supplementary information

Size: px

Start display at page:

Download "supplementary information"

Malcolm Harrell
5 years ago
Views:

Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development nd in 2-cell stge emryos.

for immunostining with H3K4me1 ntiody (cm 8895) () or ntiody (cm 7766) ().

Note tht re zygotic stges efore repliction; S-phse tkes plce mostly during PN3 nd PN4, nd is the ltest pronucler stge.

Single sections where femle (left) nd mle (right) pronuclei dimeter ws mximl re shown (Middle section).

1 DOI: /nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development nd in 2-cell stge emryos. Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 X CD1 crosses nd processed immeditely for immunostining with H3K4me1 ntiody (cm 8895) () or ntiody (cm 7766) (). In ll figures, PN stges were determined ccording to Adenot et l 1. Note tht re zygotic stges efore repliction; S-phse tkes plce mostly during PN3 nd PN4, nd is the ltest pronucler stge. Shown re representtive zygotes t the, PN3-4 nd stges nd 2-cell stge emryo. Single sections where femle (left) nd mle (right) pronuclei dimeter ws mximl re shown (Middle section). Full (mximl) projections of Z-sections cquired every 1 mm re lso shown on the right. The confocl prmeters used for the cquisition were identicl nd fluorescence levels re therefore comprle. Mle nd Femle pronuclei re indicted in the full projection pnel. Scle r is 10 mm. Where visile, the position of the polr ody () is indicted. Emryos shown re representtive of three independent experiments with t lest 16 emryos nlysed. 1

H3K4me3 H3K4me3 H3K4me3 H3K4me3 H3K4me3 H3K4me3 PN 5 H3K4me3 H3K4me3 H3K4me3 2-cell stge

S2 Pttern of loclistion of H3K4me3 () nd H3K27me1 () during zygotic development nd in 2-cell

Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 X CD1

04-745) () or H3K27me1 ntiody (Upstte/ Millipore 07-448) ().

Single sections where femle (left) nd mle (right) pronuclei dimeter ws mximl re shown ().

The confocl prmeters used for the cquisition were identicl nd fluorescence levels re therefore

2 H3K4me3 H3K4me3 H3K4me3 H3K4me3 H3K4me3 H3K4me3 PN 5 H3K4me3 H3K4me3 H3K4me3 2-cell stge H3K27me1 H3K27me1 H3K27me1 H3K27me1 H3K27me1 H3K27me1 H3K27me1 H3K27me1 tge 2-cell st Figure S2 Pttern of loclistion of H3K4me3 () nd H3K27me1 () during zygotic development nd in 2-cell stge emryos. Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 X CD1 crosses nd processed immeditely for immunostining with H3K4me3 ntiody (Upstte/Millipore ) () or H3K27me1 ntiody (Upstte/ Millipore ) (). Shown re representtive zygotes t the, PN3-4 nd stges nd 2-cell stge. Single sections where femle (left) nd mle (right) pronuclei dimeter ws mximl re shown (). Full projections of Z-sections cquired every 1 mm re lso shown on the right. The confocl prmeters used for the cquisition were identicl nd fluorescence levels re therefore comprle. Mle nd Femle pronuclei re indicted in the full projection pnel. Scle r is 10 mm. Where visile, the position of the polr ody () is indicted. Emryos shown re representtive of three independent experiments with t lest 17 emryos nlysed. 2

H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 2-cell stge 2-cell stge Figure S3 Accumultion

Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 crosses nd processed immeditely for

Shown re representtive zygotes t the, PN3-4 nd stges nd 2-cell stge emryo.

Full projections of Z-sections cquired every 1 mm re lso shown on the right.

