Increased cystic fibrosis transmembrane conductance regulator (CFTR) expression in the human hydrosalpinx

Size: px
Start display at page:

Download "Increased cystic fibrosis transmembrane conductance regulator (CFTR) expression in the human hydrosalpinx"

Transcription

1 Human Reproduction Vol.20, No.5 pp , 2005 Advance Access publication February 10, 2005 doi: /humrep/deh773 Increased cystic fibrosis transmembrane conductance regulator (CFTR) expression in the human hydrosalpinx Louis Chukwuemeka Ajonuma 1, Ernest Hung Yu Ng 2, Pak Ham Chow 4, Cathy Yui Hung 4, Lai Ling Tsang 1, Annie Nga Yin Cheung 3, Christine Brito-Jones 5, Ingrid Hung Lok 5, Christopher J.Haines 5 and Hsiao Chang Chan 1,6 1 Epithelial Cell Biology Research Center, Department of Physiology, Faculty of Medicine, Chinese University of Hong Kong, Shatin, NT, Hong Kong, 2 Department of Obstetrics & Gynecology, 3 Department of Pathology, Faculty of Medicine, The University of Hong Kong, and 4 Department of Anatomy and 5 Department of Obstetrics & Gynecology, Faculty of Medicine, The Chinese University of Hong Kong, SAR, China 6 To whom correspondence should be addressed. Hsiaocchan@cuhk.edu.hk BACKGROUND: Hydrosalpinx (HSP), characterized by abnormal fluid accumulation in the Fallopian tube, is one of the main causes of infertility in women; however, the mechanism underlying the formation of hydrosalpinx fluid (HF) remains elusive. The present study investigated the possible involvement of cystic fibrosis transmembrane conductance regulator (CFTR), a camp-dependent chloride channel, in the pathogenesis of hydrosalpinx. METHODS: Masson s trichrome staining was used to characterize epithelial transformation in human HSP; RT PCR, immunohistochemistry and immunofluorescence staining were used for CFTR expression and localization. RESULTS: Masson s trichrome staining showed areas of epithelial transformation, focally attenuated and pseudostratified. Immunostaining showed enhanced CFTR immunoreactivity in the focally attenuated and pseudostratified areas of HSP epithelium. RT PCR revealed that CFTR expression in HSP was significantly greater than that in normal Fallopian tubes. CONCLUSIONS: These results indicate that HSP epithelium undergoes epithelial transformation with elevated CFTR expression, which may lead to increased transepithelial electrolyte and fluid secretion resulting in HF formation. The present findings may lead to the development of new treatment strategies for infertile patients with HSP. Key words: CFTR/female reproductive tract/hydrosalpinx/hydrosalpinx fluid/infertility Introduction About 30% of infertile women seeking assisted reproductive treatments have hydrosalpinx (HSP) (Strandell et al., 1994; Blazar et al., 1997; Ng et al., 1997). Hydrosalpinx is detrimental to IVF outcome (Aboulghar et al., 1998; Strandell et al., 1998; Zeyneloglu et al., 1998; Camus et al., 1999). Hydrosalpinx fluid (HF) toxicity on mouse embryo development (Mukherjee et al., 1996; Bayler et al., 1997; Murray et al., 1997; Rawe et al., 1997: Sachdev et al., 1997; Koong et al., 1998; Spandorfer et al., 1999; Roberts et al., 1999; Carrasco et al., 2001; Arrighi et al., 2001) and human sperm (Ng et al., 2000) has also been documented. However, the molecular mechanism underlying the formation of HF is far from understood. In particular, the involvement of HSP epithelium has not been investigated although the secretory and absorptive activities of the epithelium have been considered to play a role (Ajonuma et al., 2002). Movement of ions across the tubal epithelium is essential for the movement of fluid, which is not actively transported but moves in response to osmotic gradients largely established by the transport of ions across epithelium, particularly Cl 2 ions through ion channels such as the cystic fibrosis transmembrane conductance regulator (CFTR), a campdependent Cl 2 channel located in the apical membrane and mainly responsible for Cl 2 secretion in many epithelia (Dickens and Leese, 1994; Quinton, 1999). CFTR has previously been shown to be expressed in the female reproductive tract of rodents (Rochwerger and Buchwald, 1993; Chan et al., 2002) and humans (Rochwerger and Buchwald, 1993; Tizzano et al., 1994). Previous studies from our laboratory have provided molecular and electrophysiological evidence of CFTR involvement in transepithelial fluid transport in the female reproductive tract of mice (Chan et al., 1999, 2002). Cyclic changes in uterine fluid volume have been explained by differential regulation of CFTR by ovarian hormones (Chan et al., 2002). The demonstration of camp-activated oviductal Cl 2 secretion in normal but not CFTR mutant mice (Leung et al., 1995) indicate a functional role of CFTR in oviductal secretory function. Therefore, it is likely that CFTR may play a crucial and important role in regulating fluid 1228 q The Author Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please journals.permissions@oupjournals.org

