Errors Mitotic Errors 0% < > 40 Maternal Age Meiotic errors: Difference statistically significant at P<0.05 and P< Mitotic errors: No difference detected (P>0.05)

31 Significant difference in mosaicism between centers in egg donor embryos Center ID # N Euploid % Aneuploid % Mosaic % % 37% 16% % 26% 18% % 30% 24% % 25% 29% % 17% 31% % 17% 31% % 27% 33% % 19% 34% % 18% 44% 206 p= Sachdev et al. (2016) ASRM

32 Clinical outcome of mosaics

33 Misdiagnosed by acgh PGS: normal by acgh POC: Trisomy 16. PGS reanalysis: normal by acgh, Mosaic Trisomy 16 (70%) by NGS acgh h-r NGS

34 Mosaics by hr-ngs Miscarry more 52 loses after acgh euploid embryo transfers were reanalyzed by hr-ngs: hr-ngs result Total Euploid 46% Triploid 4% Mosaic euploid / aneuploid 29% Mosaic euploid / segmental 13% Mosaic euploid / Complex abnormal 8% MISCARRIAGES COULD BE FURTHER REDUCED BY 54% USING hr-ngs * * miscarriage rate after acgh about 10%. Grifo et al. (2015) ASRM

35 Mosaic embryos by hr-ngs implant less Mosaic (n=44) Euploid (n=52) Implantation 38% 58% p<0.001 Ongoing implantation 27% 46% p<0.001 Mosaics can progress to term but significantly less than euploid embryos Fragouli et al. (2016) PGDIS

36 Mosaic embryos can result in healthy pregnancies (Greco et al. 2015) 4% of mosaic embryos detected by acgh 33% (6/18) ongoing pregnancies Geco, Minasa, Fiorentino (2015) New Eng. J. Med

37 OPR of euploid vs. mosaic: One center experience (NYU) MOSAIC EUPLOID transferred implantated 50% 72% p=0.06 miscarried 56% 12% p=0.006 ongoing 22% 63% p=0.001 Besser, Maxwell, Friedenthal, Munné, McCaffrey, Grifo (data from NYU, submitted)

38 OPR by type of mosaic or by % abnormal cells (multicentric data) Mosaic type % abnormal replaced ongoing Complex mosaics Aneuploid mosaics Segmental mosacis Total mosaics Euploid <20% any 32 6% 20-40% % >40% 44 30% any 43 37% % All IVF centers 50-70% p<0.001 p<0.05 p<0.001 No difference between monosomy and trisomy Complex have the worse OPR Not enough embryos replaced with >40% abnormal cells Munné et al. (2017) Fertil Steril + Fiorentino (Genoma) data

39 High resolution NGS vs. acgh: Two center experiences acgh NGS p-value SET transfers Age NS IR (%) 63.9% 71.6% 0.01 OPR (%) 53.1% 61.9% Friedenthal, Maxwell, MD, Munné, Kramer, McCulloh, McCaffrey, Grifo (2017) ESHRE acgh NGS p-value transfers Age NS IR (%) 41.6% 57.8% <0.05 OPR (%) 44.0% 65.7% <0.02 Macer, Barritt, Surrey, Danzer, Ghadir, Wang, Pisarska (submitted PCRS)

41 Paradigm shift Current: Classify embryos as normal or abnormal Error rate 2-10% False positives, False negatives occur New: Classify embryos as normal, mosaic or abnormal Minimal error rate Deprioritize mosaics

42 PGDIS, COGEN Recommendations (outdated?) Report <20% as normal and >80% as abnormal (resolution limit) High priority mosaics: those with <40% abnormal cells Low priority mosaics: chaotic mosaics or those with >40% abnormal cells Low priority mosaics: - with chromosomes X, Y, 13, 18, 21 (live born viability) - with chromosomes 14, 15 (risk of UPD) - with chromosomes 2, 7, 16 (intrauterine growth retardation) But there is no evidence that mosaics at blastocyst level have the same impact as mosaics in first trimester

43 Risk of embryonic mosaics producing fetal mosaics or full trisomies 2.1% of CVS are mosaic Grati et al (in press) data on n=72,472 CVS Risk of a trisomic baby from mosaic embryos is <1%: - 24/106 pregnancies miscarried (no data on aneuploid SABs) - 82/106 pregnancies were ongoing and 100% euploid (data from CooperGenomics + Genoma, unpublished) Is Mosaicism at blastocyst stage and fetal mosaicism caused by different mechanisms? - Bolton et al: implantation of mice mosaic blastocysts depends on abnormal cell load - Munne et al: human embryos with higher abnormal cell load perform worse - Weier et al: confined placental mosaicism arises in the placenta and not the embryo

hr-ngs mosaics: Summary NGS detects mosaicism better than other methods 21% of blastocysts are mosaics Mosaics miscarry more (only 4% euploid by hr-ngs miscarry) Mosaics implant less than euploid

44 hr-ngs mosaics: Summary NGS detects mosaicism better than other methods 21% of blastocysts are mosaics Mosaics miscarry more (only 4% euploid by hr-ngs miscarry) Mosaics implant less than euploid embryos (specially complex mosaics) 40% of mosaics can result in an ongoing pregnancy compared to 50-70% euploid Recommended: Transfer euploid first followed by mosaics do Prenatal diagnosis (Amnio) for mosaic transfers

45 Scientists Santi Munné, PhD, CSO (US) Mark Hughes, MD, PhD (US) Jacques Cohen, PhD (US) Dagan Wells, PhD (UK) Elpida Fragouli, PhD (UK) Joson Horcajadas, PhD (LATAM) M. Konstantinidis, PhD (US) Samer Alfarawati, PhD (UK) Tomas Escudero, MSc (US) Josh Blazek, PhD (US) Mike Large, PhD (US) Katharina Spath, PhD (UK) Ryan Subaran, PhD (US) Sarthak Sawarkar, MSc (US) Dhruti Babariya, PhD (UK) Pere Colls, PhD (US) Tony Gordon, PhD (UK) John Kitchen, PhD (US) Carles Gimenez, PhD (Spain) Mireia Sandalinas, PhD (Spain) Sophia Tormasi, MSc (US) Lia Ribustello, MSc (US) Katie Bauckman, MSc (US) Renata Prates, MSc (US) Luis Guzman, PhD (Peru) Muriel Roche, PhD (Japan) Dr. Araki, PhD (Japan) Bioinformatics, VC scientists Arun Manoharan, PhD (US) Avinash Shanmugan, PhD (US) Ursula Schick, PhD (US) Lauren Hurd, PhD (US) Jim Hayes, PhD (US) Eric Proffitt, PhD (US) Genetic Councilors (R&D) Amy Jordan Erin Mills Rachael Cabey Dina Goldberg Haley Nisson

Differences in chromosome abnormalities in eggs and embryos between fertility centers Santi Munné

Differences in chromosome abnormalities in eggs and embryos between fertility centers Santi Munné disclosure None (lol) Except: - Chief Scientific Officer of CooperGenomics - Founder @ Reprogenetics (PGS/PGD