Supplementary information

Size: px
Start display at page:

Download "Supplementary information"

Transcription

1 Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang, Songjoon Baek, Ronni Nielsen, Susanne Mandrup, Gordon L. Hager, Jay H. Chung, Lars Grøntved

2 Supplementary table S1. Summary of Illumina sequencing. Sequencing data was aligned to mm9 using TopHat (RNA-seq [Ribozero]), Bowtie (DNase-seq) or STAR (RNA-seq [PolyA], DNase-seq and ChIP-seq). RNA-seq, PolyA represents RNA-seq data from polya-enriched RNA. RNA-seq, Ribozero represents RNA-seq data produced from RNA-depleted ribosomal RNA. Sample ID Method Uniquely aligned reads Chow, rep1 RNA-seq, PolyA Chow, rep2 RNA-seq, PolyA Chow, rep3 RNA-seq, PolyA HFD, rep1 RNA-seq, PolyA HFD, rep2 RNA-seq, PolyA HFD, rep3 RNA-seq, PolyA HFD-chow, rep1 RNA-seq, PolyA HFD-chow, rep2 RNA-seq, PolyA HFD-chow, rep3 RNA-seq, PolyA Chow-chow, rep1 RNA-seq, PolyA Chow-chow, rep2 RNA-seq, PolyA Chow-chow, rep3 RNA-seq, PolyA Chow, rep1 RNA-seq, Ribozero Chow, rep2 RNA-seq, Ribozero Chow, rep3 RNA-seq, Ribozero HFD, rep1 RNA-seq, Ribozero HFD, rep2 RNA-seq, Ribozero HFD, rep3 RNA-seq, Ribozero Chow, rep1 DNase-seq 4U Chow, rep2 DNase-seq 4U HFD, rep1 DNase-seq 4U HFD, rep2 DNase-seq 4U Chow, rep1 DNase-seq 6U Chow, rep2 DNase-seq 6U HFD, rep1 DNase-seq 6U HFD, rep2 DNase-seq 6U Chow, rep1 H3K27Ac ChIP-seq Chow, rep2 H3K27Ac ChIP-seq Chow, rep3 H3K27Ac ChIP-seq HFD, rep1 H3K27Ac ChIP-seq HFD, rep2 H3K27Ac ChIP-seq HFD, rep3 H3K27Ac ChIP-seq HFD-chow, rep1 H3K27Ac ChIP-seq HFD-chow, rep2 H3K27Ac ChIP-seq HFD-chow, rep3 H3K27Ac ChIP-seq Chow-chow, rep1 H3K27Ac ChIP-seq Chow-chow, rep2 H3K27Ac ChIP-seq Chow-chow, rep3 H3K27Ac ChIP-seq

3 Supplementary table S2. Gene ontology analysis using PANTHER. Overrepresentation test using Bonferroni correction for multiple testing. PANTHER GO-Slim Biological Process Fold P-value Enrichment Lipid metabolic process (GO:6629) E-14 Steroid metabolic process (GO:822) E-1 Fatty acid metabolic process (GO:6631) E-9 Sensory perception of chemical stimulus (GO:766) < E-5 Cholesterol metabolic process (GO:823) E-4 Metabolic process (GO:8152) E-3 Sensory perception of smell (GO:768) <.2 4.6E-3 Primary metabolic process (GO:44238) E-2 Neurological system process (GO:5877) E-2 Sensory perception (GO:76) E-2 Cellular amino acid metabolic process (GO:652) E-2 Gluconeogenesis (GO:694) E-2 Anion transport (GO:682) E-1

4 Supplementary table S3. Reactome curated pathway analysis. Reactome pathway analysis FDR Activation of gene expression by SREBF (SREBP) 6.18E-8 Regulation of cholesterol biosynthesis by SREBP (SREBF) 9.27E-7 Circadian Clock.1281 Fatty acid, triacylglycerol, and ketone body metabolism.1281 Unwinding of DNA Fatty Acyl-CoA Biosynthesis Mitotic G1-G1/S phases ChREBP activates metabolic gene expression Triglyceride Biosynthesis PPARA activates gene expression

5 Supplementary figure S4 Percentage of genes with nearby differential H3K27Ac 7% 6% 5% 4% 3% 2% 1% % Induced H3K27Ac Exon Intron Exon Intron Repressed H3K27Ac Upregulated genes Downregulated genes Supplementary figure S4. Frequency of HFD-induced up- and downregulated genes with nearby accessible regions that are differentially acetylated at H3K27 by HFD. Induced H3K27Ac is marked green and reduced H3K27Ac is marked red. Accessible regions within 1kb of the transcriptional start sites were selected for analysis. Differential gene expression was calculated using in intron or exon reads.

