Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk
|
|
|
- Alexis Spencer
- 5 years ago
- Views:
Transcription
1 EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated as described in the legend of Fig. 3B. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antiphosphoakt (Ser473) and Akt antibody (top). Densitometric quantification was performed on immunoblotting data from at least 3 independent experiments (bottom). Bars indicate s.e.m. B. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antiphospho Erk1/2(Thr22/Tyr24) and Erk1/2 antibody (top). Densitometric quantification was performed on immunoblotting data of at least 3 independent experiments (bottom). Bars indicate s.e.m. Figure S2. Effect of chloroquine on EGFstimulated mtorc1, Akt and Erk activation and effect of bafilomycin and chloroquine on cell apoptosis. A. Hepatocytes were pretreated with either vehicle or 1 µm chloroquine for 3 minutes, and then incubated with 1 nm EGF for the times shown. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antibodies as indicated. The results are from a single exposed gel which was sliced to allow sidebyside comparison of the data. Data shown are representative of at least 3 independent experiments. B. Densitometric quantitation of selected results from Fig. S2A is shown. Results are means ± s.e.m. of at least 3 independent experiments. *p<.5. C. Hepatocytes were pretreated with DMSO, 1 nm bafilomycin or 1 µm chloroquine for 3 minutes, and then incubated with 1 nm EGF for the times shown. Cell lysates were subjected to SDSPAGE followed by immunoblotting with anti Caspase 3 and PARP antibody. 1
2 EGF induced VATPase assembly and mtorc1 activation Figure S3. Similar effect of bafilomycin on insulin and EGFstimulated mtorc1, Akt and Erk activation. Hepatocytes were pretreated with either DMSO or 1 nm bafilomycin, and then stimulated with 1 nm EGF or insulin for the times shown. Cell lysates were subjected to SDSPAGE followed by immunoblotting with the indicated antibodies. Data shown are representative of at least 3 independent experiments. Figure S4. Bafilomycin does not alter mtor and Raptor association, energy status, Akt effect on TSC2, the total intracellular amino acid concentration and leucine uptake in hepatocytes. Serum starved primary hepatocytes were preincubated with either serumfree medium or warm PBS, in the presence of DMSO or 1 nm bafilomycin for 3 minutes. A. Cells were incubated with 1 nm EGF for the times shown. Cell lysates were incubated with antimtor antibody, and the immunoprecipitates were subjected to SDS PAGE followed by immunoblotting with antimtor and raptor antibodies (top). Densitometric quantification was performed on immunoblotting data of 3 independent studies (bottom). Raptor mtor association is expressed as fold over basal in each of three independent studies.bars indicate s.e.m. B. Cells were incubated with 1 nm EGF or insulin for the times shown. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antiphosphoampk (Thr172) and AMPK antibody. Data are representative of 3 independent experiments. C. Cells were incubated with 1 nm EGF for the times shown. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antiphosphotsc2 2
