Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Size: px
Start display at page:

Download "Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production"

Transcription

1 Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim and Jin Yeul Ma* - Supplementary Table S1 - Supplementary Table S2 - Supplementary Table S3 - Supplementary Table S4 - Supplementary Figure S1 - Supplementary Figure S2 - Supplementary Figure S3 - Supplementary Figure S4 - Supplementary Figure S5 - Supplementary Figure S6 - Supplementary Figure S7 - Supplementary Figure S8 - Supplementary Figure S9 - Supplementary Figure S10 -

2 Table S1. Body weights of mice administrated with WEF or saline Treatment Body weight (g) Day 0 Day 7 Day 14 Control ± ± ± mg/kg ± ± ± 0.19 Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily and weighed body weight at 0, 7, and 14 days.

3 Table S2. Organ weights of mice administrated with WEF or saline Treatment Weight of organs (g) Liver Heart Lung spleen Kidney (L) Kidney (R) Control mg/kg Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily, sacrificed at 15 days, and weighed organs.

4 Table S3. Chemical analysis of serums obtained from mice administrated with WEF or saline. Treatment GOT (IU/L) GPT (IU/L) BUN (mg/dl) CRE (mg/dl) Control mg/kg Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily, sacrificed at 15 days, and analyzed the levels of GOT, GPT, BUN, and CRE. GOT, glutamic oxaloacetic transaminase; GPT, glutamic pyruvic transaminase; BUN, blood urea nitrogen; CRE, creatinine.

5 Table S4. Hematological analysis of bloods obtained from mice administrated with WEF or saline. Parameter control 50 mg/kg WBCP ( 10 3 cells/ l) WBCB ( 10 3 cells/ l) RBC ( 10 6 cells/ l) Means HGB (g/dl) HCT (%) MCV (fl) MCH (pg) MCHC (g/dl) PLT ( 10 4 cells/ l) % NEUT % LYM % MONO Data are presented as mean S.D. Each group of mice (n=3) were orally administrated with 50 mg/kg of WEF or saline daily, sacrificed at 15 days, and analyzed hematologic parameters. CBC, complete blood cell count; WBCP, white blood cell count peroxidase method; WBCB, white blood cell count basophile method; RBC, red blood cell count; HGB, hemoglobin, HCT, hematocrit; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; PLT, platelet; NEUT, neutrophil; LYM, lymphocyte; MONO, monocyte.

6 Figure S1. WEF inhibits the migration and invasion of HT1080 cells. (A): After making wounds on the confluent cell monolayers, cells were incubated in the presence of 25, 50, and 100 g/ml WEF for 36 h. Cell migration was calculated based on the relative width of wound at 0 h and expressed as the mean SD of four selected fields. (B): Cells were pre-treated with 25, 50, and 100 g/ml WEF for 12 h. After harvest, cells ( /100 l) suspended in serum-free RPMI was added into upper chamber of Transwell and lower chamber was filled with 600 l 10% FBS/RPMI. For invasion assay, Matrigel-coated Transwell was used. Cells migrated and invaded to the lower surface of the Transwell membrane were measured at 12 h and 24 h incubation, respectively. Data are representative of two independent experiments and expressed as the mean SD of five random fields of each well. #, p 0.01 vs. untreated control.

7 Figure S2. WEF reduces transcriptional expression of MMPs under PMA stimulation. HT1080 cells pretreated with 25, 50, and 100 g/ml WEF for 12 h in serum-free media were stimulated with 5 nm PMA for additional 24 h. MMPs mrna levels were measured by RT-PCR.

8 Figure S3. WEF suppresses MMP-9 gelatinolytic activity under PMA stimulation. This is a full length image of the cropped blot presented in the Figure 4B.

9 Figure S4. WEF suppresses PMA-induced p38 and JNK phosphorylation as well as NF-κB activation. These are full length images of the cropped blot presented in the Figure 5A and 5B.

10 Figure S5. WEF reduces TNF-α-induced MMP-9 expression and activity via suppression of NFκB activation in B16F10 cells. (A): B16F10 cells pretreated with 25, 50, and 100 g/ml WEF for 12 h in serum-free media were stimulated with TNF-α (10 ng/ml) for additional 24 h. MMP-9 mrna level and MMP-9 activity were measured by RT-PCR and gelatin zymography, respectively. (B): B16F10 cells were pretreated with WEF (100 g/ml) for 12 h and then stimulated with TNF-α (10 ng/ml) for 30, 60, and 180 min. Total cell lysates were subjected to Western blotting and relative ratios were calculated after normalization to tubulin. Data are representative of two independent experiments.

11 Figure S6. Inhibitory effect of WEF on vessel sprout formation is reversible. Aortic rings were first incubated with WEF-treated CMs of HT1080 or PC-3 and continued to culture in EGM-2 for another 72 h after CMs were removed.

12 Figure S7. WEF inhibits HIF-1α expression. HT1080 cells were pretreated with WEF (25, 50, and 100 g/ml) for 12 h, and then stimulated with 100 M CoCl 2 for 6 h. Total cell lysates were subjected to Western blotting to measure the levels of HIF-1α, phosphorylated Akt and mtor. After normalization to tubulin, the relative ratios were calculated. Data are expressed as the mean SD of two independent experiments. *, p 0.01 vs. untreated control.

13 Figure S8. WEF inhibits VEGF-α and HIF-1α expression. (A): B16F10 cells were pretreated with WEF (25, 50, and 100 g/ml) for 24 h and VEGF-α mrna levels were measured by RT- PCR. Relative ratio was quantified after normalization to GAPDH. (B): B16F10 cells were pretreated with WEF (25, 50, and 100 g/ml) for 12 h, and then stimulated with 100 M CoCl 2 for 3 h. Total cell lysates were subjected to Western blotting to measure the levels of HIF-1α, phosphorylated Akt and mtor. After normalization to tubulin, the relative ratios were calculated. Data are representative of two independent experiments.

14 Figure S9. No inhibitory effects of WEF on HUVEC migration and tube formation. (A): Matrigels mixed with bfgf (1 g/ml) and VEGF-α (100 ng/ml) in the presence of WEF were implanted and angiogenesis was examined after 14 days. (B): HUVEC capillary-like tube formation induced by bfgf (1 g/ml) and VEGF-α (100 ng/ml) in the presence of WEF was examined. (C): EGM-2 was added to the lower chamber, and HUVECs in EBM-2 were allowed to migrate in the presence of WEF (0, 25, 50, and g/ml) for 24 h.

15 Figure S10. WEF inhibits HIF-1α expression and phosphorylation of Akt/mTOR. These are full length images of the cropped blot presented in the Figure 7C.

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

The novel herbal cocktail MA128 suppresses tumor growth and the metastatic potential of highly malignant tumor cells

The novel herbal cocktail MA128 suppresses tumor growth and the metastatic potential of highly malignant tumor cells 900 The novel herbal cocktail MA128 suppresses tumor growth and the metastatic potential of highly malignant tumor cells Aeyung Kim, Minju Im, Nam-Hiu Yim, Youn-Hwan Hwang, Hye Jin Yang and Jin Yeul Ma

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

A Toxicological Study of HangAmDan-B in Mice

A Toxicological Study of HangAmDan-B in Mice J Acupunct Meridian Stud 2011;4(1):54 60 RESEARCH ARTICLE A Toxicological Study of HangAmDan-B in Mice Hwa-Seung Yoo*, Hyo-Jae Lee, Jung-Sun Kim, Jeungwon Yoon, Grace H. Lee, Yeon-Weol Lee, Chong-Kwan

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice

JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in

More information

Step 2. Common Blood Tests, and the Coulter Counter Readout

Step 2. Common Blood Tests, and the Coulter Counter Readout Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

i. Where is the participant seen?

i. Where is the participant seen? PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb.

Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb. Mahidol University Journal of Pharmaceutical Sciences 2005; 32(1-2): 7-14. Original Article Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb. S. Thanabhorn,

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)

a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female) Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Changes of hematological references depends on storage period and temperature conditions in rats and dogs ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC) AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney

Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

Date Time By Code Description Qty (Variance) Photo

Date Time By Code Description Qty (Variance) Photo Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.

More information

(control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential

(control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential SUPPLEMENTAL DATA Supplemental Figures Supplemental Figure 1 Supplemental Figure 1 Apoptotic events of stored platelets. (A and B) PRP was incubated at 37 under agitation for 0 (control) or 16 h. The pretreated

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test. 5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

International Journal of Pharma and Bio Sciences V1(2)2010

International Journal of Pharma and Bio Sciences V1(2)2010 AJAY KSHIRSAGAR* 1, PURNIMA ASHOK 1, KAUSHIK NARGOLKAR 2, AMOL BHANDARE 2, ANURAG DODAL 2 AND TANMAY DODAL 2 1 Department of, K.L.E.S s College of Pharmacy, Bangalore-560010, Karnataka, India. 2 AISSMS

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels in rats

Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels in rats Songklanakarin J. Sci. Technol. 30 (5), 611-619, Sep. - Oct. 2008 http://www.sjst.psu.ac.th Original Article Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels

More information

Clinical use of flow cytometry

Clinical use of flow cytometry Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control

Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

2013/11/29 Version 2

2013/11/29 Version 2 1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219

More information

A Study on the Relationship between CBC and EEG for Epilepsy Patients

A Study on the Relationship between CBC and EEG for Epilepsy Patients ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice (% of body weight, mean ± SD).

Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice (% of body weight, mean ± SD). Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice ( of body weight, mean ± SD). a. Steady-state, high dose T (0 mg/kg, weekly for 7 mo, n = 10-13 per group) Sample F M T Kidney

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

Paper ID: ART

Paper ID: ART analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in

More information

Lifeblood Lab Activity

Lifeblood Lab Activity History of Blood: It is the universal symbol of horror, of death, yet it is the one thing that keeps you living. It is the blood that is coursing through your veins. But, what do you really know about

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Brief Communication Diagnostic Hematology

Brief Communication Diagnostic Hematology Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges

More information

Interpreting Blood Tests Part 1. Dr Andrew Smith

Interpreting Blood Tests Part 1. Dr Andrew Smith Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0

More information

TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN

TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN Clinical Utility CA19-9 (CA-GI) 8 hours 48 hours UNDETERMINED CA 19-9 may be ordered along with other tests,

More information

(PDGF), 9 ( -2 (FGF-2), SMO

(PDGF), 9 ( -2 (FGF-2), SMO Abstract An ethanol extract from shark muscle has been shown to have potent angiogenic activity when mixed together with olive oil in a ratio of 1part extract to 9 parts olive oil. This mixture has been

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

CASE-BASED SMALL GROUP DISCUSSION

CASE-BASED SMALL GROUP DISCUSSION MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious

More information

Acute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats

Acute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats Songklanakarin J. Sci. Technol. 30 (6), 729-737, Nov. - Dec. 2008 Original Article Acute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats Seewaboon Sireeratawong

More information

Kathryn Jones 8/11/2015

Kathryn Jones 8/11/2015 1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry

More information

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna

More information

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and

More information

Supplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in

Supplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in Supplementary Data 600 500 400 300 150 Saline Vehicle Control P7 Low Dose P7 High Dose P13 High Dose 100 50 0 HGB(g/L) HCT(%) MCV(fL) MCHC(g/L) PLT( 10 9 /L) Neut(%) Lymph(%) Parameters SUPPLEMENTARY FIG.

More information

Complete Blood Count (CBC)

Complete Blood Count (CBC) Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction

More information

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction

More information

CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS

CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS Lucrări Ştiinţifice - Seria Zootehnie, vol. 61 CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS Il. Mihalache 1*, M. Munteanu 2, Roxana Lazăr 2, P.C. Boişteanu 2 1 Transilvania University of

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

CELL-DYN 3700 Strength in Technology, Proven Reliability

CELL-DYN 3700 Strength in Technology, Proven Reliability CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

Nano Immuno Chemotherapy to treat cancers

Nano Immuno Chemotherapy to treat cancers Nano Immuno Chemotherapy to treat cancers Dr. Giovanna Lollo, MiNT, France Dr. Ilaria Marigo, IOV, Italy University of Angers MiNt: Micro et Nanomedicines Biomimetiques France Instituto Oncologico Veneto

More information

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9 etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

Advanced Hematology Five-Part Differential. Simple Operation

Advanced Hematology Five-Part Differential. Simple Operation HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Clinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock

Clinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock Learning Objectives At the completion of this program, the participants will be able to: 1. Identify the components of the CBC and Differential and their clinical implications. 2. Identify normal pediatric

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

HM5. Hematology Analyzer BETTER. ACTUALLY.

HM5. Hematology Analyzer BETTER. ACTUALLY. HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects. Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same

More information

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your

More information