SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 Supplementry Informtion Supplementry Figure legends Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity purifiction. The hrored domins, their puttive cytologicl functions, nd the reported regultion of NR-medited trnscription of the individul identified fctors re summrized. Supplementry figure S1. Model showing the impct of nucler O-GlcNAc modifiction of the complex nd promotion of grnulocytic differentition. Supplementry figure S2. Neighor-joining tree of representtive HKMTs. The SET-domin sequences re ligned, nd tree showing relted SET domins nd their sustrte specificities is constructed. Supplementry figure S3. Western lot nlysis of the expression of the isoforms., The protein structures of nd Full nd their relted exon/intron orgniztionl structures re illustrted. Filled rrow heds indicte the sequences 1

2 Supplementry Informtion Supplementry Figure legends Glucose RA Terminl differentition Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity purifiction. OGT GlcNAc OGT GlcNAc O-GlcNAcyltion Me K4 GlcNAc The hrored domins, their puttive cytologicl functions, nd the reported regultion Histone methyltion Me RAR Me K4 K4 ON of NR-medited trnscription of the individul identified fctors re summrized. Complex formtion Supplementry figure S1. Model showing the impct of nucler O-GlcNAc Supplementry Figure S1 modifiction of the complex nd promotion of grnulocytic differentition. Supplementry Informtion Supplementry figure S2. Neighor-joining tree of representtive HKMTs. The SET-domin sequences re ligned, nd tree showing relted SET domins nd Supplementry Figure legends their sustrte specificities is constructed. Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity Supplementry figure S3. Western lot nlysis of the expression of the hset1 purifiction. isoforms. hezh2 dtrx hmll1 The hrored domins, their puttive cytologicl functions, hmll4 nd the reported regultion, The protein structures of nd Full nd their relted exon/intron hnsd1 of NR-medited trnscription heset orgniztionl structures re hsetd2 of the individul identified fctors re summrized. illustrted. Filled rrow heds indicte the sequences hsuv39h1 used for the ntigens of - hash1l (N), while open ones indicte hsuv39h2 tht of - (C)., Supplementry figure S1. Model showing the impct Western lot nlysis of FLAG-tgged vrints exogenously heu-hmtse1 of nucler O-GlcNAc expressed in 293F h hg9 modifiction of the complex nd promotion of grnulocytic differentition. cells (left) nd endogenous vrints expressed in HL60 cells (right). The sterisk d indictes non-specific nds. Supplementry figure S2. Neighor-joining tree of representtive HKMTs. The SET-domin sequences Supplementry re ligned, nd 1 tree Figure showing relted S2SET domins nd their sustrte specificities is constructed. H3K36 H3K4 H3K27 H3K4 H3K9 Supplementry figure S3. Western lot nlysis of the expression of the isoforms., The protein structures of nd Full nd their relted exon/intron orgniztionl structures re illustrted. Filled rrow heds indicte the sequences used for the ntigens of - (N), while open ones indicte tht of - (C)., Western lot nlysis of FLAG-tgged vrints exogenously expressed in 293F cells (left) nd endogenous vrints expressed in HL60 cells (right). The sterisk indictes non-specific nds. 2

3 humn gene kd PHD SET PHD SET Full WB:α-FLAG E1 E14 E15 E16 E WB:α- (N) (C) Full Full cell exogenous HL60 cell endogenous Supplementry figure S3. Western lot nlysis of the expression of the isoforms., The protein structures of nd Full nd their relted exon/intron orgniztionl structures re illustrted. Filled rrow heds indicte the sequences used for the ntigens of - (N), while open ones indicte tht of - (C)., Western lot nlysis of FLAG-tgged vrints exogenously expressed in 293F cells (left) nd endogenous vrints expressed in HL60 cells (right). The sterisk indictes non-specific nds. 3