3 EGF induced VATPase assembly and mtorc1 activation (Thr1462) and TSC2 antibody (left). Densitometric quantification was performed on immunoblotting data of at least 3 independent studies (right). Bars indicate s.e.m. D. Cells were incubated with 1 nm EGF for the times shown. Total amino acid analysis was performed by using the Lamino acid quantitation kit from Biovision. E. Cells were incubated with EGF or insulin in the presence of 3Hleucine for minutes. Leucine uptake was measured by scintillation counting. Results are means ± s.e.m. of 3 independent experiments. Figure S5. Effect of chloroquine on EGFstimulated mtorc1 in the presence of cycloheximide. Hepatocytes were pretreated with either DMSO, 1 µm chloroquine (CQ), 25 µg/ml cycloheximide (CHX) or CQ and CHX together (CQCHX) for 3 minutes, and then incubated with 1nM EGF for another 3 minutes. A. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antiphosphop7s6k (Thr389) and p7s6k antibody (top). Quantification was performed from 3 independent experiments. * p<.5; bars indicate s.e.m. (bottom). B. Cell lysates were subjected to SDSPAGE followed by immunoblotting with antiphospho4ebp1 (Ser65) and 4EBP1 antibody (top). Quantification was performed from 3 independent experiments. * p<.5; bars indicate s.e.m. (bottom). Figure S6. Effect of in vivo chloroquine on Rag GTPase. Animals received 1 mg/2g body weight of chloroquine by intraperitoneal injection, 2 hours and 1 hour prior to EGF stimulation. animals received a comparable volume of normal saline. Rat liver subcellular fractions were prepared as described in Experimental Procedures from rat livers at minutes after EGF (1. µg/1 g BW) or 3
4 EGF induced VATPase assembly and mtorc1 activation vehicle administration. Immunoblotting of RagA and RagC in rat liver endosomes (EN) is shown. 4
5 Supplemental Figure S1 EGF induced VATPase assembly and mtorc1 activation A EGF (min) Bafilomycin PAkt(S473) PAKT(Ser473)/AKT(% Maximal) PAkt/Akt (% Maximal) Akt 1 Baf Time after EGF (min) EGF (min) Bafilomycin PErk (T22/Y24) Erk1/2 1 PErk/ErK (% Maximal) B Baf Time after EGF 5 (min) 5 6
6 EGF induced VATPase assembly and mtorc1 activation Supplemental Figure S2 EGF (min) Chloroquine PYEGFR EGFR PAkt (S473) B Pp7S6K /p7s6k(% Maximal) A Akt PAkt/Akt (% Maximal) (T22/Y24) Erk1/2 * PErk 5 6 CQ Actin p7s6k EGF (min) 2 6 P4EBP1 PErk/Erk (% Maximal) Pp7S6K (T389) Chloroquine CQ EBP Time After EGF (min) (S65) 5 5 6
7 C EGF induced VATPase assembly and mtorc1 activation Bafilomycin Chloroquine EGF (min) Caspase PARP
8 EGF induced VATPase assembly and mtorc1 activation Supplemental Figure S3 5min min EGF Ins EGF 3min 6min Ins EGF Ins EGF Ins Bafilomycin Pp7S6K (T389) p7s6k 4EBP1 mtor PErk (T22/Y24) PAkt (S473) PYEGFR PYIR 8
9 Supplemental Figure S4 A EGF (min) 2 5 PBS WB:Raptor WB:mTOR Raptor/mTOR (fold basal) IP:mTOR Bafilomycin EGF induced VATPase assembly and mtorc1 activation 1.5 DMSO Baf PBS EGF Insulin Time after EGF (min) 2min 5min Insulin EGF Insulin EGF B Bafilomycin 5 min PBS PAMPK (T172) AMPK 12 EGF (min) 3 PTSC2 / TSC2(% Maximal) C Bafilomycin 3 Baf 1 PTSC2 (T1462) TSC2 control Time after EGF (min) 3
10 Free Amino Acid (nmol/1 6 cells) D EGF induced VATPase assembly and mtorc1 activation Baf 5 6 Time after EGF (min) E 3 HLeucine uptake (Fold PBSstarved) DMSO Baf Ins EGF PBS Starved 1
11 Supplemental Figure S5 EGF induced VATPase assembly and mtorc1 activation A EGF Pp7S6K (T389) p7s6k CQ CHX CQCHX Pp7S6K/p7S6K (% Maximal) Basal EGF CQ CHX CQCHX * B EGF P4EBP1 (S65) 4EBP1 CQ CHX CQCHX P4EBP1/4EBP1(% Maximal) * 11
12 Supplemental Figure S6 EGF induced VATPase assembly and mtorc1 activation EGF Chloroquine RagA(EN) EGF Chloroquine RagC(EN) 12