3 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 H3K27me2 2-cell stge 2-cell stge Figure S3 Accumultion of H3K27me2 () nd () during zygotic development nd in 2-cell stge emryos. Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 crosses nd processed immeditely for immunostining with H3K27me2 ntiody (cm 24684) () or ntiody (Upstte/Millipore ) (). Shown re representtive zygotes t the, PN3-4 nd stges nd 2-cell stge emryo. Single sections where femle (left) nd mle (right) pronuclei dimeter is mximl re shown (). Full projections of Z-sections cquired every 1 mm re lso shown on the right. The confocl prmeters used for cquisition were identicl nd fluorescence levels re therefore comprle. Mle nd Femle pronuclei re indicted in the full projection pnels. Scle r is 10 mm. Where visile, the position of the polr ody () is indicted. Emryos shown re representtive of two independent experiments with t lest 14 emryos nlysed. 3

H3K9me2 H3K9me2 H3K9me2 H3K9me2 H3K9me2 H3K9me2 PN 5 H3K9me2 H3K9me2 H3K9me2 2-cell stge H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3

Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 X CD1 crosses nd processed immeditely for immunostining

The confocl prmeters used for the cquisition were identicl nd fluorescence levels re therefore comprle.

4 H3K9me2 H3K9me2 H3K9me2 H3K9me2 H3K9me2 H3K9me2 PN 5 H3K9me2 H3K9me2 H3K9me2 2-cell stge H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 H3K9me3 ge 2-cell stg Figure S4 Pttern of loclistion of H3K9me2 () or H3K9me3 () during zygotic development nd in 2-cell stge emryos. Zygotes t different pronucler (PN) stges or 2-cell stge emryos were collected from CD1 X CD1 crosses nd processed immeditely for immunostining with H3K9me2 ntiody (Upstte/Millipore ) or H3K9me3 ntiody (Upstte/Millipore ). Shown re representtive zygotes t the, PN3-4 nd stges nd 2-cell stge emryo. Note tht the fct tht the two prentl genomes do not mix cn e seen t the 2-cell stge in (), where H3K9me3 stins strongly only hlf nucleus (e.g. mternl chromtin). Single sections where femle (left) nd mle (right) pronuclei dimeter ws mximl re shown (). Full projections of Z-sections cquired every 1 mm re lso shown on the right. The confocl prmeters used for the cquisition were identicl nd fluorescence levels re therefore comprle. Mle nd Femle pronuclei re indicted in the full projection pnel. Note tht H3K9me3 is enriched round the nucleolrlike odies NLBs in the femle pronucleus (rrow)(see lso ref 2), ut is undetectle in the mle pronucleus. Scle r is 10 mm. Where visile, the position of the polr ody () is indicted. Emryos shown re representtive of three independent experiments with t lest 18 emryos nlysed. 4

H3.3 wt mrna (ng/ l) 375 300 Development Altered development/ Anorml nucler s t ructure Altered development/ Anorml nucler s t ructure 260 OK 200 OK 150 OK 120 OK H3K27me1 H3.3 K27R H3.

Estlishment of conditions for expressing exogenous histones in erly emryos.

experimentlly the mount of exogenous histones tht emryos cn tolerte. For this, we injected vrious mounts of H3.

We found tht emryos displyed developmentl defects when greter thn 260ng/ml mrna ws injected. We oserved no developmentl defects in multiple experiments when 260ng/ml or less ws injected.

detrimentl effects. -c. Effects of H3.3 -GFP wild type or K27R mutnt on glol H3K27me1 nd. Zygotes were microinjected t the fertilistion cone stge with mrna for H3.

Shown re middle sections (left) or full projections (right) of confocl Z-series of representtive emryos shown in Figure 4-.