4 kd WB:α-(N) WB:α-GAPDH Full Plcent Testis Prostte Uterus Rectum Colon Smll intestine Stomch Skeletl muscle Spleen Pncres Lung Liver Kidney rin Hert Supplementry figure S4. Expression levels of nd Full in humn tissues. Western lot nlysis with - (N) of the memrne (BioChin), lotted with cell lystes from the indicted tissues. As quntittive control, immunolot imge with -GAPDH ntiody ws supplied y BioChin Inc. The sterisk indictes the non-specific nds. p RT Exon Full strt (+1) Full stop (+,172) Humn gene E1 E2 E14 E15 E16 E26 E27 strt (+1) stop (+77,418) Supplementry figure S5. Isoltion of the gene trnscripts., 3 -RACE nlysis of the gene trnscripts. The 3 frgments of the gene trnscripts were mplified with the indicted exon-specific primers nd oligo(dt) primers., The usge of ech exon encoding nd Full nd the 3 -ends of ech vrint re presented (upper). The otined 3 -end of mrna contining exon 14 ws sequenced (ottom). 4

5 sh-730 :5'-GCA TTT CGT GAA GGA TCT AGG-3' sh-742 :5'-GGA TCT AGG AAG TCA TCA AGA-3' sh-1248:5'-ggt GAG GCA TGA AAT TCA AGA-3' sh-4476:5'-gca ACA CTC TGT AGC ACA TGT-3' WB α- (N) () Scr sh (Full) α-βactin c RARE-Luciferse 30 Reltive Luc. ctivity RA sh-: Scr Supplementry figure S6. The role of on RAR-medited trnscription., The sequences of the shrna trgeting vrints re presented., Efficiencies of the indicted shrna towrd vrints were nlyzed y Western lot with the - (N). c, Luciferse ssy for the function of in RAR-medited trnscription. The RARE-driven reporter ws electroported into HL60 cells long with the shrnas expressing vectors trgeting to the indicted sequences. All vlues re shown s mens ± s.d. (n = 3) 5

6 PHD finger motif SET domin Y E SET Y358A A E441A 1 A Full FLAG-: WB kd Y358A E441A SET Full 250 Full α- (N) SET α-βactin Supplementry figure S7. Western lot nlysis of the expression levels of the vrious constructs., The schemtic representtion of the vrious constructs., Western lot nlysis of the expression levels of series of, Full nd their mutnts. 6

7 HKMT ctivity (10 4 d.p.m.) RA 0 d 1 d 4 d H3(22-44) peptide: WT K27A K36A HL60 WT K27A K36A HL60-R2 Supplementry figure S8. Non-normlized level of HKMT ctivity ssocited with RAR in HL60 nd HL60-R2 cells. The -RAR immunoprecipittes from HL60 cells nd HL60-R2 cells were sujected to the in vitro HKMT ssys with the indicted H3 til peptides s descried in Figure 1i. The dpm vlues of the rdioctivity, incorported into the peptides, were mesured y scintilltion counter. All vlues re shown s mens ± s.d. (n = 3). kd Input IP:RARα 250 Full Histone H3 RARα RA (1 d) Supplementry figure S9. RA-dependent interction of RAR with in HL60-R2 cells. NEs were prepred from HL60-R2 cells treted with RA for 1 dy, nd were sujected to immunoprecipittion with -RAR ntiody nd Western lot nlysis with the indicted ntiodies. 7

8 HL60 FLAG-Cont FLAG- FLAG-Cont FLAG IRES egfp Visile FLAG- FLAG IRES egfp HL60 cells Spinfection (φ0 x g for 2 RT) 2 dys FACS sorting for GFP-positive cells Green c d α-flag PI HL % PI FLAG-Cont 95.82% PI FLAG % WB α-gfp α-βactin egfp egfp egfp HL60 FLAG- Cont FLAG- Supplementry figure S10. Estlishment of HL60 cells stly expressing FLAG-tgged., Schemtic representtion of the experimentl procedure nd the retroviruses used for estlishing HL60 stle cells., c, HL60 cells were infected with the retroviruses encoding FLAG-tgged y the spinfection method. GFP-positive cells were sorted with the FACSVntge (BD Biosciences) nd nlyzed y fluorescence microscopy () nd y flow cytometry (c). d, expression ws vlidted y Western lot with - FLAG ntiody. 8

