For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

Size: px
Start display at page:

Download "For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin"

Transcription

1 Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week 7 after tofoglifozin treatment. The mice were housed individually and the cages were changed each day to remove the food thrown on the floor of the cage. These mice were also housed under a 12-h light-dark cycle and the daily food was placed in the animal cages before the start of the dark cycle (35). Measurement of Adipocyte Size Epididymal white adipose tissue was routinely processed for paraffin embedding, and 4-μm sections were cut and mounted on silanized slides. The adipose tissue sections were stained with hematoxylin and eosin, and the total adipocyte area was manually traced and analyzed using the Image J software. The white adipocyte area was measured in 150 or more cells per mouse in each group, in accordance with a previously described method but with slight modifications (36,37). Urinary Collection and Urinary Glucose Measurement Animals were placed in individual metabolic cages for the collection of urine samples and had ad libitum access to water and food. Urine samples were frozen at -20 C until the measurement of the glucose concentrations. Urinary glucose was assayed using an enzymatic method (Wako Pure Chemical Industries Ltd., Osaka, Japan). 1

2 Dual X-Ray Absorptiometry (DEXA) Before this measurement, the mice were anesthetized with pentobarbital (1 mg/kg). Whole-body measurements were conducted using a Lunar PIXI Mus2 Densitometer (Lunar Corp., Madison, WI) as previously reported but with slight modifications (38). Analysis of the Respiratory Quotient (RQ) Oxygen consumption was measured every 3 minutes for 24 h in mice using an O 2 /CO 2 metabolism measurement device (Model MK-5000; Muromachikikai, Tokyo, Japan), as previously reported (38-43). The RQ was calculated using the following equation based on the volume of O 2 consumed and the volume of CO 2 produced: RQ = vco 2 /vo 2. Computed Tomography (CT) To determine the fat volume and skeletal muscle volume, CT was performed in mice pair-fed for 6 weeks (Hitachi Aroka). The bone volume and bone mineral density were also measured using the manufacturer s software. HOMA-R HOMA-R was calculated by multiplying the fasting blood glucose and serum insulin values. Animals were denied access to food for 24 h (NC) or for 48 h (HFD) before the blood sample collection. 2

3 Clinical Chemistry Assays Clinical chemistry (ALP, T-Bil, BUN, Cre, ip, Ca, Na, K, Cl) assays were performed at Chugai Pharmaceutical Co., Ltd. using enzymatic methods. The serum transaminase levels were measured with the transaminase C-II test kit (Wako Pure Chemical Industries Ltd., Osaka, Japan). Serum free fatty acid (Wako Pure Chemical Industries Ltd., Osaka, Japan) and serum glycerol levels (Cayman Chemical Company, USA) were also assayed using enzymatic methods in accordance with the manufacturer s instructions. The serum ketone body levels were measured using a ketometer N (Sanwa Kagaku Kenkyusho Co., Ltd., Japan). Hct was measured using i-stat (FUSO Pharmaceutical Industries, Ltd.) Serum Adiponectin and Leptin Measurements Samples were collected during the period when the mice had access to water and food ad libitum. Serum adiponectin levels were determined using a mouse adiponectin enzyme-linked immunosorbent assay kit (Otsuka Pharmaceutical Co., Ltd., Tokyo, Japan), and the serum leptin levels were determined using a mouse leptin enzyme-linked immunosorbent assay kit (Morinaga Institute of Biological Science Inc.). Serum Glucagon Measurements Samples were collected at 16 h after the administration of CMC or CMC containing 10 mg/kg of tofogliflozin. A protease inhibitor (Roche life science) was placed in 3

