Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
|
|
- Lauren Harrell
- 5 years ago
- Views:
Transcription
1 Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim and Jin Yeul Ma* - Supplementary Table S1 - Supplementary Table S2 - Supplementary Table S3 - Supplementary Table S4 - Supplementary Figure S1 - Supplementary Figure S2 - Supplementary Figure S3 - Supplementary Figure S4 - Supplementary Figure S5 - Supplementary Figure S6 - Supplementary Figure S7 - Supplementary Figure S8 - Supplementary Figure S9 - Supplementary Figure S10 -
2 Table S1. Body weights of mice administrated with WEF or saline Treatment Body weight (g) Day 0 Day 7 Day 14 Control ± ± ± mg/kg ± ± ± 0.19 Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily and weighed body weight at 0, 7, and 14 days.
3 Table S2. Organ weights of mice administrated with WEF or saline Treatment Weight of organs (g) Liver Heart Lung spleen Kidney (L) Kidney (R) Control mg/kg Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily, sacrificed at 15 days, and weighed organs.
4 Table S3. Chemical analysis of serums obtained from mice administrated with WEF or saline. Treatment GOT (IU/L) GPT (IU/L) BUN (mg/dl) CRE (mg/dl) Control mg/kg Data are presented as mean S.D. Each group of female C57BL/6J mice (n=3) were orally administrated with 50 mg/kg of WEF or same volume of saline daily, sacrificed at 15 days, and analyzed the levels of GOT, GPT, BUN, and CRE. GOT, glutamic oxaloacetic transaminase; GPT, glutamic pyruvic transaminase; BUN, blood urea nitrogen; CRE, creatinine.
5 Table S4. Hematological analysis of bloods obtained from mice administrated with WEF or saline. Parameter control 50 mg/kg WBCP ( 10 3 cells/ l) WBCB ( 10 3 cells/ l) RBC ( 10 6 cells/ l) Means HGB (g/dl) HCT (%) MCV (fl) MCH (pg) MCHC (g/dl) PLT ( 10 4 cells/ l) % NEUT % LYM % MONO Data are presented as mean S.D. Each group of mice (n=3) were orally administrated with 50 mg/kg of WEF or saline daily, sacrificed at 15 days, and analyzed hematologic parameters. CBC, complete blood cell count; WBCP, white blood cell count peroxidase method; WBCB, white blood cell count basophile method; RBC, red blood cell count; HGB, hemoglobin, HCT, hematocrit; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; PLT, platelet; NEUT, neutrophil; LYM, lymphocyte; MONO, monocyte.
6 Figure S1. WEF inhibits the migration and invasion of HT1080 cells. (A): After making wounds on the confluent cell monolayers, cells were incubated in the presence of 25, 50, and 100 g/ml WEF for 36 h. Cell migration was calculated based on the relative width of wound at 0 h and expressed as the mean SD of four selected fields. (B): Cells were pre-treated with 25, 50, and 100 g/ml WEF for 12 h. After harvest, cells ( /100 l) suspended in serum-free RPMI was added into upper chamber of Transwell and lower chamber was filled with 600 l 10% FBS/RPMI. For invasion assay, Matrigel-coated Transwell was used. Cells migrated and invaded to the lower surface of the Transwell membrane were measured at 12 h and 24 h incubation, respectively. Data are representative of two independent experiments and expressed as the mean SD of five random fields of each well. #, p 0.01 vs. untreated control.
7 Figure S2. WEF reduces transcriptional expression of MMPs under PMA stimulation. HT1080 cells pretreated with 25, 50, and 100 g/ml WEF for 12 h in serum-free media were stimulated with 5 nm PMA for additional 24 h. MMPs mrna levels were measured by RT-PCR.
8 Figure S3. WEF suppresses MMP-9 gelatinolytic activity under PMA stimulation. This is a full length image of the cropped blot presented in the Figure 4B.