5 H3.3 wt mrna (ng/ l) Development Altered development/ Anorml nucler s t ructure Altered development/ Anorml nucler s t ructure 260 OK 200 OK 150 OK 120 OK H3K27me1 H3.3 K27R H3.3 wt c Single sections H3.3 K27R H3.3 wt Single sections d non-injected H3K4me3 H3K4me3 H3K4me3/ H3K27me1 H3K27me1 H3K27me1/ non-injected / HP1β HP1β HP1β/ Figure S5. Estlishment of conditions for expressing exogenous histones in erly emryos. Becuse it is well estlished tht expression of exogenous histones t levels in excess of just 10-15% of the endogenous cn elicit detrimentl effects (for exmple, see ref 3), we first titrted experimentlly the mount of exogenous histones tht emryos cn tolerte. For this, we injected vrious mounts of H3.3 wt mrna to determine the mximum mount of exogenous mrna tht the emryos could tolerte without ltering development. We found tht emryos displyed developmentl defects when greter thn 260ng/ml mrna ws injected. We oserved no developmentl defects in multiple experiments when 260ng/ml or less ws injected. Although our pproch does not provide direct quntittion of the mount of exogenous histone reltive to endogenous, it does indicte the 'sfe' level of histone mrna tht cn e injected without eliciting detrimentl effects. -c. Effects of H3.3 -GFP wild type or K27R mutnt on glol H3K27me1 nd. Zygotes were microinjected t the fertilistion cone stge with mrna for H3.3 -GFP wild type or K27R mutnt, cultured until the 2-cell stge, fixed nd nlysed using H3K27me1 () or ntiody (c). Shown re middle sections (left) or full projections (right) of confocl Z-series of representtive emryos shown in Figure 4-. For ech ntiody, emryos were processed in prllel nd cquisition ws performed under identicl confocl prmeters. Where visile, the polr ody is depicted y n rrowhed. Scle r is 10 mm. d. Distriution of H3K4me3, H3K27me1, nd HP1β in non-injected emryos t the 2-cell stge. Zygotes were collected t the fertilistion cone stge nd were either microinjected with the corresponding mrnas (see min text) or left non-injected. All groups of emryos were cultured until the 2-cell stge t which time they were fixed nd nlysed with HP1,, H3K27me1 or H3K4me3 ntiodies s indicted (red). Note tht quntifiction of H3K27me1 nd levels did not revel ny difference etween non-injected controls nd emryos expressing H3.3- GFP wt. Shown re full projections (left) or middle section (right) of Z-series tken every 0.5 mm of representtive emryos of t lest 18 emryos nlysed for ech ntiody. The polr ody is depicted y n rrow. Scle r is 10 mm. 5

Nucleophosmin B23 DAPI +RNAse -R RNAse c Proe only GST GST- HP1β Single section Femle PN Mle PN HP1β HP1β/DAPI HP1β HP1β/DAPI -RNs se Free proe +RNse Figure S6 RNAse tretment in zygotes results in

Shown re full projections of imges cquired every 1 mm of representtive emryos of 6 nlysed. ws stined with DAPI. Zygotes were permeilised in Triton 0.

Becuse the size of the emryo is significntly igger thn routinely used cultured cells, we first estlished conditions to chieve n efficient RNAse tretment using the nucleolr protein NucleophosminB23 s

. HP1β loclistion is ltered upon RNAse tretment. Shown re single confocl sections of two zygotes where femle nd mle pronuclei dimeter re mximl. ws stined with DAPI.

6 Nucleophosmin B23 DAPI +RNAse -R RNAse c Proe only GST GST- HP1β Single section Femle PN Mle PN HP1β HP1β/DAPI HP1β HP1β/DAPI -RNs se Free proe +RNse Figure S6 RNAse tretment in zygotes results in misloclistion of HP1β nd HP1β is le to ind mjor stellite trnscripts.. RNAse tretment in the zygote leds to misloclistion of Nucleophosmin B23. Shown re full projections of imges cquired every 1 mm of representtive emryos of 6 nlysed. ws stined with DAPI. Zygotes were permeilised in Triton 0.1% S, treted with RNAse, fixed, processed for immunostining with Nucleophosmin B23 ntiody (kindly provided y M. Ould-Adelghni)() or with the HP1 ntiody () nd nlysed under confocl microscopy. Becuse the size of the emryo is significntly igger thn routinely used cultured cells, we first estlished conditions to chieve n efficient RNAse tretment using the nucleolr protein NucleophosminB23 s control (), s it is known tht Nucleophosmin B23 loclistion depends on RNA. Emryos with ech ntiody were nlysed in prllel nd using identicl confocl prmeters.. HP1β loclistion is ltered upon RNAse tretment. Shown re single confocl sections of two zygotes where femle nd mle pronuclei dimeter re mximl. ws stined with DAPI. Emryos shown re representtive of 15 emryos nlysed nd three independent experiments. Note tht the permeilistion tretment results in high ckground nd the qulity of the imges is compromised. Arrows in the mle pronucleus point to the NLBs. c. HP1 inds to pericentromeric trnscripts. RNA-shift ssy ws performed with recominnt GST-HP1 nd mjor stellite RNA tht ws trnscried nd rdioctively lelled in vitro. GST-HP1-RNA shift is indicted y n rrow. 6

