Supplementary information
|
|
- Matilda Moore
- 5 years ago
- Views:
Transcription
1 Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang, Songjoon Baek, Ronni Nielsen, Susanne Mandrup, Gordon L. Hager, Jay H. Chung, Lars Grøntved
2 Supplementary table S1. Summary of Illumina sequencing. Sequencing data was aligned to mm9 using TopHat (RNA-seq [Ribozero]), Bowtie (DNase-seq) or STAR (RNA-seq [PolyA], DNase-seq and ChIP-seq). RNA-seq, PolyA represents RNA-seq data from polya-enriched RNA. RNA-seq, Ribozero represents RNA-seq data produced from RNA-depleted ribosomal RNA. Sample ID Method Uniquely aligned reads Chow, rep1 RNA-seq, PolyA Chow, rep2 RNA-seq, PolyA Chow, rep3 RNA-seq, PolyA HFD, rep1 RNA-seq, PolyA HFD, rep2 RNA-seq, PolyA HFD, rep3 RNA-seq, PolyA HFD-chow, rep1 RNA-seq, PolyA HFD-chow, rep2 RNA-seq, PolyA HFD-chow, rep3 RNA-seq, PolyA Chow-chow, rep1 RNA-seq, PolyA Chow-chow, rep2 RNA-seq, PolyA Chow-chow, rep3 RNA-seq, PolyA Chow, rep1 RNA-seq, Ribozero Chow, rep2 RNA-seq, Ribozero Chow, rep3 RNA-seq, Ribozero HFD, rep1 RNA-seq, Ribozero HFD, rep2 RNA-seq, Ribozero HFD, rep3 RNA-seq, Ribozero Chow, rep1 DNase-seq 4U Chow, rep2 DNase-seq 4U HFD, rep1 DNase-seq 4U HFD, rep2 DNase-seq 4U Chow, rep1 DNase-seq 6U Chow, rep2 DNase-seq 6U HFD, rep1 DNase-seq 6U HFD, rep2 DNase-seq 6U Chow, rep1 H3K27Ac ChIP-seq Chow, rep2 H3K27Ac ChIP-seq Chow, rep3 H3K27Ac ChIP-seq HFD, rep1 H3K27Ac ChIP-seq HFD, rep2 H3K27Ac ChIP-seq HFD, rep3 H3K27Ac ChIP-seq HFD-chow, rep1 H3K27Ac ChIP-seq HFD-chow, rep2 H3K27Ac ChIP-seq HFD-chow, rep3 H3K27Ac ChIP-seq Chow-chow, rep1 H3K27Ac ChIP-seq Chow-chow, rep2 H3K27Ac ChIP-seq Chow-chow, rep3 H3K27Ac ChIP-seq
3 Supplementary table S2. Gene ontology analysis using PANTHER. Overrepresentation test using Bonferroni correction for multiple testing. PANTHER GO-Slim Biological Process Fold P-value Enrichment Lipid metabolic process (GO:6629) E-14 Steroid metabolic process (GO:822) E-1 Fatty acid metabolic process (GO:6631) E-9 Sensory perception of chemical stimulus (GO:766) < E-5 Cholesterol metabolic process (GO:823) E-4 Metabolic process (GO:8152) E-3 Sensory perception of smell (GO:768) <.2 4.6E-3 Primary metabolic process (GO:44238) E-2 Neurological system process (GO:5877) E-2 Sensory perception (GO:76) E-2 Cellular amino acid metabolic process (GO:652) E-2 Gluconeogenesis (GO:694) E-2 Anion transport (GO:682) E-1
4 Supplementary table S3. Reactome curated pathway analysis. Reactome pathway analysis FDR Activation of gene expression by SREBF (SREBP) 6.18E-8 Regulation of cholesterol biosynthesis by SREBP (SREBF) 9.27E-7 Circadian Clock.1281 Fatty acid, triacylglycerol, and ketone body metabolism.1281 Unwinding of DNA Fatty Acyl-CoA Biosynthesis Mitotic G1-G1/S phases ChREBP activates metabolic gene expression Triglyceride Biosynthesis PPARA activates gene expression
5 Supplementary figure S4 Percentage of genes with nearby differential H3K27Ac 7% 6% 5% 4% 3% 2% 1% % Induced H3K27Ac Exon Intron Exon Intron Repressed H3K27Ac Upregulated genes Downregulated genes Supplementary figure S4. Frequency of HFD-induced up- and downregulated genes with nearby accessible regions that are differentially acetylated at H3K27 by HFD. Induced H3K27Ac is marked green and reduced H3K27Ac is marked red. Accessible regions within 1kb of the transcriptional start sites were selected for analysis. Differential gene expression was calculated using in intron or exon reads.