9 Figure S4. WEF suppresses PMA-induced p38 and JNK phosphorylation as well as NF-κB activation. These are full length images of the cropped blot presented in the Figure 5A and 5B.
10 Figure S5. WEF reduces TNF-α-induced MMP-9 expression and activity via suppression of NFκB activation in B16F10 cells. (A): B16F10 cells pretreated with 25, 50, and 100 g/ml WEF for 12 h in serum-free media were stimulated with TNF-α (10 ng/ml) for additional 24 h. MMP-9 mrna level and MMP-9 activity were measured by RT-PCR and gelatin zymography, respectively. (B): B16F10 cells were pretreated with WEF (100 g/ml) for 12 h and then stimulated with TNF-α (10 ng/ml) for 30, 60, and 180 min. Total cell lysates were subjected to Western blotting and relative ratios were calculated after normalization to tubulin. Data are representative of two independent experiments.
11 Figure S6. Inhibitory effect of WEF on vessel sprout formation is reversible. Aortic rings were first incubated with WEF-treated CMs of HT1080 or PC-3 and continued to culture in EGM-2 for another 72 h after CMs were removed.
12 Figure S7. WEF inhibits HIF-1α expression. HT1080 cells were pretreated with WEF (25, 50, and 100 g/ml) for 12 h, and then stimulated with 100 M CoCl 2 for 6 h. Total cell lysates were subjected to Western blotting to measure the levels of HIF-1α, phosphorylated Akt and mtor. After normalization to tubulin, the relative ratios were calculated. Data are expressed as the mean SD of two independent experiments. *, p 0.01 vs. untreated control.
13 Figure S8. WEF inhibits VEGF-α and HIF-1α expression. (A): B16F10 cells were pretreated with WEF (25, 50, and 100 g/ml) for 24 h and VEGF-α mrna levels were measured by RT- PCR. Relative ratio was quantified after normalization to GAPDH. (B): B16F10 cells were pretreated with WEF (25, 50, and 100 g/ml) for 12 h, and then stimulated with 100 M CoCl 2 for 3 h. Total cell lysates were subjected to Western blotting to measure the levels of HIF-1α, phosphorylated Akt and mtor. After normalization to tubulin, the relative ratios were calculated. Data are representative of two independent experiments.
14 Figure S9. No inhibitory effects of WEF on HUVEC migration and tube formation. (A): Matrigels mixed with bfgf (1 g/ml) and VEGF-α (100 ng/ml) in the presence of WEF were implanted and angiogenesis was examined after 14 days. (B): HUVEC capillary-like tube formation induced by bfgf (1 g/ml) and VEGF-α (100 ng/ml) in the presence of WEF was examined. (C): EGM-2 was added to the lower chamber, and HUVECs in EBM-2 were allowed to migrate in the presence of WEF (0, 25, 50, and g/ml) for 24 h.
15 Figure S10. WEF inhibits HIF-1α expression and phosphorylation of Akt/mTOR. These are full length images of the cropped blot presented in the Figure 7C.
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationThe novel herbal cocktail MA128 suppresses tumor growth and the metastatic potential of highly malignant tumor cells
900 The novel herbal cocktail MA128 suppresses tumor growth and the metastatic potential of highly malignant tumor cells Aeyung Kim, Minju Im, Nam-Hiu Yim, Youn-Hwan Hwang, Hye Jin Yang and Jin Yeul Ma
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationA Toxicological Study of HangAmDan-B in Mice
J Acupunct Meridian Stud 2011;4(1):54 60 RESEARCH ARTICLE A Toxicological Study of HangAmDan-B in Mice Hwa-Seung Yoo*, Hyo-Jae Lee, Jung-Sun Kim, Jeungwon Yoon, Grace H. Lee, Yeon-Weol Lee, Chong-Kwan
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSupplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationJKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice
JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationMorphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationAcute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb.