9 Histone H3K4me peptide SAM (-) (me1) (me2) SAM (+) +CH3 (14D) Histone H3K4me2 peptide SAM (-) SAM (+) c Histone H3K4me3 peptide SAM (-) SAM (+) Supplementry figure S11. Mss spectrometric nlysis of HKMT ctivity of -L complex towrd mono-, di- nd tri-methylted histone H3 til (1-21).,, c, The following peptides were used; H3K4me, ART(methylK)QTARKSTGGKAPRKQLA-GG-iocytin (M.W. = D); H3K4me2, ART(dimethylK)QTARKSTGGKAPRKQLA-GG-(NHS-LC-iotin) (M.W. = D), H3K4me3, ART(trimethylK)QTARKSTGGKAPRKQLA-GG-iocytin (M.W. = D). The histone H3K4me (), H3K4me2 () nd H3K4me3 (c) peptides were rected with -L complex in the presence or sence of S-Adenosyl methionine (SAM, 1 mm). The methylted peptides were deionized y reverse phse column nd nlyzed y MALDI TOF-MS. Numers represent the vlue of m/z derived from the sustrte nd product peptides. Asterisk indictes non-specific peks. 9

10 kd 75 Autordiogrph OGT 50 kd 75 CBB OGT 50 rec. OGT rec Supplementry figure S12. In vitro GlcNAcyltion of y OGT. Recominnt ws ssyed s sustrte for recominnt OGT in the presence of UDP-[H 3 ]-GlcNAc. The O-GlcNAcylted proteins were visulized y utordiogrph (upper) of the gel stined with CBB (ottom). rec. rec. HCF-1N /rec. OGT (-/+) UDP-GlcNAc (-/+) Western lotting 1 30 [H 3 -] SAM Scintilltion counting 1 30 WB α-glcnac α- (N) HKMT ctivity (x 10 3 d.p.m.) kd rec. HCF-1N /rec. OGT rec. UDP-GlcNAc H3 til (1-21) H3 til (K4A) (OGT) () Supplementry figure S13. The effect of HCF-1N nd OGT on the HKMT ctivity of in vitro. The experimentl procedure is shown (left). In vitro GlcNAcyltion levels of the recominnt proteins were nlyzed y western lot with -GlcNAc (upper right). The GlcNAcylted smples were sujected to in vitro HKMT ssy using H3 til (1-21) peptides (ottom right). 10

11 kd 150 Void (2 MD) 670 kd 440 kd SKB1 STK 38 PPP1Cs β Actin WB α-flag () α-ogt Input L complex -S complex Supplementry figure S14. The role of GlcNAcyltion of HKMT-ctive complex on the complex formtion. The -FLAG ffinity-purified complex ws treted with recominnt O-GlcNAcse nd sujected to frctiontion y gel filtrtion column. Silver stining nd Western lot nlysis with the indicted ntiodies for ech frction re shown. 11

12 OGT interction PHD SET C SET PHD Full interction OGT TPR NLS CDI CDII TPR TPR TPR - c IP:α-FLAG ( mut) WB:α-FLAG d IP:α-FLAG (OGT mut) WB:α-FLAG WB:α-GlcNAc WB:α-GlcNAc WB:α-OGT WB:α- (N) TPR TPR6 TPR OGT Full PHD SET Supplementry figure S15. The O-GlcNAc level nd the OGT-intercting domin of mutnts.,, Schemtic representtion of the deletion mutnts of () nd OGT (), used in the nlysis descried in (c) nd (d) respectively. The + symol t the right of the pnel denotes the interction etween the nd OGT mutnts. c, d, The 293 cells, trnsfected with either the FLAG-tgged OGT mutnts (c) or the FLAG-tgged mutnts (d), were sujected to immunoprecipittion with -FLAG ntiody nd Western lotted with the indicted ntiodies. 12