2 Increased CFTR expression in hydrosalpinx balance in the Fallopian tubes and that abnormality of the tubal epithelium as in hydrosalpinx may lead to elevated CFTR expression, and thus HF formation. We undertook the present study to test this hypothesis by examining epithelial pathology and CFTR expression in the Fallopian tubes of infertile HSP patients seeking assisted reproduction treatments. Materials and methods Patients were recruited with ethical approval from the Ethics Committee of The Chinese University of Hong Kong. All patients gave written informed consent prior to their participation in this study. HSP was obtained from six patients undergoing laparoscopic bilateral salpingectomy because of visible HSP shown on transvaginal scanning during IVF cycles of infertile women who had tubal factor infertility only. Normal Fallopian tubes (NFT) were obtained from three healthy women of reproductive age who agreed to have laparoscopic bilateral salpingectomy for tubal sterilization. Salpingectomy was done during mid late proliferative stages (day 7 12) of their uterine cycles when CFTR expression is observed to be highest. Immediately after surgical removal, hydrosalpinges and NFT were collected into sterile tubes containing cold minimum essential medium (MEM; Life Technologies, Invitrogen, USA), placed on ice and transported to the laboratory. Masson s trichrome staining HSP and NFT tissue pieces were fixed overnight in 4% paraformaldehyde (Fisher brand, Fisher Scientific, USA). Tissue samples were dehydrated in graded ethanol and embedded in paraffin wax. Sections were cut at 5 mm using a Reichert Jung, Biocut Rotary Microtome 1130 (Germany), and dried unto Superfrost microscope slides (Fisher brand). Slides were dewaxed in xylene and redehydrated in graded alcohol and stained in Celestine Blue for 30 min and washed, stained again in Mayer s haematoxylin for another 30 min and washed in water. Slides were decolorized for a short time in acid alcohol and washed also in Scott s tap water. Slides were then stained in 1% Xylidine Ponceau in 0.5% HAC for 2 min and washed in water, and finally stained in 0.5% Fast Green for 20 s, blot dried, dehydrated in absolute alcohol, cleared and mounted using Permount (Fisher Scientific Fair Lawn, USA). Observation was done under inverted microscope (Leica; DMR BE, Germany). RNA extraction and RT PCR HSP and NFT were cut into small pieces after the removal of fatty tissues. Tissue pieces for RT PCR were immediately snap-frozen in liquid nitrogen and later stored at 280 8C until used. RNA was isolated from HSP and NFT small pieces using TRIzol reagent (Gibco Invitrogen, USA). RT PCR was performed and repeated three times using RNA obtained from small pieces of HSP and NFT. The specific oligonucleotide primers for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were: GTGGG- GCGCCCCAGGCACCA (sense) and CTCCTTAATGTCACGCAC- GATTTC (antisense), with expected cdna of 515 base pairs (bp). The specific oligonucleotide primers for human CFTR were: AGCT- GGACCAGACCAATTTTGAGGAAA (sense) and CCACACGAA- ATGTGCCAATGCAAGTCC (antisense), with expected cdna of 554 bp. The conditions were: denaturation at 94 8C for 45 s; annealing at 53 8C, 58 8C for 60 s; extension at 72 8C for 60 s; 30, 33 cycles for GAPDH and CFTR respectively. Optimal amplification cycles are determined based on the linear relationship between the amount of PCR product detected and the number of amplification cycles. Due to the relatively small number of samples and in order to minimize unnecessary variables, RNA obtained from all the samples for each group were polled together, reverse-transcribed and then used for PCR. The PCR products were analysed using 2% agarose gel electrophoresis stained with ethidium bromide and visualized in an UV-illuminated imager, Alpha Imager 2200 (Alpha Innotech Corporation, USA). The intensities of the bands of CFTR were normalized to that of GAPDH, which was amplified simultaneously and used as internal marker. Experiments in the absence of reverse transcriptase were conducted as negative control and experiments were repeated four times. Immunohistochemistry Tissue sections dried onto Superfrost microscope slides (Fisher brand) were deparaffinized in xylene and rehydrated in ethanol. Endogenous peroxidase activity was quenched using 3% hydrogen peroxide incubation for 30 min. The slides were then placed in a cooling jar with sodium citrate buffer (ph 6) for antigen retrieval for 5 min. After cooling, slides were rinsed in 1 phosphate-buffered saline (PBS) and incubated in normal blocking serum (Vectastain Elite ABC kit, Vector Laboratories, Inc., USA) for 30 min and washed with PBS. Slides were then incubated overnight with the primary antibody (CFTR, NeoMarkers, Lab Vision Corp., USA; 1:500 v/v in buffer) at 4 8C overnight. Tissue sections were then washed with PBS and immunostaining was performed using a biotinylated secondary antibody, a horseradish peroxidase H conjugate and a substrate chromogen mixture (Vectastain Elite ABC reagent: ABC kit). Reaction was revealed by incubation with vasoactive intestinal peptide (VIP) substrate (Vector Laboratories, Inc., USA) for another 15 min, rinsed in water and counterstained with haematoxylin (Merck, Germany). Tissue sections were dehydrated in graded ethanol, mounted with Permount (Fisher Scientific, USA) and observed under an Olympus epifluorescence microscope (Olympus IX-70, Japan). Intense purple colour deposits indicated the site of positive immunostaining. The experiment was repeated three times and negative controls were applied for all tissue sections by using normal serum and omitting the primary antibody. Three people who never took part in slide preparations evaluated the slides individually. Interpersonal variability was, 1%. CFTR immunostaining intensity values of NFT and HSP tissues were then analysed using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA). Immunofluorescence staining Tissue sections dried onto Superfrost microscope slides (Fisher brand) were deparaffinized in xylene, rehydrated in graded ethanol and rinsed in tap water. Incubating slides in a solution of 0.3% hydrogen peroxide in water for 30 min quenched endogenous peroxidase activity. Then slides were washed in water and incubated in normal blocking serum (Vectastain Elite ABC kit) for another 30 min to block non-specific sites. Excess serum was removed from the slides by blotting and incubated overnight in primary antibody (CFTR1: 500 V/V in buffer, Neo Markers; Lab Vision Corp., USA) at 4 8C. Tissue sections were washed for 5 min three times with PBS and incubated for 30 min in a diluted biotinylated secondary antibody solution (Vectastain Elite ABC kit). Tissue sections were again washed for 5 min three times in PBS and incubated for min in FITC-conjugated anti-mouse antibody (Vector Laboratories, Inc.), washed again in PBS, mounted with glycerol and observed under an Olympus epifluorescence microscope (Olympus IX-70, Japan). Three people who never took part in the slide preparation also evaluated the slides. Intensity values of immunofluores- 1229

3 L.C.Ajonuma et al. cence staining of NFT and HSP tissues were also analysed using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA). Statistical analysis Data presented are mean (SEM) for the ratio of CFTR/GAPDH expression intensities as analysed using 2% agarose gel electrophoresis. Differences between groups were assessed using Mann Whitney U-test and analysis of variance (ANOVA) with Newman Keuls multiple comparison test for immunohistochemical staining intensity and immunofluorescence staining intensity values. P # 0.05 was considered significant. Statistical analysis was done using GraphPad Prism (GraphPad Software Inc., USA). Results Masson s trichrome staining Masson s trichrome staining allows one to distinguish clearly between muscles, connective tissue and epithelium. Masson s trichrome staining of HSP tissues showed extensive epithelial loss, areas of epithelial transformation (flattening of epithelial cells and cuboidal transformation), different degrees of focal attenuation (Figure 1a c) and pseudostratification (Figure 1d) of HSP epithelium. Immunolocalization of CFTR in hydrosalpinx We further compared the immunolocalization of CFTR protein in HSP and NFT. Immunoreactive CFTR, obtained using CFTR antibody and a VIP substrate kit, was detected strongly in the focally attenuated and pseudostratified areas of HSP epithelium (Figure 2). In the healthy Fallopian tubes, CFTR was localized on the apical side of luminal epithelium only (Figure 2b), while in hydrosalpinx it was found in both apical and basolateral surfaces of the pseudostratified (Figure 2c, d) and focally attenuated (Figure 2e, f) epithelium. Staining intensity of HSP was significantly different from those of NFT and controls (P, , Figure 2g). Immunofluorescence staining further confirmed enhanced CFTR expression and abnormal localization in HSP (Figure 3). Densitometric measurements showed that the immunoreactive intensity in HSP was significantly different from that in NFT (P, , Figure 3e). CFTR expression by RT PCR To further compare the expression of CFTR mrna in HSP and NFT, semi-quantitative RT PCR was performed using GAPDH (515 bp) as internal marker. The PCR products obtained were the expected molecular weight sizes of human CFTR (554 bp). CFTR expression, as shown by CFTR/GAPDH ratio, in HSP was significantly greater than that in NFT (P ¼ , Figure 4). Discussion We have previously proposed that abnormalities in the transepithelial ion transport across HSP epithelium may be one of the important factors in the pathophysiology of post-infectious HF formation (Ajonuma et al., 2001). The present study has indeed confirmed epithelial transformation and upregulation of CFTR in HSP. Although extensive damage and loss of epithelial lining have been previously observed in HSP, areas of epithelial lining showing flattened and transformed epithelial cells have also been reported (David et al., 1969), consistent with our present observation. We have further demonstrated abnormality in CFTR expression and localization associated with the transformed epithelium in HSP. Instead of apical expression in the NFT, CFTR was predominantly found in the focally attenuated and pseudostratified areas of HSP epithelium. Elevated CFTR mrna expression in HSP was also demonstrated by semi-quantitative RT PCR. These data support the notion Figure 1. Masson s trichrome staining of hydrosalpinx (HSP) tissues showing extensive epithelial loss, areas of epithelial transformation (flattening of epithelial cells and cuboidal transformation), different degrees of focal attenuation (arrow, A C) and pseudostratification (arrows, D) of HSP epithelium. Magnification 40, bar ¼ 30 mm. L ¼ luminal epithelium. 1230