6 Supplementary figure S5 a Motifs in regions with HFD-regulated DHS and increased H3K27Ac Factor Top 1 most enriched known motifs p-val %target/ backgr b Random DHS Increased H3K27Ac Reduced H3K27Ac log odds motif score p-val HNF4 1e-14 32/1 HNF4.2 C/EBP 1e-61 28/11 C/EBP 3.1e-6 ERRA 1e-42 61/41 ERRA.64 PPAR 1e-35 35/19 PPAR.93 FOXA 1e-3 37/22 FOXA.83 ATF4 1e-29 13/4 ATF4 1.5e-1 NFY 1e-27 27/15 NFY 5.2e-8 SREBP 1e-23 11/4 SREBP 8.7e-7 HNF1 1e-22 7/2 HNF1.94 ATF1 1e-21 21/12 ATF1 1.7e-9 Supplementary figure S5. DNA motif analysis of HFD-regulated enhancers. a) DNA-sequence at DNase accessible regions with differentially regulated H3K27Ac by HFD was extracted and subjected to enriched motif analysis by HOMER. Top 1 of the most enriched known motifs. b) Motif strength of the most enriched motifs curated by HOMER at regions with either increased (green) or decreased (red) H3K27Ac or randomly selected DNase accessible regions (grey). Statistical test was performed by Wilcoxon signed-rank test.
7 Supplementary figure S6 a HFD_R3 HFD_R1 HFD_R2 Chow_R1 Chow_R2 Chow_R3 HFD chow_r1 Chow chow_r3 HFD chow_r2 HFD chow_r3 Chow chow_r1 Chow chow_r HFD_R3 HFD_R1.9 HFD_R2.85 Chow_R1 Chow_R2 Chow_R3 HFD chow_r1 Chow chow_r3 HFD chow_r2 HFD chow_r3 Chow chow_r1 Chow chow_r2 b Normalized RNA expression (RT-qPCR relative to Gtf2b) Col1a1.6 p= Tgfb p= Acta2 p=.17.6 p= Des.16 p=.3 p= p=.19 p=.82 c Log2 fold change (HFD-chow/Chow-chow) Weight lossregulated genes FDR.3 log2 mean tag density Chow HFD Chow-chow HFD-chow d HFD-regulated Regulated by weight loss n=39 n=67 Putative persistant n=8 Supplementary figure S6. a) Pairwise corralation analysis (Pearson) of RNA-seq replicates from Chow, HFD, HFD-chow and Chow-chow feeding regimens. RNA-seq data was generated from polya-enriched RNA. Pairwise correlation analysis was clusted using eucledian distance computation. Heatmap shows Pearson correlation coefficient. b) Expression of genes associated with hepatic fibrosis measured by RT-qPCR (n=3-4). Statistical test was performed by two-tailed t-test. Error bars represent SEM. c) Differential RNA expression (RNA-seq) in livers isolated from Chow-chow compared to HFD-chow treated mice. DESeq2 was used to compute FDR. FDR>.3 is colored black, while FDR<.3 is colored according to the heatmap. Red represents most significantly regulated genes. d) Unique and commen regulated genes by HFD and genes regulated as a result of weight loss. Differentially regulated genes are scored at FDR<.5 computed by DESeq2. Commen regulated genes (8 in total) represents putative persistant regulated genes as a result of HFD.