13 kd Undigest Trypsin (µg/ml) T440A Y358A Supplementry figure S16. Trypsin clipping ssy of, T440A mutnt nd Y358A mutnt. The indicted mutnts were trnslted in vitro nd leled with [ 35 S-]methionine. The expressed mutnts were digested with trypsin t the indicted concentrtion. The tryptic peptides were resolved y SDS-PAGE nd visulized y utordiogrphy. 13

14 kd 250 Silver stin kd 250 Silver stin HCF-1N OGT FLAG-T440A HCF-1N OGT FLAG-Y358A STK38 PPP1C βactin STK38 PPP1C βactin (me0) Histone H3 til (1-21) peptide No complex (me0) (me1) (me2) complex +CH3 (14D) +CH3 (14D) (me0) Mock (me0) (me1) T440A complex +CH3 (14D) (me0) Y358A complex Supplementry figure S17. The HKMT ctivities of the complexes contining the O-GlcNAc-deficient nd the ctlyticlly inctivting mutnts., The -FLAG immunoffinity complexes contining the indicted FLAG-tgged mutnts were resolved y SDS-PAGE (8-16%), nd visulized with silver stining., Mss-spectrometric nlysis of the H3 til (1-21 nd K4A) peptides of HKMT ctivity of the complexes contining the indicted mutnts. Numers represent the vlue of m/z derived from the sustrte nd product peptides. The sterisk indictes non-specific peks. 14

15 % HKMT ctivtion UDP-GlcNAc UDP-GlNAc IP : IgG (N) (C) MLL1 MLL2 MLL3 MLL4 Supplementry figure S18 In vitro HKMT ssy of MLL-fmily memers in the presence of UDP-GlcNAc or UDP-GlNAc. The indicted MLL-fmily memers were immunoprecipitted with specific ntiodies from HL60-cell NEs nd rected with H3 til (1-21) peptides s their sustrtes. Ech vlue ws normlized with the vlue in the sence of UDP-hexosmine. 15

16 c HL60 promyelocytes (CD11 - CD14 - ) Monocytic cells (CD11 + CD14 + ) RA (-/+) PUGNAc (-/+) 2 d PUGNAc (-/+) 4 d VD P19 cells Neurosphere forming Neurogenesis 4 d neurosphere forming Neurogenesis RA RA PUGNAc (-) RA PUGNAc (+) Monocytic cells CD14 Undifferentited cells Grnulocytic cells PUGNAc PUGNAc+RA RA+PUGNAc PUGNAc (-) RA+PUGNAc PUGNAc (+) CD11 PUGNAc 0.01 % 0.00 % CD % CD % d ST2 cells CD11 RA CD11 PUGNAc+RA Tro (-/+) PUGNAc (-/+) 6 d BMP2 (-/+) PUGNAc (-/+) 6 d CD % CD % Adipogenesis Osteolst genesis Tro BMP2 CD11 CD11 VD PUGNAc+VD CD % CD % PUGNAc Tro+PUGNAc PUGNAc BMP2+PUGNAc CD11 CD11 Supplementry figure S19. The effects of O-GlcNAc modultion on monocytic differentition of HL60 cells., Giems-My-Grunewld stining of HL60 promyelocytes differentited into monocytes (1 M VD tretment for four dys). Cell surfce mrkers of monocytes re indicted., HL60 cells, exposed to PUGNAc (150 M) long with either RA (1 M) or VD (1 M) for two dys, were nlyzed y flow cytometry with Alex Fluor 488-conjugted -CD11 nd APC-conjugted -CD14 ntiodies. The popultions of differentited HL60 cells re shown in the two-dimensionl-sctter plots. c, Schemtic representtion of the experimentl procedure for RA-induced neuro genertion (upper). A neurosphere ws formed y 2-dy exposure of P19 cells to RA (1 M) in the presence 16