6 Supplementary figure S5 a Motifs in regions with HFD-regulated DHS and increased H3K27Ac Factor Top 1 most enriched known motifs p-val %target/ backgr b Random DHS Increased H3K27Ac Reduced H3K27Ac log odds motif score p-val HNF4 1e-14 32/1 HNF4.2 C/EBP 1e-61 28/11 C/EBP 3.1e-6 ERRA 1e-42 61/41 ERRA.64 PPAR 1e-35 35/19 PPAR.93 FOXA 1e-3 37/22 FOXA.83 ATF4 1e-29 13/4 ATF4 1.5e-1 NFY 1e-27 27/15 NFY 5.2e-8 SREBP 1e-23 11/4 SREBP 8.7e-7 HNF1 1e-22 7/2 HNF1.94 ATF1 1e-21 21/12 ATF1 1.7e-9 Supplementary figure S5. DNA motif analysis of HFD-regulated enhancers. a) DNA-sequence at DNase accessible regions with differentially regulated H3K27Ac by HFD was extracted and subjected to enriched motif analysis by HOMER. Top 1 of the most enriched known motifs. b) Motif strength of the most enriched motifs curated by HOMER at regions with either increased (green) or decreased (red) H3K27Ac or randomly selected DNase accessible regions (grey). Statistical test was performed by Wilcoxon signed-rank test.

7 Supplementary figure S6 a HFD_R3 HFD_R1 HFD_R2 Chow_R1 Chow_R2 Chow_R3 HFD chow_r1 Chow chow_r3 HFD chow_r2 HFD chow_r3 Chow chow_r1 Chow chow_r HFD_R3 HFD_R1.9 HFD_R2.85 Chow_R1 Chow_R2 Chow_R3 HFD chow_r1 Chow chow_r3 HFD chow_r2 HFD chow_r3 Chow chow_r1 Chow chow_r2 b Normalized RNA expression (RT-qPCR relative to Gtf2b) Col1a1.6 p= Tgfb p= Acta2 p=.17.6 p= Des.16 p=.3 p= p=.19 p=.82 c Log2 fold change (HFD-chow/Chow-chow) Weight lossregulated genes FDR.3 log2 mean tag density Chow HFD Chow-chow HFD-chow d HFD-regulated Regulated by weight loss n=39 n=67 Putative persistant n=8 Supplementary figure S6. a) Pairwise corralation analysis (Pearson) of RNA-seq replicates from Chow, HFD, HFD-chow and Chow-chow feeding regimens. RNA-seq data was generated from polya-enriched RNA. Pairwise correlation analysis was clusted using eucledian distance computation. Heatmap shows Pearson correlation coefficient. b) Expression of genes associated with hepatic fibrosis measured by RT-qPCR (n=3-4). Statistical test was performed by two-tailed t-test. Error bars represent SEM. c) Differential RNA expression (RNA-seq) in livers isolated from Chow-chow compared to HFD-chow treated mice. DESeq2 was used to compute FDR. FDR>.3 is colored black, while FDR<.3 is colored according to the heatmap. Red represents most significantly regulated genes. d) Unique and commen regulated genes by HFD and genes regulated as a result of weight loss. Differentially regulated genes are scored at FDR<.5 computed by DESeq2. Commen regulated genes (8 in total) represents putative persistant regulated genes as a result of HFD.

8 Supplementary figure S7 a Component 2 (13%) Regions with HFD-regulated H3K27Ac Chow HFD HFD-chow Chow-chow Component 1 (18%) b HFD_R3 HFD_R1 HFD_R2 Chow_R3 Chow_R1 Chow_R2 HFD chow_r1 Chow chow_r1 Chow chow_r2 HFD chow_r3 Chow chow_r3 HFD chow_r HFD chow_r2 Chow chow_r3 HFD chow_r3 Chow chow_r2 Chow chow_r1 HFD chow_r1 Chow_R2 Chow_R1 Chow_R3 HFD_R2 HFD_R1 HFD_R3 Supplementary figure S7. a) Principle component analysis and b) Pearson pairwise correlation analysis of H3K27Ac ChIP-seq replicates. Analysis was performed on regions demonstrating differential H3K27Ac in response to HFD (p<.5). Pairwise correlation analysis was clusted using eucledian distance computation. Heatmap shows Pearson correlation coefficient.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature19360 Supplementary Tables Supplementary Table 1. Number of monoclonal reads in each sample Sample Number of cells Total reads Aligned reads Monoclonal reads