4 Increased CFTR expression in hydrosalpinx Figure 2. Immunohistochemical staining for cystic fibrosis transmembrane conductance regulator (CFTR) immunoreactivity on paraffin sections of normal Fallopian tubes (NFT) and hydrosalpinx (HSP). (A) Negative control, (B) apical localization of CFTR protein in NFT luminal epithelium (arrow). CFTR protein localization on the psudostratified (C, D) and focally attenuated (E, F) HSP epithelium. Magnification 40, bar ¼ 30 mm. Staining intensity measurements were done using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA) showed that the CFTR immuoreactive intensity in HSP was significantly different from that of NFT and control (*P, , Newman Keuls, G). L ¼ luminal epithelium; CONT. ¼ negative control. that CFTR, as a Cl 2 channel, may play an important role in HF formation. Ion channels are membrane proteins that act as gated pathways for the movement of ions across cell membranes. Fluid movements across secretory epithelia are secondary to ion movements, particularly Cl 2. The importance of ion movements across epithelia lies in their coupling with the movement of water, which is not actively transported but moves in response to osmotic gradients established by the transport of ions (Leese, 1988). CFTR expression has been reported in the reproductive tissues of rodents (Rochwerger and Buchwald, 1993; Chan et al., 2002) and humans (Rochwerger and Buchwald, 1993; Tizzano et al., 1994); its regulation by ovarian hormones has been well documented (Rochwerger and Buchwald, 1993; Mularoni et al., 1995) and attributed to the cyclic changes in uterine fluid volume 1231

5 L.C.Ajonuma et al. Figure 3. Immunofluorescence staining of hydrosalpinx (HSP) paraffin sections showing cystic fibrosis transmembrane conductance regulator (CFTR) protein localization on the pseudostratified and focally attenuated HSP epithelium (A B); (C) apical localization of CFTR on normal Fallopian tubes (NFT) epithelium and D, negative control in which normal serum was used and CFTR antibody was omitted. Magnification 20, bar ¼ 30 mm. Densitometric measurements using Meta Morph image analysis software version 6.0 showed that CFTR immuoreactive intensity in HSP was significantly different from that in NFT (P, , Figure 3E). L ¼ luminal epithelium (Chan et al., 2002) since expression of CFTR is expected to lead to significant increase in the osmotic water permeability (Kunzelmann and Mall, 2002). Therefore, transformed epithelial cells with increased expression of CFTR in HSP, as observed in this study, may be one of the underlying mechanisms for abnormal fluid secretion and accumulation in the HSP lumen. Increased CFTR expression in HSP, significantly more than the expression in NFT during mid late proliferative stage of the uterine cycle, when CFTR expression is maximal, is also suggestive of increased fluid secretion. The abnormal fluid accumulation in HSP may also result from the indirect effect of CFTR as a regulator of other epithelial channels and transporters, such as water channels, protein (aquaporin AQP) and epithelial sodium channels (ENaC). Up-regulation of water channel (Kunzelmann and Schreiber, 1997; Kunzelmann, 1999) and inhibition of ENaC function, and thus fluid reabsorption (Stutts et al., 1995) by CFTR could both lead to a net accumulation of fluid in HSP. Although the reason for the increased expression of CFTR observed in HSP remains to be investigated further, one possible cause may be infection. Salpingitis and pelvic inflammatory disease (PID) precede HSP and our previous study demonstrated evidence of chronic ongoing low-grade infection in HSP (L.C.Ajonuma et al., unpublished data). It has been reported that bacterial infections up-regulate CFTR expression (Resta-Lenert and Barrett, 2002). Cytokines produced during infection, suggested to be contributory to the adverse effects of HF (David et al., 1969) such as interleukin 1 beta (IL-1b) are potent modulators of CFTR (Cafferata et al., 2000). During infection, bacteria binding may stimulate receptor signalling, leading to protein tyrosine phosphorylation, and finally increased CFTR expression. The significance of the presence of focally attenuated and pseudostratified epithelium in HSP is not clear at the moment. However, it has been reported that Chlamydial infection alters the transcription of host cell genes including those for cell differentiation, transcription factors and inhibition of apoptosis (Xia et al., 2003). Proliferating and dedifferentiating epithelial cells may show changes in their ion transport or channel expression. Recently, it has been demonstrated that enhanced camp-activated Cl 2 secretion in the hyperproliferative colonic mucosa was caused by elevated CFTR

6 Increased CFTR expression in hydrosalpinx Figure 4. Cystic fibrosis transmembrane conductance regulator (CFTR) mrna expression in hydrosalpinx tissues. Representative gel of 2% agarose gel electrophoresis of RT PCR products for CFTR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in NFT and HSP samples. Band for GAPDH corresponds to 515 bp whereas CFTR band corresponds to 554 bp (above). Densitometric units of (CFTR/GAPDH) ratio in both NFT and HSP PCR products. CFTR expression in HSP is significantly different from NFT (*P ¼ ) (below). expression (Umar et al., 2000). The epithelial changes seen in this study, possibly induced by Chlamydial chronic infection, may have contributed at least in part to the increased CFTR expression. It has also been demonstrated that C. trachomatis infection results in increased tyrosine phosphorylation of several host proteins including those involved in signal transduction pathways (Bliska et al., 1993; Brikeland et al., 1994; Fawaz et al., 1997; Xia et al., 2003). In fact, our preliminary data showed that C. trachomatis inoculated into healthy Sprague Dawley rat uteri induced uterine infection, massive uterine fluid accumulation (as in HSP) and increased CFTR mrna expression (Ajonuma et al., 2004), supporting the notion that infection may lead to up-regulation of CFTR with concomitant changes in ion flux across the apical membrane including hypersecretion of chloride ions and inhibition of sodium reabsorption, together contributing to the net increase in electrolytes in the Fallopian tube accompanied with increased fluid accumulation producing HSP. Accumulation of HF in the Fallopian tubes and its regurgitation into the uterine cavity may be a contributing factor for infertility observed in HSP patients, and impaired implantation or endometrium receptivity of transferred embryos during IVF (Mansour et al., 1991; Meyer et al., 1997). This is consistent with the present finding that CFTR is up-regulated in HSP. In fact, the observed improved IVF outcome in HSP patients pretreated with antibiotics (Sharara et al., 1996; Hurst et al., 2001) may be due to the return of CFTR expression back to the normal level when infection had subsided, leading to reduced HF reflux into the uterine cavity. Salpingectomy prior to IVF has been reported to be beneficial (Strandell et al., 1999, 2001; Johnson et al., 2002), and currently, salpingectomy for large hydrosalpinges prior to IVF is an accepted practice. However, most patients are reluctant to consent to this procedure, which is also reflected in the small sample numbers in our study. Whether this represents the general HSP, most or a particular HSP histological type remains to be evaluated further. If treatment with CFTR specific inhibitors in conjunction with antibiotics improves IVF and embryo transfer outcome in a clinical trial, it will certainly be a more attractive option to most patients than salpingectomy. Therefore, clinical applicability of CFTR-specific inhibitors with antibiotics as potential adjunct treatment for HSP should be evaluated. In summary, the present study has demonstrated for the first time epithelial transformation with increased CFTR expression in human HSP, thus providing a possible molecular mechanism of HF formation in HSP and infertility. These findings may lead to the development of a new treatment strategy for tubal factor infertile patients with HSP. Acknowledgements The strategic programme of the Chinese University of Hong Kong, Hong Kong supported this study. References Aboulghar MA, Mansour RT and Serour GI (1998) Controversies in the modern management of hydrosalpinx. Hum Reprod Update 4, Ajonuma LC, Haines CJ and Chan HC (2001) Hydrosalpinx fluid and in vitro mouse embryo development. J Obstet Gynaecol Res 27, Ajonuma LC, Ng EH-Y and Chan HC (2002) New insights into the mechanism underlying hydrosalpinx fluid and its adverse effect on IVF outcome. Hum Reprod Update 8, Ajonuma LC, Tsang LL, Ho LS, Chung YW, Chan PSK and Chan HC (2004) Chlamydia trachomatis induced cystic fibrosis transmembrane conductance regulator (CFTR) expression in rat uterus and human colonic T84 cells. Cell Biol Inter 28,S4. Arrighi CV, Lucas H, El-mowafi D, Campana A and Chardonnes D (2001) Effects of human hydrosalpinx fluid on in vitro murine fertilization. Hum Reprod 16, Bayler SA, James KP and Meyer WR (1997) Hydrosalpingeal fluid inhibits in vitro embryonic development in a murine model. Hum Reprod 12, Birkelund S, Johnson H and Christiansen G (1994) Chlamydia trachomatis serovar L2 induces protein tyrosine phosphorylation during uptake by Hela Cells. Infect Immun 62, Blazar AS, Hogan JW, Seifer DB, Frishman GN, Wheeler CA and Haning RV (1997) The impact of hydrosalpinx on successful pregnancy in tubal factor infertility treated by in vitro fertilization. Fertil Steril 67, Bliska JB, Galan JE and Falkow S (1993) Signal transduction in the mammalian cell during bacteria attachment and entry. Cell 73, Cafferata EG, Gonzalez-Guerrico AM, Giordano L, Pivetta OH and Santa- Coloma TA (2000) Interleukin-1B regulates CFTR expression in human intestinal T84 cells. Biochim Biophys Acta 1500, Camus E, Poncelet C, Goffinet F, Wainer B, Merlet F, Nisand I and Philippe HJ (1999) Pregnancy rates after in-vitro fertilization in cases of tubal infertility with and without hydrosalpinx: a meta-analysis of published comparative studies. Hum Reprod 14, Carrasco I, Cebral E, Benitez R and Vantman D (2001) Hydrosalpinx fluid affects murine embryonic development in a coculture system with epithelial endometrial cells. Fertil Steril 75, Chan LN, Chung YW, Leung PS, Liu CQ and Chan HC (1999) Activation of an adenosine cyclic monophosphate-dependent Cl-conductance in response to neurohormonal stimuli in mouse endometrial epithelial cells: the role of cystic fibrosis transmembrane conductance regulator. Biol Reprod 60,