C57/Bl6 CAST/EiJ B6H2 B6H3 CstB1 CstB3 RT13 RT8 TTTCCATAATTTTCAGTTTTTGTGCCACATT TTTCCATAATTTTCAGTTTTTGTGCCACATT TTTCCATGATTTTCAGATTTCTTGCCATATT TTTCCATGATTTTCAGTTTTCTTGCCATATT

7 C57/Bl6 CAST/EiJ B6H2 B6H3 CstB1 CstB3 RT13 RT8 TTTCCATAATTTTCAGTTTTTGTGCCACATT TTTCCATAATTTTCAGTTTTTGTGCCACATT TTTCCATGATTTTCAGATTTCTTGCCATATT TTTCCATGATTTTCAGTTTTCTTGCCATATT TTTCCATGATTTTCAGTTTTCTTGCCATATT TTTCCATGATTTTTAATTTTCTTGCCATATT ******* ***** * *** ***** *** RT-PCR mjor st + Cloning + Sequencing c Dy 0 Dy 1 Dy 2 Dy 3 H3.3-GFP K9R GFP Brightfield d % of emryos reching the lstocyst stge Numer of emryos nlysed control non-injected 85 % 14 H3.3-GFP wt H3.3 GFP 80 % 35 H3.3-GFP K9R H3.3 GFP 84 % 43 Figure S7 -. Mjor stellites re primrily trnscried from the pternl genome in the mouse zygote.. RNA from zygotes derived from C57/Bl6mt X CAST/EiJpt crosses ws extrcted, reversed-trnscried nd mplified with primers specific for mjor stellites 4. PCR products were cloned nd individul clones were sequenced. Note tht trnscription from mjor stellite repets cn generte dsrna in ES cells 5 L²-.. Alignment of frgment of genomic Mus musculus domesticus (C57Bl6) nd Mus musculus cstneus (CAST/ EiJ) mjor stellites sequences compred to the sequences otined from c from mouse zygotes. Shown on the lignement re two representtive sequences otined from ech of the three groups nlysed: genomic from C57Bl6 (B6H2-H3), genomic from CAST/EiJ (CstB1-B3) or from two representtive of 31 clones otined fter RT-PCR nd cloning from mouse zygotes. All RT-PCR clones sequenced were of the Cst/EiJ ckground. The lue nd yellow color code highlights the nucleotides shred y the CAST/ EiJ ckground nd those y the C57Bl6 one, respectively. c-d. Development of emryos expressing H3.3 - GFP K9R. c. Muttion of K9 of H3.3 does not pper to compromise development to the lstocyst stge. Zygotes were collected nd microinjected with in vitro trnscried mrna nd cultured till the lstocyst stge s indicted in Figure 1. Zygotes were monitored dily nd scored for their developmentl stge. Shown re representtive rightfield nd fluorescence imges of emryos imged dily. Scle r is 50 mm. d. Summry of development of control, non-injected emryos or emryos expressing H3.3 GFP wt or K9R of 2 independent experiments. The totl numer of emryos nlysed per group is indicted. 7

H3K27c H3K27c H3K27c H3K27c H3K27c H3K27c 5 H3K27c H3K27c H3K27c 2-ce ell stge S-phse BrdU /BrdU BrdU (Ti me) Single section Figure S8. Pttern of H3K27c in zygotes nd 2-cell stge emryos.