17 or sence of PUGNAc (150 M) nd ws nlyzed y microscopy (left lower). After n dditionl 4 dys of culture in the sence of RA, the neurospheres were re-spred on poly-lysine-coted culture dishes with or without PUGNAc (150 M). Neurogenesis ws nlyzed y immunostining with -Tuji1 ntiody (green) nd DAPI (mgent) (right lower). d, Schemtic representtion of the experimentl procedure (upper). For dipogenesis, ST2 cells were treted with Tro (1 M) in the presence or the sence of PUGNAc (150 M) for 6 dys. The cells were stined with oil red O nd nlyzed y microscopy (left lower). For osteolstogenesis, ST2 cells were cultured in the presence of BMP2 (50 ng/ml) with or without PUGNAc (150 M) for 6 dys. The osteolstic cells expressing lkline phosphtse were stined for lkline phosphtse ctivity (right lower). WB kd 150 α-glcnac WB IP:α--A(N) α-glcnac α- (N) AZA DON AZA DON Undifferentited (RA -) Differentiting (RA 1d) Supplementry figure S20. Effect of DON nd AZA on the O-GlcNAc modifiction levels of in undifferentited or differentiting HL60 cells. HL60 cells were treted with DON (45 M) or AZA (45 M) in the presence or sence of RA (1 M) for 1 dy. The totl cell lystes (upper) or the - (N) immunoprecipitnts (ottom) were sujected to Western lot with -GlcNAc. 17

18 0.43 % RA 38.6 % CD11 CD11 RA + DON 28.2 % RA + DON + GlcN 37.6 % CD11 CD11 Supplementry figure S21. Effect of Glucosmine tretment on the RA-induced differentition lock y DON. The HL60 cells, exposed to RA (1 M) nd DON (45 M) in the presence or sence of glucosmine (GlcN, 25 mm), were nlyzed y flow cytometry with Alex Fluor 488-conjugted -CD11. The numer represents the popultion of the higher CD11 expressing cells within the indicted region. 18

19 HKMT ctivity (10 4 d.p.m.) UDP-GlcNAc UDP-GlNAc 0 IP : IgG (N) (C) IgG (N) (C) HL60 HL60-R2 % HKMT ctivtion 200 UDP-GlcNAc UDP-GlNAc IP : IgG MLL1 MLL2 MLL3 MLL4 Supplementry figure S22. The ctivity of MLL-fmily HKMTs in HL60-R2 cells.,, In vitro HKMT ssy of () nd MLL-fmily HKMTs () in the presence of UDP-GlcNAc (0.5 mm) or UDP-GlNAc (0.5 mm). The immunoprecipitnts with the indicted ntiodies were sujected to n in vitro HKMT ssy with H3 til (1-21) peptides nd [ 3 H] S-Adenosyl methionine. Incorported [ 3 H]-lmethyl groups towrd the til peptides were mesured y scintilltion counter. Ech vlue ws normlized with the vlue in the sence of UDP-hexosmine. All vlues re shown s mens ± s.d., (n=3). 19

20 HL60-R2 RA PUGNAc RA+PUGNAc 2.0X10 4 cells in totl Gted cells Counts Annexin V RA PUGNAc RA + PUGNAc 2 dys 9.5 % 13.3 % 12.0 % 14.4 % 5 dys 3.6 % 14.5 % 29.5 % 41.2 % Annexin V Annexin V Annexin V Annexin V Supplementry figure S23. Effect of PUGNAc on RA-induced poptosis in HL60-R2 cells., HL60-R2 cells, four dys fter co-tretment with RA nd PUGNAc, were nlyzed y My-Grunewld-Giems stining., Cells were incuted either with RA (1 M), PUGNAc (150 M), or oth for two dys nd five dys. The cells within the indicted gte (upper) were ssessed for RA-induced poptosis y flow cytometry with PE-conjugted Annexin V (ottom). 20

21 WB α-h3k4me2 shluc α-h3 (25 % lod) Reltive intensity (H3K4me2/H3) α-h3k4me2 sh RA α-h3 (25 % lod) shrna shluc sh shogt α-h3k4me2 shogt α-h3 (25 % lod) #1 #2 #3 #1 #2 #3 RA - + Supplementry Figure S24 Supplementry figure S24. Effect of or OGT depletion on the RA-dependent increse in glol H3K4 dimethyltion levels., H3K4me2 in HL60 cells expressing the indicted shrna ws nlyzed y Western lot with -H3K4me2 ntiody., Bnd intensities in pnel () were individully quntified using the Socion imge progrm. Ech vlue ws normlized to the reltive intensity of the nd with -H3 ntiody. All vlues re shown s mens ± s.d., (n = 3). 21