7 L.C.Ajonuma et al. Chan LN, Rochelle LG, Boucher RC and Chan HC (2002) Distribution of epithelial sodium channels (ENaC) subunits and cystic fibrosis transmembrane conductance regulator (CFTR) in murine reproductive tract. J Membr Biol 185, David A, Garcia CR and Czernobilsky B (1969) Human hydrosalpinx: histologic study and chemical composition of fluid. Am J Obstet Gynecol 105, Dickens CJ and Leese HJ (1994) The regulation of rabbit oviduct fluid formation. J Reprod Fertil 100, Fawaz FS, Van ooij C and Homola E (1997) Infection with Chlamydia trachomatis altars the tyrosine phosphorylation and /or localization of several host Cell protein including contacting. Infect Immun Hurst BS, Turker KE, Awoniyi CA and Schlaff WD (2001) Hydsrosalpinx treated with extended doxycycline does not compromise the success of in vitro fertilization. Fertil Steril 75, Johnson NP, Mak W and Sowter MC (2002) Laparoscopic salpingectomy for women with hydrosalpinges enhances the success of IVF: a Cochrane review. Hum Reprod 17, Koong MK, Jun JH, Song SJ, Lee HJ, Song IO and Kang IS (1998) A second look at the embryotoxicity of hydrosalpinx fluid: an in-vitro assessment in a murine model. Hum Reprod 13, Kunzelmann K (1999) The cystic fibrosis transmembrane conductance regulator and its function in epithelial transport. Rev Physiol Biochem Pharmacol 137,1 70. Kunzelmann K and Mall M (2002) Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol Rev 82, Kunzelmann K and Schreiber R (1997) CFTR, a regulator of channels. J Membr Biol 168,1 8. Leese HJ (1988) The formation and function of oviduct fluid. J Reprod Fertil 82, Leung AY, Wong PY, Gabriel SE, Yankaskas JR and Boucher RC (1995) camp-but not Ca 2þ -regulated Cl conductance in the oviductuct is defect in mouse model of cystic fibrosis. Am J Physiol. 268,C708 C712. Mansour R, Aboulghar M, Serour G and Riad R (1991) Fluid accumulation of the uterine cavity before embryo transfer: a possible hindrance for implantation. J In Vitro Fertil Embryo Transfer 8, Meyer WR, Castelbaum AJ, Somkuti S, Sagoskin AW, Doyle M, Harris JE and Lessey BA (1997) Hydrosalpinges adversely affects markers of endometrial receptivity. Hum Reprod 12, Mukherjee T, Copperman AB, McCaffrey C, Cook CA, Bustillo M and Obasaju MF (1996) Hydrosalpinx fluid has embryotoxic effects on murine embryogenesis: a case for prophylactic salpingectomy. Fertil Steril 66, Mularoni A, Beck L, Sadir R, Adessi GL and Nicollier M (1995) Downregulation by progesterone of CFTR expression in endometrial epithelial cells: a study by competitive RT-PCR. Biochem Biophy Res Commun 217, Murray CA, Clarke HJ, Tulandi T and Tan SL (1997) Inhibitory effect of human hydrosalpingeal fluid on mouth preimplantation embryonic development is significantly reduced by the addition of lactate. Hum Reprod 11, Ng EH, Yeung WS and Ho PC (1997) The presence of hydrosalpinx may not adversely affect the implantation and pregnancy rates in in vitro fertilization treatment. J Assist Reprod Genet 14, Ng EHY, Ajonuma LC, Lau EYL, Yeung WSB and Ho PC (2000) Adverse effects of hydrosalpinx fluid on sperm motility and survival. Hum Reprod 15, Quinton PM (1999) Physiological basis of cystic fibrosis: a historical perspective. Physiol Rev 79,S3 S22. Rawe VJ, Liu J, Shaffer S et al. (1997) Effect of human hydrosalpinx fluid on murine embryo development and implantation. Fertil Steril 68, Resta-Lenert S and Barett KE (2002) Enteroinvasive bacteria alter barrier and transport properties of human intestinal epithelium: role of inos and COX-2. Gastroenterology 122, Roberts JE, Clarke HJ, Tulandi T and Tan SL (1999) Effects of hydrosalpingeal fluid on murine embryo development and implantation. J Assist Reprod Genet 16, Rochwerger L and Buchwald M (1993) Stimulation of the cystic fibrosis transmembrane conductance regulator expression by estrogen in vivo. Endocrinology 133, Sachdev R, Kemmann E, Bohrer MK and El-Danasouri I (1997) Detrimental effect of hydrosalpinx fluid on the development and blastulation of mouse embryos in vitro. Fertil Steril 68, Sharara FI, Scott RT, Jr, Marut EL and Queenan JT, Jr (1996) In-vitro fertilization outcome in women with hydrosalpinx. Hum Reprod 11, Spandorfer SD, Liu HC, Neuer A, Barmat LI, Davis O and Rosenwaks Z (1999) The embryo toxicity of hydrosalpinx fluid is only apparent at high concentrations: an in vitro model that simulates in vivo events. Fertil Steril 71, Strandell A, Waldenstrom U, Nilsson L and Hamberger L (1994) Hydrosalpinx reduces in-vitro fertilization/embryo transfer pregnancy rates. Hum Reprod 9, Strandell A, Sjogren A, Bentin-Ley U, Thorburn J and Hamberger L (1998) Hydrosalpinx fluid does not adversely affect the normal development of human embryos and implantation in vitro. Hum Reprod 13, Strandell A, Lindhard A, Waldenstrom U, Thorburn J, Janson PO and Hanberger L (1999) Hydrosalpinx and IVF outcome: a prospective, randomized multicenter trial in Scandinavia on salpingectomy prior to IVF. Hum Reprod 14, Strandell A, Lindhard A, Waldenstrom U and Thorburn J (2001) Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial. Hum Reprod 16, Stutts MJ, Canesasa MC, Olsen JC, Hamrick JA, Rossier BC and Boucher RC (1995) CFTR as a camp-dependent regulator of sodium channels. Science 269, Tizzano EF, Silver MM, Chitayat D, Benichou JC and Buchwald M (1994) Differential cellular expression of cystic fibrosis transmembrane regulation in human reproductive tissues. Clues for the infertility in patients with cystic fibrosis. Am J Pathol 144, Umar S, Scott J, Sellin JH, Dubinsky WP and Morris AP (2000) Murine colonic mucosa hyperproliferation. Elevated CFTR expression and enhanced camp-dependent Cl 2 secretion. Am J Physiol Gastrointest Liver Physiol 278,G753 G764. Xia MS, Bumgarner RE, Lampe MF and Stamm WE (2003) Chlamydia trachomatis infection alters host cell transcription in diverse cellular pathways. J Infect Dis 187, Zeyneloglu HB, Arici A and Olive DL (1998) Adverse effects of hydrosalpinx on pregnancy rates after in vitro fertilization-embryo transfer. Fertil Steril 70, Submitted on February 20, 2004; resubmitted on January 04, 2005; accepted on January 10,