Shown re representtive zygotes t the PN2, PN3-4 nd stges (top) or 2-cell stge (ottom). Single sections where femle (left) nd mle (right) pronuclei dimeter is mximl re shown ().

Mle nd Femle pronuclei re indicted in the full projection pnels. Scle r is 10 mm. Where visile, the position of the polr ody () is indicted.

8 H3K27c H3K27c H3K27c H3K27c H3K27c H3K27c 5 H3K27c H3K27c H3K27c 2-ce ell stge S-phse BrdU /BrdU BrdU (Ti me) Single section Figure S8. Pttern of H3K27c in zygotes nd 2-cell stge emryos. Zygotes or 2-cell stge emryos were collected from CD1 crosses nd fixed immeditely for immunostining with H3K27c ntiody (Active Motif AM39133). Shown re representtive zygotes t the PN2, PN3-4 nd stges (top) or 2-cell stge (ottom). Single sections where femle (left) nd mle (right) pronuclei dimeter is mximl re shown (). s of Z-sections cquired every 0.6 mm re lso shown on the right. The confocl prmeters used for cquisition were identicl nd fluorescence levels re therefore comprle. Mle nd Femle pronuclei re indicted in the full projection pnels. Scle r is 10 mm. Where visile, the position of the polr ody () is indicted. The white dshed line in the 2-cell stge emryo delinetes the cell memrne. Emryos shown re representtive of two independent experiments with t lest 16 emryos nlysed.. Reltionship etween cquisition of nd S-phse progression. Zygotes were sujected to BrdU pulse of 30 minutes during mid- nd lte S-phse nd processed for immunostining with n nti-brdu nd n nti- ntiody. Representtive zygotes of 20 nlysed t different stges of S-phse re shown chronologiclly from the top to the ottom. The zygote shown in the top pnel hs not undergone repliction of the stellites sequences round the NLBs (pttern A). In the middle pnel, BrdU lelling is detected round the NLB in the mle pronucleus (rrow), s it is (rrow). Note tht in the ottom pnel, the mle pronucleus hs undergone repliction lmost completely (pttern E), with only the peripherl nucler regions lelled with BrdU. These ptterns re ccording to the repliction ptterns descried y Bouniol-Bly et l 6. Shown re mximl projections of Z-stck sections tken every 0.5 mm (right pnels) or single sections (left pnels) where the dimeter of the mle pronucleus is mximl. Mle nd femle pronuclei re indicted. Where visile, the 2nd polr ody () is indicted. 8

9 References 1. Adenot, P. G., Mercier, Y., Renrd, J. P. & Thompson, E. M. Differentil H4 cetyltion of pternl nd mternl chromtin precedes repliction nd differentil trnscriptionl ctivity in pronuclei of 1-cell mouse emryos. Development 124, (1997). 2. Sntos, F., Peters, A. H., Otte, A. P., Reik, W. & Den, W. Dynmic chromtin modifictions chrcterise the first cell cycle in mouse emryos. Dev Biol 280, (2005). 3. Polo, S. E., Roche, D. & Almouzni, G. New histone incorportion mrks sites of UV repir in humn cells. Cell 127, (2006). 4. Lehnertz, B. et l. Suv39h-medited histone H3 lysine 9 methyltion directs methyltion to mjor stellite repets t pericentric heterochromtin. Curr Biol 13, (2003). 5. Mrtens, J. H. et l. The profile of repet-ssocited histone lysine methyltion sttes in the mouse epigenome. Emo J 24, (2005). 6. Bouniol-Bly, C., Nguyen, E., Besomes, D. & Deey, P. Dynmic orgniztion of repliction in one-cell mouse emryos: reltionship to trnscriptionl ctivtion. Exp Cell Res 236, (1997). 9

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE