SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
|
|
- Clifton Cannon
- 5 years ago
- Views:
Transcription
1 SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic implantation model. (A) Workflow for tumor cell line derivation and orthotopic implantation. (B) Flow cytometry analysis of the established TS1 line for EpCAM and endogenous GFP expression prior to and following labeling with the TGL-imaging vector (Ponomarev et al, 2004) and sorting. (C) Representative brightfield image of the TS1-TGL cell line in culture. (D) Hematoxylin and eosin staining of representative orthotopic and spontaneous PyMT tumors, showing the morphological similarities. (E) Ex vivo bioluminescence imaging of lung and liver from a mouse implanted orthotopically with the imaging vector-labeled TS1-TGL cell line, indicating the presence of metastases to those organs. Supplemental Figure 2. Analysis of cathepsin protein, expression and activity levels in mammary tumors and BMDMs following Taxol treatment. (A) Orthotopically implanted tumors were harvested from mice 7 days after vehicle or Taxol treatment and whole tumor lysates were assayed for cathepsin proteins. Quantitation of bands for the active forms of cathepsins S, X/Z, and H are shown in the upper graphs, and none of these cathepsins showed a 1
2 significant difference in the lysates from Taxol- versus vehicle-treated tumors. Quantitation of the loading control, actin, on each of the three blots used for the relative quantitations of all cathepsins in Figure 1B and Figure S2 are shown in the lower graphs. Quantitation of all western blots was done using area under the curve (A.U.C.) analysis using exposures within the dynamic range of detection. n=6-7 mice per group. (B) Cathepsin mrna levels also increase after Taxol treatment. Quantitative RT- PCR analysis for all cathepsin genes detectable in whole tumor lysates, relative to an endogenous control gene, Ubiquitin C. n=7-8 mice per group. * p<0.05, ** p<0.01 by the Mann-Whitney test. (C) Cathepsin activity levels in macrophages do not change following Taxol treatment. Macrophage (mφ) cell lysates (left) or conditioned media (cm) (right) were labeled with the biotinylated cathepsin ABP, DCG04 (Greenbaum et al. 2000), showing there is no change in the levels of active cathepsins following treatment with Taxol versus vehicle. Supplemental Figure 3. Macrophage quantitation in PyMT tumors with the cell type specific marker Iba1. The macrophage-specific antibody, Iba1, which has generally been used to stain brain resident macrophages known as microglia, but has also been shown to label other tissue macrophage populations (Kohler 2007; Pyonteck et al. 2011), was used to label macrophages in PyMT tumors. The reason for using this rabbit antibody was to perform co-immunostaining with the pan-leukocyte marker 2
3 CD45, which is raised in rat, without concern for potential cross-reactivity in the subsequent detection with secondary antibodies, which could happen with other macrophage-specific antibodies such as CD68 or F4/80 that are also raised in rat. (A) Representative image of co-localization of two different macrophage markers: F4/80 and Iba1 in mammary tumors. (B) Quantitation via image analysis of F4/80 and Iba1 co-localization (n=11 tumors) showing that Iba1 labels the vast majority of F4/80 + cells, and is thus an appropriate macrophage marker for image analysis in PyMT tumors. Red line indicates the mean co-localization: 92.6%. (C) Macrophages accumulate in tumors after Taxol treatment. Representative composite images of tumors stained for the macrophage marker, Iba1, 7 days after vehicle or Taxol treatment. Higher magnification images from these composites are shown in Figure 2A. (D) Quantitation of intratumoral Iba1 + cells in tumors of vehicle- and Taxol-treated mice via image analysis shows there is no difference between the two groups at this timepoint. Individual data points represent tumors from each treatment group (n=13 vehicle; 12 Taxol). ns= not significant. Supplemental Figure 4. Co-staining of cathepsin B and S in macrophages in patient samples. Representative images of tumor samples post-treatment from Patients 6 and 8 stained with a CD68 antibody (blue), and antibodies against either cathepsin B or 3
4 S (red/brown color) to visualize tumor cells. Macrophages showing co-staining with cathepsin B or S are indicated by white arrows. Patient information can be found in Table S1. Images captured using a Zeiss Z1 Axioimager and 40x objective lens. Supplemental Figure 5. Co-culture and conditioned media assays for assessing effects of macrophages on Taxol-induced tumor cell death. (A) Representative flow cytometry plots showing separation of macrophages and tumor cells in co-culture assay (plot on left) and DAPI/ Annexin V staining to analyze tumor cell death (right). (B) Schematic of experimental design for conditioned media experiments. (C) BMDM conditioned media, treated with DMSO or JPM (10µM), was concentrated then labeled with the biotinylated cathepsin ABP, DCG04. There is a clear reduction in active cathepsin species following JPM treatment. (D) Tumor cell death in the BMDM conditioned media experiments was confirmed by western blot analysis of cleaved caspase 3 (CC3) at 24 hours after Taxol treatment. A representative western blot is shown on the left, with quantification of three independent experiments graphed on the right, * p<0.05, ns= not significant. Supplemental Figure 6. Analysis of cathepsin deficient macrophages. (A) Representative flow cytometry plots showing no major differences in differentiation of WT versus cathepsin-deficient BMDMs in response to colony stimulating factor-1 (Csf-1) in the macrophage derivation protocol. 4