22 NAG ctivity (A405/10 5 cells) GlcNAcse O-GlcNAcse Intrcellulr glucose (mg/10 10 cells) HL60 HL60 -R2 HL60 HL60 -R2 Supplementry figure S25. Anlysis for N-Acetyl- -D-glucosminidse (NAG) ctivity nd intrcellulr glucose concentrtion of HL60 nd HL60-R2 cells., The NAG ctivity ws mesured y colorimetric ssy sed on the hydrolysis of 4-Nitrophenyl N-cetyl- -D-glucosminide. For this nd susequent r grph, ll vlues re shown s mens ± s.d. (n = 3), The concentrtion of intrcellulr glucose ws mesured y glucose ssy kit (BioVision). (n = 3). 22

23 C/EBPε gene RARE AGGTCAGGAGGAGGTAG % of input shluc shcont RARα Input IP (N) HCF-1 OGT IP % of input sh(1248) sh(1248) O-GlcNAc STK38 H3K4me H3K4me2 H3K4me3 H3c PPP1Cα PPP1Cβ PPP1Cγ (C) % of input shogt shogt RA (h) RA (h) RA (h) IgG RARα (N) OGT H3K4me2 Supplementry figure S26. ChIP nlysis on C/EBP promoter in differentiting HL60 cells. The primer sets for ChIP nlysis re presented (upper left). Immunoprecipitted DNA from the intct cells ws mplified y PCR (ottom left). For ssessment of the effect of nd OGT on the promoter H3K4me2, retroviruses encoding shrnas ginst or OGT were used to infect HL60 cells. The knockdown efficiencies of the shrnas ginst nd OGT re shown in Figure 6c. The precipitted DNA frgments using the indicted ntiodies from - or OGT-depleted cells were nlyzed y qpcr (right). Vlues re mens ± s.d. for triplictes. 23

24 GGTTCACCGAAAGTTCA distl RARE RARβ2 gene +1 AAGTGGAATGTCCCATCAGCA TAGCTCTGGGTGTGAAGCCCT ATCCTGGGAGTTGGTGATGTC AAGTGAGCTGTTCAGAGGCA distl RARE c distl RARE Input RARα (N) OGT IP IP % of input % of input shcont sh(1248) shcont sh(1248) % of input % of input shcont sh(1248) shcont sh(1248) H3K4me2 IgG % of input shogt shogt % of input shogt shogt RA (h) RA (h) RA (h) IgG RARα (N) OGT H3K4me2 IgG RARα (N) OGT H3K4me2 Supplementry figure S27. ChIP nlysis of the RAR 2 promoter of differentiting HL60 cells using ntiodies ginst RAR,, OGT nd H3K4me2., The primer sets for ChIP nlysis re presented., Immunoprecipitted DNA from the intct cells ws mplified y PCR. c, For ssessment of the effect of nd OGT on the promoter H3K4me2, retroviruses encoding shrnas ginst or OGT were used to infect HL60 cells. The knockdown efficiencies of the shrnas ginst nd OGT re shown in Figure 6c. The precipitted DNA frgments using the indicted ntiodies from - or OGT-depleted cells were nlyzed y qpcr. Vlues re mens ± s.d. for triplictes. 24