8 Supplementary figure S7 a Component 2 (13%) Regions with HFD-regulated H3K27Ac Chow HFD HFD-chow Chow-chow Component 1 (18%) b HFD_R3 HFD_R1 HFD_R2 Chow_R3 Chow_R1 Chow_R2 HFD chow_r1 Chow chow_r1 Chow chow_r2 HFD chow_r3 Chow chow_r3 HFD chow_r HFD chow_r2 Chow chow_r3 HFD chow_r3 Chow chow_r2 Chow chow_r1 HFD chow_r1 Chow_R2 Chow_R1 Chow_R3 HFD_R2 HFD_R1 HFD_R3 Supplementary figure S7. a) Principle component analysis and b) Pearson pairwise correlation analysis of H3K27Ac ChIP-seq replicates. Analysis was performed on regions demonstrating differential H3K27Ac in response to HFD (p<.5). Pairwise correlation analysis was clusted using eucledian distance computation. Heatmap shows Pearson correlation coefficient.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature19360 Supplementary Tables Supplementary Table 1. Number of monoclonal reads in each sample Sample Number of cells Total reads Aligned reads Monoclonal reads
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationLung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
More informationcis-regulatory enrichment analysis in human, mouse and fly
cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationSupplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
More informationSupplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
More informationRNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................
More informationSupplemental Information. Integrative Transcriptome Analyses. of Metabolic Responses in Mice Define. Pivotal LncRNA Metabolic Regulators
Cell Metabolism, Volume 24 Supplemental Information Integrative Transcriptome Analyses of Metabolic Responses in Mice Define Pivotal LncRNA Metabolic Regulators Ling Yang, Ping Li, Wenjing Yang, Xiangbo
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationSupplemental Information. A Highly Sensitive and Robust Method. for Genome-wide 5hmC Profiling. of Rare Cell Populations
Molecular ell, Volume 63 Supplemental Information Highly Sensitive and Robust Method for enome-wide hm Profiling of Rare ell Populations Dali Han, Xingyu Lu, lan H. Shih, Ji Nie, Qiancheng You, Meng Michelle
More informationAnalysis of in vitro insulin-resistance models and their physiological relevance to in vivo diet-induced adipose insulin resistance
University of Massachusetts Medical School escholarship@umms University of Massachusetts Medical School Faculty Publications 10-17-2013 Analysis of in vitro insulin-resistance models and their physiological
More informationSupplemental Information. Genetic Regulation of Plasma Lipid Species. and Their Association with Metabolic Phenotypes
Cell Systems, Volume 6 Supplemental Information Genetic Regulation of Plasma Lipid Species and Their Association with Metabolic Phenotypes Pooja Jha, Molly T. McDevitt, Emina Halilbasic, Evan G. Williams,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationUser Guide. Association analysis. Input
User Guide TFEA.ChIP is a tool to estimate transcription factor enrichment in a set of differentially expressed genes using data from ChIP-Seq experiments performed in different tissues and conditions.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationSelective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
More informationSupplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination
Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang
More informationNature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationAnalysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4
Khozoie et al. BMC Genomics 2012, 13:665 RESEARCH ARTICLE Open Access Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4 Combiz Khozoie
More informationSupplementary Information
Supplementary Information 5-hydroxymethylcytosine-mediated epigenetic dynamics during postnatal neurodevelopment and aging By Keith E. Szulwach 1,8, Xuekun Li 1,8, Yujing Li 1, Chun-Xiao Song 2, Hao Wu
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationTable S1. Total and mapped reads produced for each ChIP-seq sample
Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3
More informationSupplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
More informationMIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
More informationSalt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
More informationSUPPLEMENTARY INFORMATION
Supplementary text Collectively, we were able to detect ~14,000 expressed genes with RPKM (reads per kilobase per million) > 1 or ~16,000 with RPKM > 0.1 in at least one cell type from oocyte to the morula
More informationDevelopment Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-
Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Expression deviation of the genes mapped to gene-wise recurrent mutations in the TCGA breast cancer cohort (top) and the TCGA lung cancer cohort (bottom). For each gene (each pair
More informationProcessing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data
Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationH3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells
Nucleic Acids Research, 2017 1 doi: 10.1093/nar/gkx251 H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Runsheng He 1,2 and
More informationNature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.
Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationSupplementary figure 1
Supplementary figure 1 Nature Medicine: doi:1.138/nm.275 CLUSTER BY SELF-ORGANIZING MAPS SELECTED PATHWAY ANALISYS TERMS Cluster : up-regulated genes in acute patients Cell cycle/dna repair Fatty acid
More informationSupplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationTranscriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationProfiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
More informationRice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants
Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu
More informationSupplemental Figures
Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSupporting information
Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction
More informationIntegrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
More informationRosa Caiazzo, PhD. The 3 rd Plant Genomics Congress May 2015 London, UK
A systems biology approach to investigate the mechanisms that promote ripening and regulate post-harvest fruit withering in the cherry-like tomato landrace pomodorino del piennolo del Vesuvio Rosa Caiazzo,
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/487/eaag2476/dc1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More information15. Supplementary Figure 9. Predicted gene module expression changes at 24hpi during HIV
Supplementary Information Table of content 1. Supplementary Table 1. Summary of RNAseq data and mapping statistics 2. Supplementary Table 2. Biological functions enriched in 12 hpi DE genes, derived from
More informationSupplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
More informationThe KDM5 family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation
Syddansk Universitet The M family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation Brier, Ann-Sofie B; Loft, Anne; Madsen, Jesper Grud Skat; Nielsen, Thomas
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplemental Information. Derivation of Human Trophoblast Stem Cells
Cell Stem Cell, Volume 22 Supplemental Information Derivation of Human Trophoblast Stem Cells Hiroaki Okae, Hidehiro Toh, Tetsuya Sato, Hitoshi Hiura, Sota Takahashi, Kenjiro Shirane, Yuka Kabayama, Mikita
More informationNature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.
a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]
More informationSupplementary. properties of. network types. randomly sampled. subsets (75%
Supplementary Information Gene co-expression network analysis reveals common system-level prognostic genes across cancer types properties of Supplementary Figure 1 The robustness and overlap of prognostic
More informationSUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7
SUPPLEMENTAL DATA Figure S1. Muscle mass changes in different anatomical regions with age. (A) The TA and gastrocnemius muscle showed a significant loss of weight in aged mice (24 month old) compared to
More informationOffice number.
The University of Jordan Faculty: Pharmacy Department: Biopharmaceutics and Clinical Pharmacy Program: Pharmacy Academic Year/ Fall Semester: 2014/15 BIOCHEMISTRY 2 [1203253] Credit hours 3 Level 2 nd
More informationInhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative
SUPPLEMENTARY INFORMATION Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative breast cancer Roman Camarda, Alicia Y. Zhou, Rebecca A. Kohnz, Sanjeev Balakrishnan, Celine
More informationDistinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation
Savic et al. Genome Medicine (6) 8:74 DOI.86/s373-6-38-6 RESEARCH Open Access Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation
More informationBroad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
More informationGenome-Wide mrna Expression Analysis of Hepatic Adaptation to High-Fat Diets Reveals Switch from an Inflammatory to Steatotic Transcriptional Program
Genome-Wide mrna Expression Analysis of Hepatic Adaptation to High-Fat Diets Reveals Switch from an Inflammatory to Steatotic Transcriptional Program Marijana Radonjic 1,2 *, Jorn R. de Haan 1,2, Marjan
More informationA prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding
Supplementary Information A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding Qilai Huang 1,2*, Thomas Whitington 3,4*, Ping Gao 1,2, Johan
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationFatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation
Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationFormalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed
More informationHistone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells
Histone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells Ondrej Podlaha 1, Subhajyoti De 2,3,4, Mithat Gonen 5, Franziska Michor 1 * 1 Department of Biostatistics
More information