More information

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets. Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

More information

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1 a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplementary Figures and Tables

Supplementary Figures and Tables Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:

More information

cis-regulatory enrichment analysis in human, mouse and fly

cis-regulatory enrichment analysis in human, mouse and fly cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded

Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency

More information

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................

More information

Supplemental Information. Integrative Transcriptome Analyses. of Metabolic Responses in Mice Define. Pivotal LncRNA Metabolic Regulators

Supplemental Information. Integrative Transcriptome Analyses. of Metabolic Responses in Mice Define. Pivotal LncRNA Metabolic Regulators Cell Metabolism, Volume 24 Supplemental Information Integrative Transcriptome Analyses of Metabolic Responses in Mice Define Pivotal LncRNA Metabolic Regulators Ling Yang, Ping Li, Wenjing Yang, Xiangbo

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Supplemental Information. A Highly Sensitive and Robust Method. for Genome-wide 5hmC Profiling. of Rare Cell Populations

Supplemental Information. A Highly Sensitive and Robust Method. for Genome-wide 5hmC Profiling. of Rare Cell Populations Molecular ell, Volume 63 Supplemental Information Highly Sensitive and Robust Method for enome-wide hm Profiling of Rare ell Populations Dali Han, Xingyu Lu, lan H. Shih, Ji Nie, Qiancheng You, Meng Michelle

More information

Analysis of in vitro insulin-resistance models and their physiological relevance to in vivo diet-induced adipose insulin resistance

Analysis of in vitro insulin-resistance models and their physiological relevance to in vivo diet-induced adipose insulin resistance University of Massachusetts Medical School escholarship@umms University of Massachusetts Medical School Faculty Publications 10-17-2013 Analysis of in vitro insulin-resistance models and their physiological

More information

Supplemental Information. Genetic Regulation of Plasma Lipid Species. and Their Association with Metabolic Phenotypes

Supplemental Information. Genetic Regulation of Plasma Lipid Species. and Their Association with Metabolic Phenotypes Cell Systems, Volume 6 Supplemental Information Genetic Regulation of Plasma Lipid Species and Their Association with Metabolic Phenotypes Pooja Jha, Molly T. McDevitt, Emina Halilbasic, Evan G. Williams,

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells. Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

User Guide. Association analysis. Input

User Guide. Association analysis. Input User Guide TFEA.ChIP is a tool to estimate transcription factor enrichment in a set of differentially expressed genes using data from ChIP-Seq experiments performed in different tissues and conditions.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the

More information

Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination

Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality. Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

More information

Table S1. Quantitative RT-PCR primers

Table S1. Quantitative RT-PCR primers Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus. Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4

Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4 Khozoie et al. BMC Genomics 2012, 13:665 RESEARCH ARTICLE Open Access Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4 Combiz Khozoie

More information

Supplementary Information

Supplementary Information Supplementary Information 5-hydroxymethylcytosine-mediated epigenetic dynamics during postnatal neurodevelopment and aging By Keith E. Szulwach 1,8, Xuekun Li 1,8, Yujing Li 1, Chun-Xiao Song 2, Hao Wu

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Table S1. Total and mapped reads produced for each ChIP-seq sample

Table S1. Total and mapped reads produced for each ChIP-seq sample Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3

More information

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal

More information

MIR retrotransposon sequences provide insulators to the human genome

MIR retrotransposon sequences provide insulators to the human genome Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert

More information

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary text Collectively, we were able to detect ~14,000 expressed genes with RPKM (reads per kilobase per million) > 1 or ~16,000 with RPKM > 0.1 in at least one cell type from oocyte to the morula

More information

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/- Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Expression deviation of the genes mapped to gene-wise recurrent mutations in the TCGA breast cancer cohort (top) and the TCGA lung cancer cohort (bottom). For each gene (each pair

More information

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells

H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Nucleic Acids Research, 2017 1 doi: 10.1093/nar/gkx251 H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Runsheng He 1,2 and