- (IVF-ET), IVF : ; ; IVF ; : ; - (IVF-ET); ; ; : R711.6 : A : X(2014)

- (IVF-ET), IVF : ; ; IVF ; : ; - (IVF-ET); ; ; : R711.6 : A : X(2014) 34 7 Vol.34 No.7 2014 7 Jul. 2014 Reproduction & Contraception doi: 10.7669/j.issn.0253-357X.2014.07.0584 E-mail: randc_journal@163.com ( 430060) - (-ET) : Essure : - (-ET) : R711.6 : A : 0253-357X(2014)07-0584-06

More information

THE POSSIBLE EFFECT OF HYDROSALPINX FLUID HUMAN EMBRYOS

THE POSSIBLE EFFECT OF HYDROSALPINX FLUID HUMAN EMBRYOS Prof D. Loutradis 1 st Obstetrics and Gynecology Department of University of Athens Alexandra Maternity Hospital THE POSSIBLE EFFECT OF HYDROSALPINX FLUID HUMAN EMBRYOS Tubal factor Infertility IVF was

More information

Adverse effects of hydrosalpinx on pregnancy rates after in vitro fertilization embryo transfer

Adverse effects of hydrosalpinx on pregnancy rates after in vitro fertilization embryo transfer FERTILITY AND STERILITY VOL. 70, NO. 3, SEPTEMBER 1998 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Adverse effects

More information

Ernest Hung Yu Ng, M.D., Carina Chi Wai Chan, M.B.B.S., Oi Shan Tang, M.D., and Pak Chung Ho, M.D.

Ernest Hung Yu Ng, M.D., Carina Chi Wai Chan, M.B.B.S., Oi Shan Tang, M.D., and Pak Chung Ho, M.D. Comparison of endometrial and subendometrial blood flows among patients with and without hydrosalpinx shown on scanning during in vitro fertilization treatment Ernest Hung Yu Ng, M.D., Carina Chi Wai Chan,

More information

Relationship between cytokines and the embryotoxicity of hydrosalpingeal fluid

Relationship between cytokines and the embryotoxicity of hydrosalpingeal fluid ( C 2005) DOI: 10.1007/s10815-005-4913-7 Assisted Reproduction Relationship between cytokines and the embryotoxicity of hydrosalpingeal fluid Mohamed A. Bedaiwy, 1,4 Tommaso Falcone, 1 Jeffrey M. Goldberg,

More information

Cost effectiveness analysis of salpingectomy prior to IVF, based on a randomized controlled trial

Cost effectiveness analysis of salpingectomy prior to IVF, based on a randomized controlled trial Human Reproduction Vol.20, No.12 pp. 3284 3292, 2005 Advance Access publication August 11, 2005. doi:10.1093/humrep/dei244 Cost effectiveness analysis of salpingectomy prior to IVF, based on a randomized

More information

Expression of alpha 1 and beta 3 integrins subunits in the endometrium of patients with tubal phimosis or hydrosalpinx

Expression of alpha 1 and beta 3 integrins subunits in the endometrium of patients with tubal phimosis or hydrosalpinx REPRODUCTIVE BIOLOGY Expression of alpha 1 and beta 3 integrins subunits in the endometrium of patients with tubal phimosis or hydrosalpinx Ricardo Francalacci Savaris, Ph.D., a José Luiz Pedrini, M.Sc.,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

The Presence of Hydrosalpinx May Not Adversely Affect the Implantation and Pregnancy Rates in In Vitro Fertilization Treatment1

The Presence of Hydrosalpinx May Not Adversely Affect the Implantation and Pregnancy Rates in In Vitro Fertilization Treatment1 CLINICAL ASSISTED REPRODUCTION The Presence of Hydrosalpinx May Not Adversely Affect the Implantation and Pregnancy Rates in In Vitro Fertilization Treatment1 ERNEST HUNG-YU NG,2,3 WILLIAM SHU-BIU YEUNG,2

More information

Proximal tubal occlusion and salpingectomy result in similar improvement in in vitro fertilization outcome in patients with hydrosalpinx

Proximal tubal occlusion and salpingectomy result in similar improvement in in vitro fertilization outcome in patients with hydrosalpinx Proximal tubal occlusion and salpingectomy result in similar improvement in in vitro fertilization outcome in patients with hydrosalpinx Antonios Kontoravdis, M.D., a Evangelos Makrakis, M.D., a Konstantinos

More information

Salpingectomy increases peri-implantation endometrial HOXA10 expression in women with hydrosalpinx

Salpingectomy increases peri-implantation endometrial HOXA10 expression in women with hydrosalpinx Salpingectomy increases peri-implantation endometrial HOXA10 expression in women with hydrosalpinx Gaurang S. Daftary, M.D., Umit Kayisli, Ph.D., Emre Seli, M.D., Orhan Bukulmez, M.D., Aydin Arici, M.D.,

More information

NF kappab expression increases and CFTR and MUC1 expression decreases in the endometrium of infertile patients with hydrosalpinx: a comparative study

NF kappab expression increases and CFTR and MUC1 expression decreases in the endometrium of infertile patients with hydrosalpinx: a comparative study Song et al. Reproductive Biology and Endocrinology 2012, 10:86 RESEARCH Open Access NF kappab expression increases and CFTR and MUC1 expression decreases in the endometrium of infertile patients with hydrosalpinx:

