Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Size: px
Start display at page:

Download "Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times."

Transcription

1 Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent experiments. (B) Representative immunohistochemistry images showing RIPK3 staining in the tubular epithelial cells from Ripk3 +/+ or Ripk3 -/- mice at 12 h post-clp or sham surgery (n = 3 for Sham; n = 3 for CLP). Scale bar: 20 µm.

2 Supplemental Figure 2. Ripk3 deficiency protects against loss of kidney function in sepsis. (A) BUN levels in the serum of Ripk3 +/+ and Ripk3 -/- mice at 6 h post CLP or sham surgery (n = 6 mice/ group). (B) Total urinary protein to urine creatinine ratio in Ripk3 +/+ and Ripk3 -/- mice at 6 h post CLP or sham surgery (n = 3 mice/group). Data are mean + SEM of 3 independent experiments. *P<0.05, ***P<0.001, ANOVA.

3 Supplemental Figure 3. Sepsis induces limited RIPK3-dependent cell death. (A) Representative TUNEL images (brown) in the tubular epithelial cells of kidney sections from Ripk3+/+ or Ripk3-/- mice at 6 h post CLP surgery. Methyl green served as the counterstain. Scale bar: 20 µm. (n = 4 for Sham; n =4 for CLP). (B) HK-2 cells were treated with LPS in the absence or presence of RIPK3 inhibitor (GSK 872) (1 µm). LDH release was measured after 24 h. (C) HK-2 cells stably expressing Cas9 protein were transfected with non-targeting (NT) grna or grna targeting the RIPK3 gene. RIPK3 expression was determined by Western blotting. Data shown are representative of 3 independent experiments. (D) Control and RIPK3-gRNA transfected HK-2 cells generated using the CRIPSR-Cas9 method were treated with LPS, and Ethidium Homodimer-I fluorescence, indicative of dead cells with compromised membrane integrity, was measured at 24 h. Data are mean + SEM of 3 independent experiments. **P<0.01, ***P<0.001, ANOVA.

4 Supplemental Figure 4. HK-2 cells were incubated with the absence or presence of LPS followed by treatment with Z-VAD FMK or necrostatin-1 (Nec-1). Dead/live cell fluorescence was measured at 24 h. Data are mean + SEM of 3 independent experiments. **P<0.01, ***P<0.001, ANOVA

5 Supplemental Figure 5. (A) BUN levels in the serum of Mlkl +/+ (n = 6 for Sham; n = 6 for CLP) and Mlkl -/- (n = 5 for Sham; n = 8 for CLP) mice at 6h post CLP or sham surgery. (B) Lipocalin- 2 to creatinine levels in the urine of wild-type (n = 4 for Sham; n = 5 for CLP), Mlkl -/- (n = 4 for Sham; n = 6 for CLP) and Ripk3 -/- (n = 4 for Sham; n = 4 for CLP) mice at 6 h post CLP or sham surgery. Data are mean + SEM of 3 independent experiments. ***P<0.001, ANOVA.

6 Supplemental Figure 6. RIPK3 levels are elevated in the patients of human sepsis. (A) Western blot for the expression of RIPK3 in the plasma from non-sepsis (n = 5) and sepsis ICU patients (n = 5). Relative protein loading at 50 kda in the plasma samples were monitored by Ponceau S staining. (B) Bar graph showing the RIPK3 levels in the plasma from non-sepsis and sepsis ICU patients after densitometry analysis. Data are mean + SEM. **P<0.01, student s unpaired t-test.

7 Supplemental Figure 7. RIPK1 and MLKL are not elevated in the patients of human sepsis. (A) RIPK1 mrna expression was determined by quantitative RT-PCR in the human urinary cells of non-sepsis patients (n = 3) compared to sepsis patients (n = 25). (B-C) RIPK1 protein expression was determined by ELISA in the human urine supernatant and plasma samples of non-sepsis patients (n = 11 for urine; n = 14 for plasma) compared to sepsis patients (n = 106 for urine; n = 121 for plasma). (D) MLKL mrna expression was determined by quantitative RT-PCR in the human urinary cells of non-sepsis patients (n = 5) compared to sepsis patients (n = 26). (E-F) MLKL protein expression was determined by ELISA in the human urine supernatant and plasma samples of non-sepsis patients (n = 12 for urine; n = 12 for plasma) compared to sepsis patients (n = 105 for urine; n = 99 for plasma). Data are mean + SEM. Red bars represent mean. NS indicate non-significant, student s unpaired t test.

8 Supplemental Table 1: Baseline characteristics of all human subjects enrolled in the current study. Subject ID Age (years) Gender Sepsis suspicion Septic Shock 1 70 Female Yes Yes 2 51 Female Yes No 3 66 Male No No 4 75 Male Yes Yes 5 64 Male Yes Yes 6 75 Male Yes Yes 7 53 Female Yes Yes 8 71 Male Yes No 9 58 Male Yes No Female Yes Yes Male Yes No Female Yes No Female No No Male Yes Yes Male Yes Yes Female Yes No Female Yes No Male Yes No Male Yes Yes Female Yes No Female Yes Yes Female Yes No Male Yes No Male Yes Yes Male Yes Yes Male Yes No Male Yes Yes Male Yes No Female Yes Yes Male Yes No Male No No Male No No Female Yes No Male Yes Yes Male Yes Yes Female Yes Yes