13 EGF induced VATPase assembly and mtorc1 activation Table S1 Functional categorization of the proteins changing in ENDRMs following EGF determined by proteomic analysis. Protein Category # of proteins % of total # of proteins # of proteins Signaling Receptor and Transporter Trafficking Transcription/Translation Ubiquitination/ Proteasome Structural/Cytoskeleton Metabolism Unknown Function Miscellaneous Total Proteins from ENDRM fractions prepared from the livers of 3 control and 3 EGFtreated rats were identified by proteomic analysis as described in Experimental Procedures. The proteins listed per category were those which changed by >1.5 fold increase or decrease in mean peptide counts in all 3 EGFtreated animals., increased post EGF;, decreased post EGF. 13
14 EGF induced VATPase assembly and mtorc1 activation Table S2 Concentrations of amino acids (AAs) in medium and primary hepatocytes (nmol/ml) before and after treatment with EGF and bafilomycin (Baf). Medium Hepatocytes a Basal EGF AA Baf Baf % change Essential MET ± ± ±1.8 65%** VAL ±.5 2.3± ±1.4 62%** PHE ± ± ±2.3 52%** ILE ± ± ±2. 49%** LEU ± ±3.1.3±1.3 48%** LYS ±.2 16.±1.6 9.±1. 44%** THR ± ± ±3.5 n/s TRP ±.1 5.1±.6 3.8±.6 n/s ARG b ± ± ±2.5 59%** TYR b ±.5 29.±3..9±1.7 45%** HIS b ± ± ±3.4 n/s SUM ± ± ± %** Nonessential ORN 29.± ± ±1.8 21%* ASN ±.1.1± ±1.2 35%* ASP 23.9±.4 24.± ±3.9 61%* TAU 6.5±.3 7.± ±1. 8%** GLU ± ± ±3.1 n/s SER ±1. 6.3± ±3.7 n/s GLN ±.6 8.2±8. 8.9±5.4 n/s GLY ± ± ±5.7 n/s ALA ± ± ±4.3 n/s CIT 2.7±.3 3.±.2 3.8±.6 n/s SUM ± ± ±3.6 n/s TOTAL ± ± ±5.5 n/s a The values in the table are means of 3 independent replicates ±s.e.m. *p<.5, **p<.1. b Essential only in certain cases. 14
15 EGF induced VATPase assembly and mtorc1 activation Table S3 Concentrations of amino acids (AAs) in primary hepatocytes (nmol/ml) after treatment with EGF with bafilomycin (Baf) and cycloheximide (CHX). AA Baf CHX BafCHX Essential LEU 53.8± ± ± ±1.1 MET 22.6± ± ± ±.5 LYS 41.1± ± ± ±.9 VAL 37.3± ± ± ±.7 PHE 3.2±2. 18.±.9 32.± ±.8 ILE 16.8± ± ± ±.3 THR 47.1± ± ± ±1.3 TRP 6.5±.3 5.±.2 6.7±.5 6.1±.2 ARG a 26.9±1.7.5±.5 33.± ±1.3 TYR a 27.4± ± ± ±.4 HIS a 16.9± ± ± ±.3 SUM 326.6± ± ± ±6.8 NonEssential ORN 3.9± ± ± ±.6 ASN 16.6± ±.7 2.3± ±.2 ASP 25.1± ± ± ±.6 TAU 12.4±.8 14.± ± ±.3 GLU 71.3±1.7 8.± ± ±2.9 SER 79.8± ± ± ±2.1 GLN 16.± ± ± ±4.3 GLY 45.6± ± ± ±12. ALA 58.9± ± ± ±1.7 CIT 5.±.2 6.8±.1 5.7±.4 7.5±.4 SUM 55.6± ± ± ±1.6 TOTAL 832.1± ± ± ±11.2 a Essential only in certain cases The values in the table are means of 3 independent replicates ±s.e.m.
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 4 Protein Sequence
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 4 Protein Sequence 2 3 4 Are You Getting It?? A molecule of hemoglobin is compared with a molecule of lysozyme. Which characteristics do they share?
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Amino Acids. Amino Acids. Fundamentals. While their name implies that amino acids are compounds that contain an NH. 3 and CO NH 3
Fundamentals While their name implies that amino acids are compounds that contain an 2 group and a 2 group, these groups are actually present as 3 and 2 respectively. They are classified as α, β, γ, etc..
1. Describe the relationship of dietary protein and the health of major body systems.
Food Explorations Lab I: The Building Blocks STUDENT LAB INVESTIGATIONS Name: Lab Overview In this investigation, you will be constructing animal and plant proteins using beads to represent the amino acids.
Optimizing Protein in a Carbohydrate World
Optimizing Protein in a Carbohydrate World Donald K. Layman, Ph.D. Professor Emeritus Department of Food Science & Human Nutrition University of Illinois at Urbana Champaign The confused consumer 1 Myth:
Amino acids-incorporated nanoflowers with an
Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of
Objective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
Algal Biofuels Research: Using basic science to maximize fuel output. Jacob Dums, PhD candidate, Heike Sederoff Lab March 9, 2015
Algal Biofuels Research: Using basic science to maximize fuel output Jacob Dums, PhD candidate, jtdums@ncsu.edu Heike Sederoff Lab March 9, 2015 Outline Research Approach Dunaliella Increase Oil Content
The Basics: A general review of molecular biology:
The Basics: A general review of molecular biology: DNA Transcription RNA Translation Proteins DNA (deoxy-ribonucleic acid) is the genetic material It is an informational super polymer -think of it as the
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
Properties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but far from the only one!!!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids
CHAPTER 21: Amino Acids, Proteins, & Enzymes. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 21: Amino Acids, Proteins, & Enzymes General, Organic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 21: Amino Acids, Proteins, Enzymes Learning Objectives: q The 20 common, naturally occurring
Page 8/6: The cell. Where to start: Proteins (control a cell) (start/end products)
Page 8/6: The cell Where to start: Proteins (control a cell) (start/end products) Page 11/10: Structural hierarchy Proteins Phenotype of organism 3 Dimensional structure Function by interaction THE PROTEIN
LAB#23: Biochemical Evidence of Evolution Name: Period Date :
LAB#23: Biochemical Evidence of Name: Period Date : Laboratory Experience #23 Bridge Worth 80 Lab Minutes If two organisms have similar portions of DNA (genes), these organisms will probably make similar
Supplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
Supporting Information
Supporting Information Discovery of linear low-cationic peptides to target methicillin-resistant Staphylococcus aureus in vivo Yuan Liu, Meirong Song, Shuangyang Ding,, Kui Zhu*,,, Beijing Advanced Innovation
Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels. Supplementary Information
Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels Craig T. Armstrong, Philip E. Mason, J. L. Ross Anderson and Christopher E. Dempsey
CS612 - Algorithms in Bioinformatics
Spring 2016 Protein Structure February 7, 2016 Introduction to Protein Structure A protein is a linear chain of organic molecular building blocks called amino acids. Introduction to Protein Structure Amine
Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
Nature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
Biomolecules: amino acids
Biomolecules: amino acids Amino acids Amino acids are the building blocks of proteins They are also part of hormones, neurotransmitters and metabolic intermediates There are 20 different amino acids in
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Chemistry 121 Winter 17
Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;
The Structure and Function of Large Biological Molecules Part 4: Proteins Chapter 5
Key Concepts: The Structure and Function of Large Biological Molecules Part 4: Proteins Chapter 5 Proteins include a diversity of structures, resulting in a wide range of functions Proteins Enzymatic s
2. Which of the following amino acids is most likely to be found on the outer surface of a properly folded protein?
Name: WHITE Student Number: Answer the following questions on the computer scoring sheet. 1 mark each 1. Which of the following amino acids would have the highest relative mobility R f in normal thin layer
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
Molecular Biology. general transfer: occurs normally in cells. special transfer: occurs only in the laboratory in specific conditions.
Chapter 9: Proteins Molecular Biology replication general transfer: occurs normally in cells transcription special transfer: occurs only in the laboratory in specific conditions translation unknown transfer:
Methionine (Met or M)
Fig. 5-17 Nonpolar Fig. 5-17a Nonpolar Glycine (Gly or G) Alanine (Ala or A) Valine (Val or V) Leucine (Leu or L) Isoleucine (Ile or I) Methionine (Met or M) Phenylalanine (Phe or F) Polar Trypotphan (Trp
Quantitative LC-MS/MS Analysis of Glucagon. Veniamin Lapko, Ph.D June 21, 2011
Quantitative LC-MS/MS Analysis of Glucagon Veniamin Lapko, Ph.D June 21, 2011 Contents Comparison with small molecule LC-MS/MS LC-MS/MS sensitivity of peptides detection Stability: neat vs. matrix solutions
Lipids: diverse group of hydrophobic molecules
Lipids: diverse group of hydrophobic molecules Lipids only macromolecules that do not form polymers li3le or no affinity for water hydrophobic consist mostly of hydrocarbons nonpolar covalent bonds fats
Chemical Nature of the Amino Acids. Table of a-amino Acids Found in Proteins
Chemical Nature of the Amino Acids All peptides and polypeptides are polymers of alpha-amino acids. There are 20 a- amino acids that are relevant to the make-up of mammalian proteins (see below). Several
S-01 SUPPORTING INFORMATION. TITLE: Inter-laboratory reproducibility of a targeted metabolomics platform for analysis of human serum and plasma
SUPPORTING INFORMATION TITLE: Inter-laboratory reproducibility of a targeted metabolomics platform for analysis of human serum and plasma Alexandros P. Siskos, 1 Pooja Jain, 1 Werner Römisch-Margl, 2 Mark
Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
Concept 5.4: Proteins have many structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Protein functions include structural support, storage,
AA s are the building blocks of proteins
Chamras Chemistry 106 Lecture otes Chapter 24: Amino Acids, Peptides, and Proteins General Formula: () n (') α-amino Acids: (n = 1) Example: Amino Acids and Proteins: Glycine Alanine Valine AA s are the
PROTEINS. Amino acids are the building blocks of proteins. Acid L-form * * Lecture 6 Macromolecules #2 O = N -C -C-O.
Proteins: Linear polymers of amino acids workhorses of the cell tools, machines & scaffolds Lecture 6 Macromolecules #2 PRTEINS 1 Enzymes catalysts that mediate reactions, increase reaction rate Structural
Classification of amino acids: -
Page 1 of 8 P roteinogenic amino acids, also known as standard, normal or primary amino acids are 20 amino acids that are incorporated in proteins and that are coded in the standard genetic code (subunit
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
GL Science Inertsearch for LC Inertsil Applications - Acids. Data No. Column Data Title Solutes Eluent Detection Data No.
GL Science Inertsearch for LC Inertsil Applications: Acids For complete Product Description, Chromatograms Price & Delivery in Australia & New Zealand contact info@winlab.com.au or call 61 (0)7 3205 1209
Determination of Unbound Urinary Amino Acids Incorporated with Creatinine Normalization by LC-MS/MS Method with CLAM-2000 Online Sample Pre-treatment
PO-CON133E Determination of Unbound Urinary Amino Acids Incorporated with Creatinine Normalization by LC-MS/MS Method with CLAM-2000 Online Sample Pre-treatment ASMS 201 WP 34 Zhe Sun 1, Jie Xing 1, Ei
paper and beads don t fall off. Then, place the beads in the following order on the pipe cleaner:
Beady Pipe Cleaner Proteins Background: Proteins are the molecules that carry out most of the cell s dayto-day functions. While the DNA in the nucleus is "the boss" and controls the activities of the cell,
An Introduction to the Use of itraq Reagents for Amino Acid Analysis
An Introduction to the Use of itraq Reagents for Amino Acid Analysis Lisa Sapp Clinical Research and Forensic Toxicology Product Manager Mass Spectrometry Systems Amino Acid Analysis Using itraq Reagents
AP Bio. Protiens Chapter 5 1
Concept.4: Proteins have many structures, resulting in a wide range of functions Proteins account for more than 0% of the dry mass of most cells Protein functions include structural support, storage, transport,
Practice Problems 3. a. What is the name of the bond formed between two amino acids? Are these bonds free to rotate?
Life Sciences 1a Practice Problems 3 1. Draw the oligopeptide for Ala-Phe-Gly-Thr-Asp. You do not need to indicate the stereochemistry of the sidechains. Denote with arrows the bonds formed between the
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
v. reitschlagerova Renal Amino Acid Excretion and Aging H. NADVORNlKOVA, O. SCHUCK, V. TEPLAN, D. TOMKOVA,
Physiol. Res. 40:87-94, 1991 Renal Amino Acid Excretion and Aging H. NADVORNlKOVA, O. SCHUCK, V. TEPLAN, D. TOMKOVA, v. reitschlagerova Institute for Clinical and Experimental Medicine, Prague Received
RayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry
Dr. Sanjeeva Srivastava 1. Fundamental of Mass Spectrometry Role of MS and basic concepts 2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry 2 1 MS basic concepts Mass spectrometry - technique
Amino Acids : Towards Precise Nutrition in Monogastric Animals
[AFMA FORUM 2016 SESSION 4] Amino Acids : Towards Precise Nutrition in Monogastric Animals AFMA 2016 CORRENT AMINO ACIDS 2016 All rights reserved AJINOMOTO EUROLYSINE S.A.S. 1 Dietary crude protein reduction
SIMPLE BASIC METABOLISM
SIMPLE BASIC METABOLISM When we eat food such as a tuna fish sandwich, the polysaccharides, lipids, and proteins are digested to smaller molecules that are absorbed into the cells of our body. As these
Wheat Amino acids & Peptides for Hair Care. INCI Name EU/USA CAS # EINECS # Hydrolyzed wheat protein
KELYAMIN Wheat Amino acids & Peptides for Hair Care Identification INCI Name EU/USA CAS # EINECS # Hydrolyzed wheat protein 70084-87-6 305-225-0 Composition % Liquid Powder Aqua Hydrolyzed wheat protein
Short polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer
HO 1 2 3 H HO H Short polymer Dehydration removes a water molecule, forming a new bond Unlinked monomer H 2 O HO 1 2 3 4 H Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
Saccharomyces cerevisiae*
THE JOURNAL OF BIOLOGICAL CHEMISTRY 1988 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 263, No. 29, Issue of October 15, pp. 14948-14955, 1988 Printed in U.S.A. Purification
If you like us, please share us on social media. The latest UCD Hyperlibrary newsletter is now complete, check it out.
Sign In Forgot Password Register username username password password Sign In If you like us, please share us on social media. The latest UCD Hyperlibrary newsletter is now complete, check it out. ChemWiki
Can we learn something new about peptide separations after 40 years of RP and HILIC chromatography? Martin Gilar April 12, MASSEP 2016
Can we learn something new about peptide separations after 40 years of RP and HILIC chromatography? Martin Gilar April 12, MASSEP 2016 2015 Waters Corporation 1 Overview 1. 2D RP RP LC of peptides 2. RP-LC
1-To know what is protein 2-To identify Types of protein 3- To Know amino acids 4- To be differentiate between essential and nonessential amino acids
Amino acids 1-To know what is protein 2-To identify Types of protein 3- To Know amino acids 4- To be differentiate between essential and nonessential amino acids 5-To understand amino acids synthesis Amino
reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
supplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
Cells N5 Homework book
1 Cells N5 Homework book 2 Homework 1 3 4 5 Homework2 Cell Ultrastructure and Membrane 1. Name and give the function of the numbered organelles in the cell below: A E B D C 2. Name 3 structures you might
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
SUPPLEMENTARY INFORMATION
Figure S1. Cleavage of uniquitin AAA -CPP TAT in vitro and in cells. a, b. In vitro two-dimensional 1 H- 15 N correlation spectrum of ubiquitin AAA -CPP TAT before (a) and after (b) Yeast Ubiquitin Hydrolase
What is most limiting?
The Amino Acid Content of Rumen Microbes, Feed, Milk and Tissue after Multiple Hydrolysis Times and Implications for the CNCPS M. E. Van Amburgh, A. F. Ortega, S. W. Fessenden, D. A. Ross, and P. A. LaPierre
Introduction to Protein Structure Collection
Introduction to Protein Structure Collection Teaching Points This collection is designed to introduce students to the concepts of protein structure and biochemistry. Different activities guide students
Leucine Deprivation Reveals a Targetable Liability
Cancer Cell, 19 Supplemental Information Defective Regulation of Autophagy upon Leucine Deprivation Reveals a Targetable Liability of Human Melanoma Cells In Vitro and In Vivo Joon-Ho Sheen, Roberto Zoncu,
Introduction to Peptide Sequencing
Introduction to Peptide equencing Quadrupole Ion Traps tructural Biophysics Course December 3, 2014 12/8/14 Introduction to Peptide equencing - athan Yates 1 Why are ion traps used to sequence peptides?
Figures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
Proteins are a major component of dissolved organic nitrogen (DON) leached from terrestrially aged Eucalyptus camaldulensis leaves
Environ. Chem. 216, 13, 877 887 doi:1.171/en165_ac CSIRO 216 Supplementary material Proteins are a major component of dissolved organic nitrogen (DON) leached from terrestrially aged Eucalyptus camaldulensis
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Reading from the NCBI
Reading from the NCBI http://www.ncbi.nlm.nih.gov/books/bv.fcgi?highlight=thermodyn amics&rid=stryer.section.156#167 http://www.ncbi.nlm.nih.gov/books/bv.fcgi?highlight=stability,pr otein&rid=stryer.section.365#371
Study of Amino Acids in DDGS
Study of Amino Acids in DDGS Y. Zhang, J. V. Simpson and B. A. Wrenn National Corn-to-Ethanol Research Center Edwardsville, IL 62025 Hans Stein University of Illinois Urbana Champaign Gerald C. Shurson
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Biology. Lectures winter term st year of Pharmacy study
Biology Lectures winter term 2008 1 st year of Pharmacy study 3 rd Lecture Chemical composition of living matter chemical basis of life. Atoms, molecules, organic compounds carbohydrates, lipids, proteins,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Proximate composition, amino acid and fatty acid composition of fish maws. Department of Biology, Lingnan Normal University, Zhanjiang, , China
SUPPLEMENTARY MATERIAL Proximate composition, amino acid and fatty acid composition of fish maws Jing Wen a, Ling Zeng b *, Youhou Xu c, Yulin Sun a, Ziming Chen b and Sigang Fan d a Department of Biology,
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.