4 tubes on ice and the samples were immediately placed in the tubes, mixed well and allowed to clot, and the serum was separated from the clot by centrifugation. The serum glucagon levels were determined using a mouse glucagon enzyme-linked immunosorbent assay kit (Mercodia Glucagon ELISA) immediately after the samples were collected, in accordance with the manufacturer s instructions. ( RNA Preparation and TaqMan PCR Total RNA was extracted from various tissues with TRIzol reagent (Invitrogen), in accordance with the manufacturer s instructions. After treatment with RNase-Free DNase (Qiagen) to remove genomic DNA, cdna was synthesized with MultiScribe Reverse-Transcriptase (Applied Biosystems, Foster City, CA). The reverse transcription mixture was amplified with specific primers using an ABI Prism 7000 sequence detector equipped with a thermocycler. The probes for cyclophilin, Pepck, Tnf-α, Mcp-1, Il-6, Cpt-1α, Pparα, Pgc1α, Acadm, Acadl, Hmgcs2, and Aqp9 were purchased from Applied Biosystems (Foster City, CA). The primers for cyclophilin and Scd-1, Fasn, Dgat1, and Dgat2 were purchased from Invitrogen. The relative expression levels were compared by normalization to the expression levels of cyclophilin. The primer sequences that were used are shown in Supplemental Table 4. Western-Blot Analysis Tissues were excised and homogenized in ice-cold buffer A (25 mm Tris-HCl [ph7.4], 10 mm sodium orthovanadate, 10 mm sodium pyrophosphate, 100 mm sodium 4

5 fluoride, 10 mm EDTA, 10 mm EGTA, and 1 mm phenylmethylsulfonyl fluoride). Protein concentration of each sample was measured by BCA protein assay reagent (Thermo Fisher Scientific) according to the manufacture s instruction. The sample buffer for analysis under reducing conditions was composed of 3% SDS, 50 mm Tris-HCl (ph6.8), 5% 2-mercaptoethanol, and 10% glycerol. Samples were mixed with 5 sample buffer, heated at 95 C for 5 min for heat denaturation. 15µg of protein was applied to each lane and separated on polyacrylamide gels, and transferred to a Hybond-P polyvinylidene difluoride transfer membrane (Amersham Biosciences). Bands were detected with ECL detection reagents (Amersham Biosciences). Each membrane was cut at 50 kda so as to detect each protein and its internal control (actin). Image J software was used for the measurements of the density of each band. Antibody information is provided in the antibody table. Measurements of the tissue TG and Glycogen Contents To determine the TG contents in the liver and the skeletal muscle, tissue homogenates were extracted with 3:2 (vol/vol) hexan and isopropyl alcohol and the extracts were shaken for 10 min. Then, after centrifugation at rpm for 5 min, the organic layer was collected. The extraction was conducted twice, and the collected samples were dried and resuspended in 1:1 (vol/vol) NP-40 and dioxan. The measurements of the triglyceride and glycogen contents were conducted using Triglyceride C-II Wako (Wako Pure Chemical Industries Ltd., Osaka, Japan) and the Glycogen Assay kit (Wako Pure Chemical Industries Ltd., Osaka, Japan), 5

6 respectively, in accordance with the manufacturer s instructions. Measurements of the Systolic Blood Pressure and Heart Rate Softron BP -98A-L was used to measure the systolic blood pressure and heart rate according to the manufacturer s instructions. The measurements were conducted after the mice had been denied access to food for 16 h. Supplemental Figure Legends Supplemental Figure 1. Outline of all the experiments performed in this study. Supplemental Figure 2. Time-course of changes in the serum drug concentration and urinary glucose excretion rate after the final tofogliflozin administration. Nine-week-old male C57BL/6 mice were fed NC (open bars) or an HFD (filled bars) containing tofogliflozin at 0.015%, a higher concentration than 0.005%, for one week. After one week, the respective meals were administered without tofogliflozin. Blood samples were collected at 0, 24, 48, and 72 h after the switch to meals not containing tofogliflozin. Urine collection was conducted for 12 h during the dark cycle from each of the time-points shown in the figure (n = 4). 6

7 Supplemental Figure 3. Glucose intolerance and insulin resistance after tofogliflozin treatment in mice fed an HFD. (A, B, C) Blood glucose levels, AUC, and serum insulin levels during an OGTT in mice not treated (solid line, open bar) or treated with 0.005% tofogliflozin (dotted line, filled bar) (n = 8). (D) HOMA-R in mice not treated (open bars) or treated with 0.005% tofogliflozin (filled bars) (n = 8). (E, F) Blood glucose and serum insulin levels (n = 14 16). (G, H) G6Pase and Pepck mrna expression levels in the liver (n = 6). (I, J) Serum NEFA and ketone body levels (n = 7 8). (K) RQ during the dark cycle and light cycle (n = 6). (L, M, N, O, P, Q) Liver mrna expression levels (n = 8). Values are the means ± SEM of data obtained from the analysis of each group. *P < **P < Supplemental Figure 4. Serum T-Chol and TG levels after 8 weeks of pair-feeding. The serum T-Chol (left panel) and TG (right panel) levels after the denial of access to food for 16 h in mice not treated (open bars) or treated with 0.005% tofogliflozin (filled bars) (n = 8). Supplemental Figure 5. Systolic blood pressure and heart rate after 8 weeks of pair-feeding. The systolic blood pressure and heart rate after 16 h of the denial of access to food in mice not treated (open bars) or treated with 0.005% tofogliflozin (filled bars) (n = 8). Supplemental Figure 6. Bone volume and bone mineral density after 6 weeks of pair-feeding. The 7

8 bone volume (left panel) and the bone mineral density (right panel) in mice not treated (open bars) or treated with 0.005% tofogliflozin (filled bars) (n = 12-13). Supplemental Figure 7. AUC of OGTT conducted in the pair-fed mice (n = 8-9). Supplemental Figure 8. Skeletal muscle TG contents after 8 weeks of pair-feeding. The TG contents of the skeletal muscle in mice not treated (open bars) or treated with 0.005% tofogliflozin (filled bars) (n = 6-8). 8

9

10

11

12

13

14

15

16

17

18

19

20

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Tofogliflozin Improves Insulin Resistance in Skeletal Muscle and Accelerates Lipolysis in Adipose Tissue in Male Mice

Tofogliflozin Improves Insulin Resistance in Skeletal Muscle and Accelerates Lipolysis in Adipose Tissue in Male Mice ORIGINAL RESEARCH Tofogliflozin Improves Insulin Resistance in Skeletal Muscle and Accelerates Lipolysis in Adipose Tissue in Male Mice Atsushi Obata, Naoto Kubota, Tetsuya Kubota, Masahiko Iwamoto, Hiroyuki

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products.. INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplemental Information

Supplemental Information Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.

Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice. Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Supplementary Figure S1. Effect of stress during withdrawal on expression of sensitization to repeated cocaine exposure in WT and D2R / mice.

Supplementary Figure S1. Effect of stress during withdrawal on expression of sensitization to repeated cocaine exposure in WT and D2R / mice. Supplementary Figure S1. Effect of stress during withdrawal on expression of sensitization to repeated cocaine exposure in WT and D2R / mice. The time course of locomotor activity for WT (a, b) or D2R

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan). Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

Pinpoint Slide RNA Isolation System II Catalog No. R1007

Pinpoint Slide RNA Isolation System II Catalog No. R1007 INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

MagCapture Exosome Isolation Kit PS Q&A

MagCapture Exosome Isolation Kit PS Q&A MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes

More information

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

INSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents

INSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents INSTRUCTION MANUAL Catalog Nos. R1015 & R1016 Highlights Quick (5 minute) method for cleaning and concentrating RNA. Ideal for purification of RNA from aqueous phase following an acid phenol extraction.

More information

Supporting Information

Supporting Information Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with

More information

Protein MultiColor Stable, Low Range

Protein MultiColor Stable, Low Range Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction: Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',

More information

Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows

Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows FULL PAPER Biochemistry Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows Hisami NAKAGAWA-UETA 1) and Norio KATOH 2) * 1) Ishikawa

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8 Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,

More information

The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes

The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes Cantaurus, Vol. 5, -, May 7 McPherson College Division of Science and Technology The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes Callie Crist, Elizabeth

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through

More information

Free Fatty Acid Assay Kit (Fluorometric)

Free Fatty Acid Assay Kit (Fluorometric) Product Manual Free Fatty Acid Assay Kit (Fluorometric) Catalog Number STA-619 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type of lipid

More information

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:

More information

Effects of sea squirt (Halocynthia roretzi) lipids on white adipose tissue weight and blood glucose in diabetic/obese KK-A y mice

Effects of sea squirt (Halocynthia roretzi) lipids on white adipose tissue weight and blood glucose in diabetic/obese KK-A y mice Molecular Medicine REPORTS 3: 449-453, 2010 Effects of sea squirt (Halocynthia roretzi) lipids on white adipose tissue weight and blood glucose in diabetic/obese KK-A y mice Nana Mikami, Masashi Hosokawa

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information