More information

Fluid accumulation within the uterine cavity reduces pregnancy rates in women undergoing IVF

Fluid accumulation within the uterine cavity reduces pregnancy rates in women undergoing IVF Human Reproduction Vol.17, No.2 pp. 351 356, 2002 Fluid accumulation within the uterine cavity reduces pregnancy rates in women undergoing IVF Li-Wei Chien, Heng-Kien Au, Jean Xiao and Chii-Ruey Tzeng

More information

Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial*

Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial* Human Reproduction Vol.16, No.11 pp. 2403 2410, 2001 Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial* A.Strandell 1,4, A.Lindhard 2, U.Waldenström

More information

Adverse effects of hydrosalpinx fluid on sperm motility and survival

Adverse effects of hydrosalpinx fluid on sperm motility and survival Human Reproduction vol.15 no.4 pp.772 777, 2000 Adverse effects of hydrosalpinx fluid on sperm motility and survival Ernest Hung Yu Ng 1, Louis C.Ajonuma, Estella Yee to demonstrate any adverse effect.

More information

Ultrasound-guided hydrosalpinx aspiration during oocyte collection improves pregnancy outcome in IVF: a randomized controlled trial

Ultrasound-guided hydrosalpinx aspiration during oocyte collection improves pregnancy outcome in IVF: a randomized controlled trial Human Reproduction Vol.23, No.5 pp. 1113 1117, 2008 Advance Access publication on March 13, 2008 doi:10.1093/humrep/den071 Ultrasound-guided hydrosalpinx aspiration during oocyte collection improves pregnancy

More information

Removal of hydrosalpinges increases endometrial leukaemia inhibitory factor (LIF) expression at the time of the implantation window

Removal of hydrosalpinges increases endometrial leukaemia inhibitory factor (LIF) expression at the time of the implantation window Human Reproduction Vol.20, No.11 pp. 3012 3017, 2005 Advance Access publication July 15, 2005. doi:10.1093/humrep/dei188 Removal of hydrosalpinges increases endometrial leukaemia inhibitory factor (LIF)

More information

SALPINGITIS IN OVARIAN ENDOMETRIOSIS

SALPINGITIS IN OVARIAN ENDOMETRIOSIS FERTILITY AND STERILITY Copyright 1978 The American Fertility Society Vol. 30, No. 1, July 1978 Printed in U.S.A. SALPINGITIS IN OVARIAN ENDOMETRIOSIS BERNARD CZERNOBILSKY, M.D.*t ALAN SILVERSTEIN, M.D.

More information

Usama M Fouda *, Ahmed M Sayed, Hatem I Abdelmoty and Khaled A Elsetohy

Usama M Fouda *, Ahmed M Sayed, Hatem I Abdelmoty and Khaled A Elsetohy Fouda et al. BMC Women's Health (2015) 15:21 DOI 10.1186/s12905-015-0177-2 RESEARCH ARTICLE Open Access Ultrasound guided aspiration of hydrosalpinx fluid versus salpingectomy in the management of patients

More information

Hydrosalpinx and IVF outcome: a prospective, randomized multicentre trial in Scandinavia on salpingectomy prior to IVF*

Hydrosalpinx and IVF outcome: a prospective, randomized multicentre trial in Scandinavia on salpingectomy prior to IVF* Hydrosalpinx and IVF outcome: a prospective, randomized multicentre trial in Scandinavia on prior to IVF* A.Strandell, A.Lindhard, U.Waldenstrom, J.Thorburn, P.O.Janson, L.Hamberger 1,4 1 3 1 1 Department

More information

New insights into the mechanisms underlying hydrosalpinx uid formation and its adverse effect on IVF outcome

New insights into the mechanisms underlying hydrosalpinx uid formation and its adverse effect on IVF outcome Human Reproduction Update, Vol.8, No.3 pp. 255±264, 2002 New insights into the mechanisms underlying hydrosalpinx uid formation and its adverse effect on IVF outcome Louis Chukwuemeka Ajonuma 1 Ernest

More information

Hydrosalpinges adversely affect markers of endometrial receptivity

Hydrosalpinges adversely affect markers of endometrial receptivity Human Reproduction vol.12 no.7 pp.1393 1398, 1997 OUTSTANDING CONTRIBUTION Hydrosalpinges adversely affect markers of endometrial receptivity W.R.Meyer 1, A.J.Castelbaum 2, S.Somkuti 3, fertilization (IVF)

More information

An Overview of Uterine Factors That Influence Implantation

An Overview of Uterine Factors That Influence Implantation An Overview of Uterine Factors That Influence Implantation Bulent Urman, M.D. Dept. of Obstetrics and Gynecology Koc University School of Medicine Assisted Reproduction Unit, American Hospital, ISTANBUL

More information

V. Mijatovic S. Veersema M.H. Emanuel R. Schats P.G. Hompes. Fertil Steril. 2010;93:

V. Mijatovic S. Veersema M.H. Emanuel R. Schats P.G. Hompes. Fertil Steril. 2010;93: Essure hysteroscopic tubal occlusion device for the treatment of hydrosalpinx prior to in vitro fertilization-embryo transfer in patients with a contraindication for laparoscopy. V. Mijatovic S. Veersema

More information

Is hydrosalpinx fluid cytotoxic?

Is hydrosalpinx fluid cytotoxic? Human Reproduction vol.13 no.6 pp.1620 1624, 1998 Is hydrosalpinx fluid cytotoxic? I.Granot 1,3, N.Dekel 2, I.Segal 1, S.Fieldust 1, Z.Shoham 1 and A.Barash 1 1 IVF Unit, Department of Obstetrics and Gynaecology,

More information

Effect of hydrosalpinx fluid on secretion of trophoblastic matrix metalloproteinases

Effect of hydrosalpinx fluid on secretion of trophoblastic matrix metalloproteinases FERTILITY AND STERILITY VOL. 77, NO. 3, MARCH 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Effect of hydrosalpinx

More information

HRP cytochemistry. Division of Radiooncology, Deutsches Krebsforschungszentrum, Heidelberg, Germany

HRP cytochemistry. Division of Radiooncology, Deutsches Krebsforschungszentrum, Heidelberg, Germany HRP cytochemistry WOLF D. KUHLMANN, M.D. Division of Radiooncology, Deutsches Krebsforschungszentrum, 69120 Heidelberg, Germany A range of substrates is available for the cytochemical staining of peroxidase

More information

What location in the gastrointestinal (GI) tract has tight, or impermeable, junctions between the epithelial cells?