More information

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs. Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Supplementary figure 1

Supplementary figure 1 Supplementary figure 1 Nature Medicine: doi:1.138/nm.275 CLUSTER BY SELF-ORGANIZING MAPS SELECTED PATHWAY ANALISYS TERMS Cluster : up-regulated genes in acute patients Cell cycle/dna repair Fatty acid

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

Transcriptome Analysis

Transcriptome Analysis Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits

More information

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)

Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State

More information

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu

More information

Supplemental Figures

Supplemental Figures Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Supporting information

Supporting information Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction

More information

Integrative Metabolism: Significance

Integrative Metabolism: Significance Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

More information

Rosa Caiazzo, PhD. The 3 rd Plant Genomics Congress May 2015 London, UK

Rosa Caiazzo, PhD. The 3 rd Plant Genomics Congress May 2015 London, UK A systems biology approach to investigate the mechanisms that promote ripening and regulate post-harvest fruit withering in the cherry-like tomato landrace pomodorino del piennolo del Vesuvio Rosa Caiazzo,

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/487/eaag2476/dc1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated

More information

15. Supplementary Figure 9. Predicted gene module expression changes at 24hpi during HIV

15. Supplementary Figure 9. Predicted gene module expression changes at 24hpi during HIV Supplementary Information Table of content 1. Supplementary Table 1. Summary of RNAseq data and mapping statistics 2. Supplementary Table 2. Biological functions enriched in 12 hpi DE genes, derived from

More information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative

More information

The KDM5 family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation

The KDM5 family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation Syddansk Universitet The M family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation Brier, Ann-Sofie B; Loft, Anne; Madsen, Jesper Grud Skat; Nielsen, Thomas

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplemental Information. Derivation of Human Trophoblast Stem Cells

Supplemental Information. Derivation of Human Trophoblast Stem Cells Cell Stem Cell, Volume 22 Supplemental Information Derivation of Human Trophoblast Stem Cells Hiroaki Okae, Hidehiro Toh, Tetsuya Sato, Hitoshi Hiura, Sota Takahashi, Kenjiro Shirane, Yuka Kabayama, Mikita

More information

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2. a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]

More information

Supplementary. properties of. network types. randomly sampled. subsets (75%

Supplementary. properties of. network types. randomly sampled. subsets (75% Supplementary Information Gene co-expression network analysis reveals common system-level prognostic genes across cancer types properties of Supplementary Figure 1 The robustness and overlap of prognostic

More information

SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7

SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7 SUPPLEMENTAL DATA Figure S1. Muscle mass changes in different anatomical regions with age. (A) The TA and gastrocnemius muscle showed a significant loss of weight in aged mice (24 month old) compared to

More information

Office number.

Office number. The University of Jordan Faculty: Pharmacy Department: Biopharmaceutics and Clinical Pharmacy Program: Pharmacy Academic Year/ Fall Semester: 2014/15 BIOCHEMISTRY 2 [1203253] Credit hours 3 Level 2 nd

More information

Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative

Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative SUPPLEMENTARY INFORMATION Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative breast cancer Roman Camarda, Alicia Y. Zhou, Rebecca A. Kohnz, Sanjeev Balakrishnan, Celine

More information

Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation

Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation Savic et al. Genome Medicine (6) 8:74 DOI.86/s373-6-38-6 RESEARCH Open Access Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation

More information

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,

More information

Genome-Wide mrna Expression Analysis of Hepatic Adaptation to High-Fat Diets Reveals Switch from an Inflammatory to Steatotic Transcriptional Program

Genome-Wide mrna Expression Analysis of Hepatic Adaptation to High-Fat Diets Reveals Switch from an Inflammatory to Steatotic Transcriptional Program Genome-Wide mrna Expression Analysis of Hepatic Adaptation to High-Fat Diets Reveals Switch from an Inflammatory to Steatotic Transcriptional Program Marijana Radonjic 1,2 *, Jorn R. de Haan 1,2, Marjan

More information

A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding

A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding Supplementary Information A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding Qilai Huang 1,2*, Thomas Whitington 3,4*, Ping Gao 1,2, Johan

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation

Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds

Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed

More information

Histone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells

Histone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells Histone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells Ondrej Podlaha 1, Subhajyoti De 2,3,4, Mithat Gonen 5, Franziska Michor 1 * 1 Department of Biostatistics

More information