Chapter 4: Information and Knowledge in the Protein Insulin
Chapter 4: Information and Knowledge in the Protein Insulin This chapter will calculate the information and molecular knowledge in a real protein. The techniques discussed in this chapter to calculate
1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled
Protein Targeting Objectives 1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled As a protein is being synthesized, decisions
Proteasome Activity Assay Kit
Proteasome Activity Assay Kit Catalog Number KA1431 100 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
The composition of macromolecular cellular composition of mouse cell lines can be found
Supplementary 2: Cell biomass composition The composition of macromolecular cellular composition of mouse cell lines can be found elsewhere. 1-5 Following table shows the percentage composition of important
Amino Acids. Review I: Protein Structure. Amino Acids: Structures. Amino Acids (contd.) Rajan Munshi
Review I: Protein Structure Rajan Munshi BBSI @ Pitt 2005 Department of Computational Biology University of Pittsburgh School of Medicine May 24, 2005 Amino Acids Building blocks of proteins 20 amino acids
Free Amino Acid Changes in Serum throughout Rat Gestation and Lactation. Evolution of the Plasma/Serum Relationships
J. Clin. Biochem. Nutr., 3, 73-77, 1987 Free Amino Acid Changes in Serum throughout Rat Gestation and Lactation. Evolution of the Plasma/Serum Relationships M. PASTOR-ANGLADA, D. LOPEZ-TEJERO, and X. REMESAR*
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
LC-MS Analysis of Amino Acids on a Novel Mixed-Mode HPLC Column
Liquid Chromatography Mass Spectrometry SSI-LCMS-022 LC-MS Analysis of Amino Acids on a ovel Mixed-Mode PLC Column LCMS-8040 Background There are four established methods for analyzing amino acids: prelabeled,
The Structure and Function of Macromolecules
The Structure and Function of Macromolecules Macromolecules are polymers Polymer long molecule consisting of many similar building blocks. Monomer the small building block molecules. Carbohydrates, proteins
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Four melanocyte-stimulating hormones have the following amino acid sequences:
Assignment 14: Melanocyte-stimulating hormone belongs to a group called the melanocortins. This group includes ACTH, alpha-msh, beta-msh and gamma-msh; these peptides are all cleavage products of a large
Midterm 2 Results. Standard Deviation:
Midterm 2 Results High: Low: Mean: Standard Deviation: 97.5% 16% 58% 16.3 Lecture 17 Amino Acid Metabolism Urea Cycle N and S assimilation Last cofactors: THF and SAM Dietary (Exogenous) Proteins Hydrolyzed
Four Classes of Biological Macromolecules. Biological Macromolecules. Lipids
Biological Macromolecules Much larger than other par4cles found in cells Made up of smaller subunits Found in all cells Great diversity of func4ons Four Classes of Biological Macromolecules Lipids Polysaccharides
Identification of free amino acids in several crude extracts of two legumes
1 2 Identification of free amino acids in several crude extracts of two legumes using Thin Layer Chromatography 3 Authors 4 5 6 7 8 9 Taghread Hudaib Key words 10 11 12 13 14 15 16 17 18 19 20 Amino acids;
Protein Investigator. Protein Investigator - 3
Protein Investigator Objectives To learn more about the interactions that govern protein structure. To test hypotheses regarding protein structure and function. To design proteins with specific shapes.
7.012 F 04 Problem Set 1 September 10 th 2004
MIT Biology Department 7.012: Introductory Biology Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. laudette Gardel ame Question 1 TA Section 7.012 F 04 Problem Set 1 September
Lecture 4. Grouping Amino Acid 7/1/10. Proteins. Amino Acids. Where Are Proteins Located. Nonpolar Amino Acids
Proteins Lecture 4 Proteins - Composition of Proteins (Amino Acids) Chapter 21 ection 1-6! Proteins are compounds of high molar mass consisting almost entirely of amino acid chain(s)! Molar masses range
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
endopeptidases aminopeptidases carboxypeptidases hydrolyzes a peptide bond somewhere in the middle of the polypeptide
1 Amino Acid Metabolism: The primary purpose for s in the body is to provide the building blocks for proteins R other s. owever, if there is no protein synthesis occurring, the s can be broken down (i.e.