25 shrna retrovirus LTR shrna ZsGreen LTR Spinfection 2 d WB α- (N) () (Full) shluc sh shogt FLAG-cont. retrovirus LTR FLAG-ires-eGFP LTR FLAG-N retrovirus LTR FLAG--ires-eGFP LTR RA + PUGNAc (-/+) α-ogt α-βactin WB FLAG-: T440A FLAG-T440A retrovirus LTR FLAG-T440A-ires-eGFP LTR FACS nlysis α-flag α-gfp R1-gted cells R2-gted cells SSC PI CD11 R3-gted 2x10 4 cells FSC FSC egfp or ZsGreen Supplementry figure S28. The roles of nd OGT on RA-induced differentition of HL60 cells. The experimentl procedure nd the retroviruses used in Figure 5 pnels (h) nd (i). Western lot nlysis of gene-specific suppression y series of retroviruses expressing shrnas (sh-1248, sh-4475 or shogt) nd the gene-trnsfer efficiencies of the retroviruses encoding or T440A mutnt (upper right). Gtes (R1 to R3) used in pnels re lso presented (ottom). The cells, infected with the indicted shrna (red-filled histogrm) were treted with RA for two dys nd nlyzed for grnulocytic differentition y flow cytometry with APC-conjugted -CD11 ntiody. 25

26 shluc :5'-TGC GTT GCT AGT ACC AAC-3' shmll1:5'-gtg CCA AGC ACT GTC GAA A-3' shmll2:5'-gca CCG AAT GGA AGA ACA ACG-3' shmll3:5'-ggt AGA AGT GAG CAG GTA TCC-3' shmll4:5'-gct GCT AGA ATC TGC GTT C-3' αmll1 Cont shrna shmll1 αmll2 Cont shrna shmll2 shrna/psiren-zsgreen LTR shrna ZsGreen LTR Cont shrna shmll3 Cont shrna shmll4 Spinfection FACS nlysis RA (48 hrs) αmll3 αmll4 c shrna shluc shmll1 shmll2 shmll3 shmll % 86.1 % 53.9 % (-2.8 %) (-35.0 %) 79.9 % (-9.0 %) 78.9 % (-10.0 %) Supplementry figure S29. Effect of shrna-medited knockdown of MLL-fmily genes on RA-induced differentition of HL60 cells., The experimentl procedure nd the structure of the retrovirus expressing shrnas ginst MLL-fmily memers re presented., Efficiencies of the knockdown of MLL-fmily memers were confirmed y Western lot with the indicted ntiodies. c, Grnulocytic differentition of ZsGreen-positive cells 2 dys fter tretment with RA ws mesured y flow cytometry with APC-conjugted -CD11 (red-filled histogrm). The shluc-infected cells (lue-open histogrm) re overlid. 26

27 FLAG-cont. 1.1 % RA 74.8 % PUG+RA 92.1 % SET Y358A E441A 2.1 % 2.7 % 3.6 % RA 39.5 % RA 24.0 % RA 50.1 % PUG+RA 59.5 % PUG+RA 60.4 % PUG+RA 76.0 % CD11 CD11 CD11 Supplementry figure S30. Ctlytic inctivtion of : the effect on RA-induced grnulocytic differentition.,, HL60 cells were infected with seril retroviruses expressing the indicted ctlyticlly inctivted mutnts long with IRES-directed egfp reporter. The cells were treted with RA in the presence or sence of PUGNAc for two dys. The RA-induced differentition of the egfp-positive cells were nlyzed y flow cytometry with APC-conjugted -CD11 ntiody. The shluc-infected cells (lue-open histogrm) re overlid. 27

28 Immuno-stin DNA Merge OGT (N) O-GlcNAc WB α-ogt α- (N) Cytosol NE RA(d) IP:α- (N) WB α-glcnac α-ogt α- (N) kd 75 (OGT) () RA(d) 0 4 Supplementry figure S31. Sucellulr locliztion of nd OGT., HL60 were fixed on glss slides nd immuno-stined with - (N) nd -OGT ntiodies., Cytosolic proteins nd NE prepred from either RA-treted or untreted HL60 cells were sujected to Western lot nlysis with the indicted ntiodies. 28

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized

More information

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.