Mahidol University Journal of Pharmaceutical Sciences 2005; 32(1-2): 7-14. Original Article Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb. S. Thanabhorn,
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationEndothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationa) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)
Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationChanges of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationAVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationFigure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney
SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More information(control) or 16 h. The pretreated platelets were analyzed for mitochondrial membrane potential
SUPPLEMENTAL DATA Supplemental Figures Supplemental Figure 1 Supplemental Figure 1 Apoptotic events of stored platelets. (A and B) PRP was incubated at 37 under agitation for 0 (control) or 16 h. The pretreated
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationInternational Journal of Pharma and Bio Sciences V1(2)2010
AJAY KSHIRSAGAR* 1, PURNIMA ASHOK 1, KAUSHIK NARGOLKAR 2, AMOL BHANDARE 2, ANURAG DODAL 2 AND TANMAY DODAL 2 1 Department of, K.L.E.S s College of Pharmacy, Bangalore-560010, Karnataka, India. 2 AISSMS
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationAcute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels in rats
Songklanakarin J. Sci. Technol. 30 (5), 611-619, Sep. - Oct. 2008 http://www.sjst.psu.ac.th Original Article Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels
More informationClinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More information5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationBone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control
Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More information2013/11/29 Version 2
1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219
More informationA Study on the Relationship between CBC and EEG for Epilepsy Patients
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationTherapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
More informationSupplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice (% of body weight, mean ± SD).
Supplemental Table 1. Effect of Testosterone Treatment on Organ Weight in Mice ( of body weight, mean ± SD). a. Steady-state, high dose T (0 mg/kg, weekly for 7 mo, n = 10-13 per group) Sample F M T Kidney
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationPaper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
More informationLifeblood Lab Activity
History of Blood: It is the universal symbol of horror, of death, yet it is the one thing that keeps you living. It is the blood that is coursing through your veins. But, what do you really know about
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationBrief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationChapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.
Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0
More informationTEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN
TEST NAME/ PSYCHE CODE COLLECTION GUIDELINES REFERENCE VALUES ROOM TEMP. REFRIGERATED FROZEN Clinical Utility CA19-9 (CA-GI) 8 hours 48 hours UNDETERMINED CA 19-9 may be ordered along with other tests,
More information(PDGF), 9 ( -2 (FGF-2), SMO
Abstract An ethanol extract from shark muscle has been shown to have potent angiogenic activity when mixed together with olive oil in a ratio of 1part extract to 9 parts olive oil. This mixture has been
More informationChanges in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious
More informationAcute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats
Songklanakarin J. Sci. Technol. 30 (6), 729-737, Nov. - Dec. 2008 Original Article Acute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats Seewaboon Sireeratawong
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationStem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD
Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna
More informationCell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator
Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and
More informationSupplementary Data. Effect of repeat administration of human mesenchymal stem cells on clinical biochemistry in
Supplementary Data 600 500 400 300 150 Saline Vehicle Control P7 Low Dose P7 High Dose P13 High Dose 100 50 0 HGB(g/L) HCT(%) MCV(fL) MCHC(g/L) PLT( 10 9 /L) Neut(%) Lymph(%) Parameters SUPPLEMENTARY FIG.
More informationComplete Blood Count (CBC)
Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction
More informationCD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction
More informationCHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS
Lucrări Ştiinţifice - Seria Zootehnie, vol. 61 CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS Il. Mihalache 1*, M. Munteanu 2, Roxana Lazăr 2, P.C. Boişteanu 2 1 Transilvania University of
More informationHematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationNano Immuno Chemotherapy to treat cancers
Nano Immuno Chemotherapy to treat cancers Dr. Giovanna Lollo, MiNT, France Dr. Ilaria Marigo, IOV, Italy University of Angers MiNt: Micro et Nanomedicines Biomimetiques France Instituto Oncologico Veneto
More informationq,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationClinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock
Learning Objectives At the completion of this program, the participants will be able to: 1. Identify the components of the CBC and Differential and their clinical implications. 2. Identify normal pediatric
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More information