9 37 28 Female Yes No Female Yes Yes Female Yes No Male Yes No Male Yes Yes Male Yes Yes Female Yes No Male Yes No Female Yes No Male Yes No Female Yes No Female Yes Yes Male Yes Yes Female Yes No Male Yes No Male Yes Yes Male Yes No Female Yes Yes Male Yes Yes Female No No Male Yes No Male Yes Yes Female Yes Yes Male Yes No Female Yes Yes Male Yes Yes Female Yes Yes Male Yes No Female Yes No Female Yes No Male Yes No Male No No Female Yes No Male Yes No Male Yes No Female No No Female Yes Yes Female No No Female Yes Yes Male Yes Yes Male Yes No

10 78 69 Male Yes No Male Yes No Male Yes Yes Male Yes No Female Yes No Male No No Male Yes No Male Yes No Female Yes Yes Male Yes No Female No No Male No No Female Yes Yes Male Yes No Male Yes No Male Yes Yes Male Yes No Female Yes Yes Male Yes Yes Female Yes Yes Male Yes No Female Yes Yes Female Yes Yes Female Yes Yes Male No No Female Yes Yes Female Yes Yes Male Yes No Male Yes No Male No No Male Yes Yes Female Yes No Male Yes No Male Yes Yes Male Yes No Male Yes No Female Yes No Male No No Male Yes Yes Female Yes Yes Female Yes Yes

11 Female Yes Yes Female Yes No Female Yes Yes Male Yes No Female Yes No Female Yes Yes Male Yes Yes Female Yes Yes Female Yes Yes Male Yes No Female Yes No Male Yes No Male Yes Yes Female Yes Yes Male Yes No Male Yes Yes Male No No Female Yes No Male Yes Yes Male Yes Yes Female Yes No Female Yes Yes Female Yes No Male Yes No Male Yes Yes Female Yes No Male Yes No Male Yes Yes Male No No Male Yes No Female No No

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. 1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/339/339ra69/dc1 Supplementary Materials for The caspase-8 inhibitor emricasan combines with the SMAC mimetic birinapant to induce necroptosis and

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices 45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing

More information

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Nature Medicine doi: /nm.3957

Nature Medicine doi: /nm.3957 Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Supplemental Table I

Supplemental Table I Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection Victoria L. Smith, Yong Cheng, Barry R. Bryant and Jeffrey S. Schorey Supplementary Figure 1: Unprocessed

More information

Adiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular

Adiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular Supplemental Data Adiponectin/herin system enhances exosome biogenesis and decreases cellular ceramides by exosomal release 5 Yoshinari Obata, Shunbun Kita, *,, Yoshihisa Koyama, Shiro Fukuda, Hiroaki

More information

Part-I: Screening. 3.1 Assessment of non-toxic concentration of test compounds in RAW cells. Results

Part-I: Screening. 3.1 Assessment of non-toxic concentration of test compounds in RAW cells. Results Part-I: Screening Our strategy was to look for compounds which can inhibit HMGB1 (high mobility group box 1) release in activated macrophages and check effect of screened compound on endotoxemic mice.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Quantitative PPARγ expression affects the balance between tolerance and immunity

Quantitative PPARγ expression affects the balance between tolerance and immunity Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu

More information

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal

fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal 15 Scramble sirna LC3B sirna IL-1β (pg/ml) 1 5 LC3B (kda) - 18 (LC3B I) - 16 (LC3B II) β-actin - 42 ( _ ) LPS LPS ATP fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal macrophages

More information

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

A. Generation and characterization of Ras-expressing autophagycompetent

A. Generation and characterization of Ras-expressing autophagycompetent Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

The role of microcirculatory and mitochondrial dysfunction in sepsisinduced acute kidney injury (AKI): a. model of sepsis-induced organ dysfunction

The role of microcirculatory and mitochondrial dysfunction in sepsisinduced acute kidney injury (AKI): a. model of sepsis-induced organ dysfunction The role of microcirculatory and mitochondrial dysfunction in sepsisinduced acute kidney injury (AKI): a model of sepsis-induced organ dysfunction Hernando Gomez, MD Mentors: Michael R. Pinsky, MD John

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins

Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins Supplemental Material PDGFRb regulates craniofacial development through homodimers and functional heterodimers with PDGFRa Katherine A. Fantauzzo and Philippe Soriano Supplemental materials provided: Supplemental

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:

More information

Nature Medicine: doi: /nm.4078

Nature Medicine: doi: /nm.4078 Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios

More information

Urinary biomarkers in acute kidney injury. Max Bell MD, PhD Karolinska University Hospital Solna/Karolinska Institutet

Urinary biomarkers in acute kidney injury. Max Bell MD, PhD Karolinska University Hospital Solna/Karolinska Institutet Urinary biomarkers in acute kidney injury Max Bell MD, PhD Karolinska University Hospital Solna/Karolinska Institutet Development of AKI-biomarkers Early markers of AKI, do we need them? GFR drop Normal

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Nature Immunology doi: /ni.3268

Nature Immunology doi: /ni.3268 Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Macrophage migration inhibitory factor promotes cyst growth in polycystic kidney disease

Macrophage migration inhibitory factor promotes cyst growth in polycystic kidney disease Macrophage migration inhibitory factor promotes cyst growth in polycystic kidney disease Li Chen,, Jared J. Grantham, Xiaogang Li J Clin Invest. 2015;125(6):2399-2412. https://doi.org/10.1172/jci80467.

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination

More information