What location in the gastrointestinal (GI) tract has tight, or impermeable, junctions between the epithelial cells? CASE 32 A 17-year-old boy presents to his primary care physician with complaints of diarrhea for the last 2 days. The patient states that he just returned to the United States after visiting relatives

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

150 mm HCO How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell

150 mm HCO How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell JOP. J. Pancreas (Online) 2001; 2(4 Suppl):198202. 150 mm How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell Yoshiro Sohma 1, Michael A Gray 2, Yusuke Imai 1, Barry E Argent 2

More information

Dr. P. M. Gopinath. Director & Senior Consultant Institute of OBG & IVF SRM Institute for Medical Sciences Chennai

Dr. P. M. Gopinath. Director & Senior Consultant Institute of OBG & IVF SRM Institute for Medical Sciences Chennai Dr. P. M. Gopinath PRESENT DESIGNATI ON: PRESENT AFFILIATIO NS: MAJOR ACHIEVEM ENTS: Director & Senior Consultant Institute of OBG & IVF SRM Institute for Medical Sciences Chennai Vice President of FERTILITY

More information

Part II Serology Caroline Bax BW.indd 55 Caroline Bax BW.indd : :17

Part II Serology Caroline Bax BW.indd 55 Caroline Bax BW.indd : :17 Part II Serology part II Chapter 4 Comparison of serological assays for detection of Chlamydia trachomatis antibodies in different groups of obstetrical and gynaecological patients C.J. Bax J.A.E.M. Mutsaers

More information

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], Supplementary information Methods Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], and A/Hong Kong/213/03 [H5N1]) were grown in Madin-Darby canine kidney (MDCK) cells

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Hung-Ching Liu, Ph.D., Zhi-Ying He, M.S., Carol A. Mele, B.A., Lucinda L. Veeck, M.L.T., D.Sc., Owen Davis, M.D., and Zev Rosenwaks, M.D.

Hung-Ching Liu, Ph.D., Zhi-Ying He, M.S., Carol A. Mele, B.A., Lucinda L. Veeck, M.L.T., D.Sc., Owen Davis, M.D., and Zev Rosenwaks, M.D. FERTILITY AND STERILITY VOL. 71, NO. 2, FEBRUARY 1999 Copyright 1999 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Human endometrial

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,

More information

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal

More information

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

HYDROSALPINX SIMPLEX AS SEEN BY THE SCANNING ELECTRON MICROSCOPE*

HYDROSALPINX SIMPLEX AS SEEN BY THE SCANNING ELECTRON MICROSCOPE* FERTILITY AND STERILITY Copyright," 1977 The American Fertility Society Vol. 28, No.9, September 1977 Printed in U.s.A. HYDROSALPINX SIMPLEX AS SEEN BY THE SCANNING ELECTRON MICROSCOPE* EVA PATEK, M.D.t

More information

A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets

A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.

More information

IN VITRO FERTILIZATION OF RABBIT EGGS IN OVIDUCT SECRETIONS FROM DIFFERENT DAYS BEFORE AND AFTER OVULATION*

IN VITRO FERTILIZATION OF RABBIT EGGS IN OVIDUCT SECRETIONS FROM DIFFERENT DAYS BEFORE AND AFTER OVULATION* FERTILITY AND STERILITY Copyright~ 1975 The American Fertility Society Vol. 26, No.7, July 1975 Printed in U.SA. IN VITRO FERTILIZATION OF RABBIT EGGS IN OVIDUCT SECRETIONS FROM DIFFERENT DAYS BEFORE AND

More information

In-vitro fertilization outcome in women with hydrosalpinx*

In-vitro fertilization outcome in women with hydrosalpinx* Human Reproduction vol.11 no.3 pp.526-530, 1996 In-vitro fertilization outcome in women with hydrosalpinx* Fady LSharara 1 * 3, Richard TScott Jr 2, Edward L-Marut 1 and John T.Queenan Jr 1 'Division of

More information

Application of OMICS technologies on Gamete and Embryo Selection

Application of OMICS technologies on Gamete and Embryo Selection Application of OMICS technologies on Gamete and Embryo Selection Denny Sakkas, Ph.D. Scientific Director, Boston IVF Waltham, MA, USA THE FUTURE ROLE OF THE EMBRYOLOGIST WILL FOCUS ON PROVIDING OUR PATIENTS

More information

The impact of HSF on endometrium

The impact of HSF on endometrium ORIGINAL ARTICLE The impact of HSF on endometrium The impact of HSF on endometrium Hongchu Bao 1, Guichan Wang 2, Xin Huang 1, Meimei Wang 1, Xinrong Wang 1, Cuifang Hao 1 * 1 Department of Reproductive

More information

INDICATIONS OF IVF/ICSI

INDICATIONS OF IVF/ICSI PROCESS OF IVF/ICSI INDICATIONS OF IVF/ICSI IVF is most clearly indicated when infertility results from one or more causes having no other effective treatment; Tubal disease. In women with blocked fallopian

More information

Protein MultiColor Stable, Low Range

Protein MultiColor Stable, Low Range Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:

More information

The subcortical maternal complex controls symmetric division of mouse zygotes by

The subcortical maternal complex controls symmetric division of mouse zygotes by The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,

More information

Pregnancy Outcome ABSTRACT. KEY WORDS heat shock proteins; chlamydia; infertility

Pregnancy Outcome ABSTRACT. KEY WORDS heat shock proteins; chlamydia; infertility Infectious Diseases in Obstetrics and Gynecology 7:35-38 (1999) (C) 1999 Wiley-Liss, Inc. Immunity to Heat Shock Proteins and Pregnancy Outcome S.S. Witkin* Division of Immunology and Infectious Diseases,

More information

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada

More information

Prince of Wales Hospital, Shatin, New Territories, Hong Kong, China

Prince of Wales Hospital, Shatin, New Territories, Hong Kong, China REPRODUCTIVE BIOLOGY FERTILITY AND STERILITY VOL. 75, NO. 5, MAY 2001 Copyright 2001 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Regulation

More information

IHC Polymer. BioGenex Website. Presented for: Presented by: Date: BioGenex Tech Support 2016

IHC Polymer. BioGenex Website. Presented for: Presented by: Date: BioGenex Tech Support 2016 IHC Polymer Presented for: Presented by: Date: BioGenex Website BioGenex Tech Support 2016 Immunohistochemistry (IHC) Quick Guide# Super SensitiveTM Polymer-HRP kits. Baking An-gen Retrieval DeWax Overnight,

More information

The Soil Test for Your Endometrium : the Endometrial Function Test (EFT )

The Soil Test for Your Endometrium : the Endometrial Function Test (EFT ) The Soil Test for Your Endometrium : the Endometrial Function Test (EFT ) Harvey J. Kliman, MD, PhD Yale University School of Medicine A healthy pregnancy is like a successful garden. The successful garden

More information

PRETREATMENT ASSESSMENT & MANAGEMENT (MODULE 1 B) March, 2018

PRETREATMENT ASSESSMENT & MANAGEMENT (MODULE 1 B) March, 2018 PRETREATMENT ASSESSMENT & MANAGEMENT (MODULE 1 B) March, 2018 Clinical Assessment A thorough clinical evaluation is a prerequisite for ART A thorough clinical evaluation as detailed in the female and male

More information

Clinical aspect of endometrial injury!

Clinical aspect of endometrial injury! Clinical aspect of endometrial injury! Zeev Shoham, M.D. Department of Obstetrics and Gynecology Kaplan Hospital, Rehovot, Israel Implantation Process Good morphology embryo Normal uterus & receptive endometrium

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/- Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-

More information

Managing infertility when adenomyosis and endometriosis co-exist

Managing infertility when adenomyosis and endometriosis co-exist Managing infertility when adenomyosis and endometriosis co-exist Jinhua Leng Beijing,China Endometriosis Endometriosis (EM) is a common, benign, ovary hormone-dependent gynecologic disorder which affects

More information

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)

More information

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

Surgical treatment of hydrosalpinx improves the expressions of estrogen receptor and progesterone receptor in the endometrium in implantation window.

Surgical treatment of hydrosalpinx improves the expressions of estrogen receptor and progesterone receptor in the endometrium in implantation window. Biomedical Research 2013; 24 (1): 72-76 ISSN 0970-938X Surgical treatment of hydrosalpinx improves the expressions of estrogen receptor and progesterone receptor in the endometrium in implantation window.