More information

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized

More information

Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome

Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+

More information

Supplementary figure 1

Supplementary figure 1 Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22

More information

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

TNF-α (pg/ml) IL-6 (ng/ml)

TNF-α (pg/ml) IL-6 (ng/ml) Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6

More information

supplementary information

supplementary information DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control

More information

Molecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress

Molecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng

More information

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for

More information

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA

More information

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %

More information

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

More information

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

More information

Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells

Supplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Supplementary Document

Supplementary Document Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,

More information

Heparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes

Heparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,

More information

DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does

More information

Supplementary Figure 1

Supplementary Figure 1 Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2 Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry

More information

Supplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM.

Supplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM. Reltive expression 5 1 15 2-5 5 (n = 3) (n = 3) GFM nd PFM PFM GFM mmu-mir-145 mmu-mir-143 mmu-mir-72 mmu-mir-22 mmu-mir-27 mmu-mir-125-5p mmu-mir-23 mmu-mir-29 mmu-mir-126-3p mmu-let-7d mmu-let-7c mmu-mir-199-3p

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic

More information

% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %

% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 % Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

Supplementary Information

Supplementary Information Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,

More information

Supplementary Information Titles

Supplementary Information Titles Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION . Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,

More information

Supplementary Materials and Methods

Supplementary Materials and Methods DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI

More information

Supplementary Figure 1a

Supplementary Figure 1a Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk

More information

Type II monocytes modulate T cell-mediated central nervous system autoimmunity

Type II monocytes modulate T cell-mediated central nervous system autoimmunity Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE

More information

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein

More information

Supplementary Figure 1

Supplementary Figure 1 doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry

More information

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis

PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet

More information

Cos7 (3TP) (K): TGFβ1(h): (K)

Cos7 (3TP) (K): TGFβ1(h): (K) IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity

More information

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena

More information

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n. University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.

More information

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Tble 1. Sttistics of dt sets nd structure refinement PYL1 po PYL2/ABA PYL2 po PYL2/ABA/HAB1 PDB code 3KAY 3KAZ 3KB0 3KB3 Dt collection APS bem line 21-ID 21-ID 21-ID 21-ID Spce group P6 5

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Supplementary Information

Supplementary Information Supplementry Informtion Kim et l. Supplementry Mterils nd Methods Gene expression nlysis y Affymetrix microrry Totl RNAs were isolted from MDA-MB-231 cells expressing or using the RNesy mini kit (Qigen).

More information

Anti-inflammatory activity of IgG1 mediated by Fc galactosylation and association of FcγRIIB and dectin-1

Anti-inflammatory activity of IgG1 mediated by Fc galactosylation and association of FcγRIIB and dectin-1 Anti-inflmmtory ctivity of IgG1 medited y Fc glctosyltion nd ssocition of FcγRIIB nd dectin-1 Christin M. Krsten, Mnoj K. Pndey, Juli Figge, Regin Kilchenstein, Philip R. Tylor, Mrcel Ross, Jcqueline U.

More information

Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )

Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% ) Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion

More information

Nature Immunology: doi: /ni.3836

Nature Immunology: doi: /ni.3836 Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:

More information

Supplementary Information

Supplementary Information Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

More information

Supplementary Figure 1

Supplementary Figure 1 Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated

More information

Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2

Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2 Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section

More information

Control vector. HA-Elfn2. HA-Elfn1

Control vector. HA-Elfn2. HA-Elfn1 Control vector c HA-Elfn2 HA- Control vector HA-Elfn2 HA- nti- nti-ha Hippocmpus (CA3) PV DAPI SOM DAPI Hippocmpus (dentte gyrus) PV DAPI SOM DAPI Supplementry Figure 1. Specificity of the nti- ntiody

More information

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high

More information

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.

More information

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha

More information

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

More information

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.

More information

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott

More information

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

More information

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,

More information

NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]

NappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM] (A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl

More information

MERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2

MERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2 ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Icos-/ CD3 Icos Y181F OT-2 T cells doi:1.138/nture158 IgD Supplementry Figure 1. is required for folliculr locliztion of ctivted helper T cells. Icos nd Icos-/- OT-2 T cells were retrovirlly trnsduced

More information

* * * * * liver kidney ileum. Supplementary Fig.S1

* * * * * liver kidney ileum. Supplementary Fig.S1 Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity

More information