More information

Pelvic Inflammatory Disease (PID) Max Brinsmead PhD FRANZCOG July 2011

Pelvic Inflammatory Disease (PID) Max Brinsmead PhD FRANZCOG July 2011 Pelvic Inflammatory Disease (PID) Max Brinsmead PhD FRANZCOG July 2011 This talk What is Pelvic Inflammatory Disease? Why it is important How it is spread Diagnosis Treatment Prevention What is PID? Inflammation

More information

Controversies in the modern management of hydrosalpinx

Controversies in the modern management of hydrosalpinx Human Reproduction Update 1998, Vol. 4, No. 6 pp. 882 890 European Society of Human Reproduction and Embryology Controversies in the modern management of hydrosalpinx M.A.Aboulghar 1, R.T.Mansour and G.I.Serour

More information

Christine Herde, MD, FACOG

Christine Herde, MD, FACOG Christine Herde, MD, FACOG Vice Chair, Department of OB/GYN CareMount Medical, Mount Kisco, NY Assistant Director of OB/GYN, Mount Sinai Health System at CareMount Medical 1. OSE presumption that Ovarian

More information

Patterns of E.cadherin and Estrogen receptor Expression in Histological Sections of Sudanese Patients with Breast Carcinoma

Patterns of E.cadherin and Estrogen receptor Expression in Histological Sections of Sudanese Patients with Breast Carcinoma Patterns of E.cadherin and Estrogen receptor Expression in Histological Sections of Sudanese Patients with Breast Carcinoma Hadia. Mohammed. Abdalla. Abdalrhman *, Elsadig.A.Adam, Ayda.D.A.Allatif 3,'Namareg.E.Afadul

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: van Seters M, van Beurden M, ten Kate FJW, et al. Treatment

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC FIBROSIS PANCREATIC DUCT EPITHELIA

BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC FIBROSIS PANCREATIC DUCT EPITHELIA Cell Biology International 2002, Vol. 26, No. 12, 1011 1018 doi:10.1006/cbir.2002.0960, available online at http://www.idealibrary.com on BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC

More information

FOR LABORATORY USE ONLY

FOR LABORATORY USE ONLY YK060 Insulin ELISA FOR LABORATORY USE ONLY Kasumigaseki Place, 3-6-7, Kasumigaseki, Chiyoda-ku Tokyo 100-0013 Japan URL: http://www.sceti.co.jp/export/ e-mail: medical@sceti.co.jp Contents

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Tumor Necrosis Factor-Alpha (TNF- a) Expression in Mice Infected with Aspergillus Fumigatus Using Immunohistochemichal Technique

Tumor Necrosis Factor-Alpha (TNF- a) Expression in Mice Infected with Aspergillus Fumigatus Using Immunohistochemichal Technique International Journal of Sciences: Basic and Applied Research (IJSBAR) ISSN 2307-4531 (Print & Online) http://gssrr.org/index.php?journal=journalofbasicandapplied ----------------------------------------------------------------------------------------------------------------

More information

Endometriosis is an enigmatic disease of unknown origin.

Endometriosis is an enigmatic disease of unknown origin. The Depolarized Expression of the Alpha-6 Integrin Subunit in the Endometria of Women With Endometriosis María del Mar Vernet-Tomás, MD, PhD, Carlos Tomás Pérez-Ares, MD, PhD, Núria Verdú, MD, María Teresa

More information

Case 1. Pathology of gynecological cancer. What do we need to know (Case 1) Luca Mazzucchelli Istituto cantonale di patologia Locarno

Case 1. Pathology of gynecological cancer. What do we need to know (Case 1) Luca Mazzucchelli Istituto cantonale di patologia Locarno Case 1 Pathology of gynecological cancer. What do we need to know (Case 1) Luca Mazzucchelli Istituto cantonale di patologia Locarno SAMO Interdisciplinary Workshop on Gynecological Tumors Lucern, October

More information

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,

More information

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,

More information

The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes

The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes Cantaurus, Vol. 5, -, May 7 McPherson College Division of Science and Technology The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes Callie Crist, Elizabeth

More information

Endometriosis of the Appendix Resulting in Perforated Appendicitis

Endometriosis of the Appendix Resulting in Perforated Appendicitis 27 Endometriosis of the Appendix Resulting in Perforated Appendicitis Toru Hasegawa a Koichi Yoshida b Kazuhiro Matsui c a Department of Obstetrics and Gynecology, Faculty of Medicine, University of Toyama,

More information

Surgical treatment for hydrosalpinx prior to in-vitro fertilization embryo transfer: a network meta-analysis

Surgical treatment for hydrosalpinx prior to in-vitro fertilization embryo transfer: a network meta-analysis Ultrasound Obstet Gynecol 216; 48: 434 445 Published online 13 September 216 in Wiley Online Library (wileyonlinelibrary.com). DOI: 1.12/uog.159 Surgical treatment for hydrosalpinx prior to in-vitro fertilization

More information

ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium

ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium Martin C, Coolen N, Wu YZ, Thévenot G, Touqui L, PrulièreEscabasse V, Papon JF, Coste

More information

Pinpoint Slide RNA Isolation System II Catalog No. R1007

Pinpoint Slide RNA Isolation System II Catalog No. R1007 INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

Biology of fertility control. Higher Human Biology

Biology of fertility control. Higher Human Biology Biology of fertility control Higher Human Biology Learning Intention Compare fertile periods in females and males What is infertility? Infertility is the inability of a sexually active, non-contracepting

More information

(FITC) or rhodamine blue isothiocyanate (RBITC) for use in mixed egg-transfer experiments. Both FITC and RBITC bind to the zona pellucida

(FITC) or rhodamine blue isothiocyanate (RBITC) for use in mixed egg-transfer experiments. Both FITC and RBITC bind to the zona pellucida THE LABELLING OF LIVING RABBIT OVA WITH FLUORESCENT DYES J. W. OVERSTREET Department of Anatomy and International Institute for the Study of Human Reproduction, Columbia University, College of Physicians

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

GLP-2 ELISA. For the quantitative determination of GLP-2 in human serum and plasma samples.

GLP-2 ELISA. For the quantitative determination of GLP-2 in human serum and plasma samples. GLP-2 ELISA For the quantitative determination of GLP-2 in human serum and plasma samples. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 48-GP2HU-E01.1 Size: 96 wells Version:

More information

Pepsin Solution ready-to-use

Pepsin Solution ready-to-use SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats.

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Paul W. Ackermann, MD, PhD 1, Aisha Ahmed, PhD 1, Nicos Schizas, MD 1, Jian Li, MD, PhD 1, Mahmood

More information

Human Obestatin ELISA

Human Obestatin ELISA K-ASSAY Human Obestatin ELISA For the quantitative determination of obestatin in human serum and plasma Cat. No. KT-495 For Research Use Only. 1 Rev. 081309 K-ASSAY PRODUCT INFORMATION Human Obestatin

More information

Appendix 1. A. Procedure for preparing histopathology slides. The liver removed and stored immediately in buffered formalin 10 % for

Appendix 1. A. Procedure for preparing histopathology slides. The liver removed and stored immediately in buffered formalin 10 % for Appendix 1 A. Procedure for preparing histopathology slides. The liver removed and stored immediately in buffered formalin 10 % for histopathological examination. The tissue fixed for at least 48 hours

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information