5 (B) Representative images of bead phagocytosis assay of WT versus cathepsindeficient BMDMs, showing no differences in FluoSphere bead uptake in the absence of individual cathepsins or following incubation with the cathepsin inhibitor JPM. FluoSphere beads are labeled in red. All images were taken with an x20 objective lens on a Zeiss Axioimager M1 microscope. Supplemental Figure 7. JPM inhibits cathepsin activity in PyMT tumors. (A) Whole tumor lysates from vehicle or JPM-treated PyMT tumors (representative tumors, n=5 each) were labeled with the biotinylated cathepsin ABP, DCG04. (B) Quantification of active cathepsin bands relative to the loading control GAPDH shows there is a significant decrease in the levels of active cathepsins following JPM treatment administered twice daily at 100 mg/kg/day (p=0.0016). Supplemental Figure 8. Continuous low-dose cyclophosphamide does not affect tumor vascularity at end-stage, but does result in a significant increase in tumor cell apoptosis. (A) Graph of total vessel area, as determined by staining of endothelial cells with an antibody against CD34, relative to the total DAPI+ tumor area. There is no significant difference between tumors from vehicle and CLD Cyclo-treated animals at the end of the 9-14 week regression trial. Microvascular density (B) and vessel length (C) were similarly unaffected by CLD Cyclo treatment. n=10 mice per group for A-C. 5
6 (D) Graph of vessel functionality, assessed by colocalization of CD34 with FITCconjugated lectin, which was intravenously injected into tumor-bearing mice. Graph shows mean + SEM of individual tumors, n=4 mice per group, with no significant difference between groups. (E) Graph showing percentage of cleaved caspase 3 (CC3)-positive cells. There is a significant increase in apoptosis in tumors following CLD Cyclo treatment compared to vehicle (* p<0.05). (F) Representative images of CC3 staining in combination with either a tumor cell marker (EpCAM) or endothelial cell marker (CD34), showing that most CC3+ cells are in the tumor bulk, not blood vessels, of CLD Cyclo-treated mice. Arrow points to a rare CC3-positive endothelial cell. Supplemental Figure 9. Macrophages are protective against additional chemotherapies in other tumor cell lines. Percentage of DAPI + (dead) tumor cells in mono- or co-culture of the TS2 (A), Met-1(B), and AT-3 (C) cell lines treated with Etoposide (20 µm) and Doxorubicin (300 nm) with or without JPM-OEt. Co-culture with BMDMs significantly reduced cell death in response to both drugs in all lines tested, with different degrees of cathepsin dependence. For all graphs, data is from 3 independent experiments, each performed in triplicate; * p<0.05, ** p<0.01, ns =not significant. Supplemental Table 1. Information on patient samples used in this study. 6
7 Relevant information for pre- and post-chemotherapy matched samples from breast cancer patients used for CD68 immunostaining and analysis in Figures 2G and S4. Supplemental Table 2. Statistical results from 5-week combination drug trials. Supplemental Table 3. Statistical results from analysis of lung metastases at the end of 5-week trials. Supplemental Table 4. Statistical results from analysis of long-term survival data in MMTV-PyMT trials. 7
8
9
10
11
12
13
14
15
16
17 Shree et al, Supplemental Table 1 Supplemental Table 1. Information on patient samples used in this study. Patient No. Tumor grade ER Status PR Status HER2 Status Chemotherapy Clinical Response to Chemotherapy Pathological Response to Chemotherapy Survival Status CD68(+) cells after treatment 1 II/III Negative Negative Negative DC-T Partial Partial NED 2 III/III Negative Negative Negative DC-T Partial Partial NED no change 3 III/III Positive Negative Positive DC-T, Trastuzumab Minimal Minimal NED 4 I/III Positive Positive Negative DC-T Minimal Minimal NED 5 III/III Positive Negative Negative DC-T Partial Partial DOC 6 III/III Negative Negative Positive DC-T Partial Partial DOD 7 III/III Negative Negative Positive EC-T Partial Partial NED Table key: Chemotherapy given: DC= Doxorubicin and Cyclophosphamide; T= Paclitaxel; EC= Epirubicin and Cyclophosphamide NED= no evidence of disease; DOC= died of other cause; DOD= died of disease; = increase
18 Shree et al, Supplemental Table 2 Supplemental Table 2. Statistical results from 5-week combination drug trials. Comparison p-values Group 1 Group 2 Tumor volume curves (Area-under-curve analysis) Volume of excised tumors (Unpaired t-test) F-test for equal variance 1 Vehicle JPM Vehicle Taxol Vehicle Taxol+JPM < Vehicle Cyclo Vehicle Cyclo+JPM Vehicle Taxol+Cyclo < < Vehicle Triple < < < Taxol Taxol+JPM Taxol Taxol+Cyclo Taxol Triple < < < Taxol+JPM Triple < Taxol+Cyclo Triple < Analysis conducted on data from excised tumors.
19 Shree et al, Supplemental Table 3 Supplemental Table 3. Statistical results from analysis of lung metastases at the end of 5-week trials. Comparison p-values (Mann-Whitney test) Group 1 Group 2 Total Metastatic Burden Metastasis Incidence Average Metastasis Size Vehicle JPM Vehicle Taxol Vehicle Taxol+JPM Vehicle Taxol+Cyclo Vehicle Triple
20 Shree et al, Supplemental Table 4 Supplemental Table 4. Statistical results from analysis of long-term survival data. Comparison p-values (Log-rank test) Group 1 Group 2 Full Survival Early Survival 1 Late-stage Survival 2 Vehicle JPM Vehicle Taxol < Vehicle Taxol+JPM Vehicle Taxol+Cyclo < < < Vehicle Triple < < Taxol Taxol+JPM Taxol Taxol+Cyclo Taxol Triple < Taxol+JPM Triple Taxol+Cyclo Triple Data truncated at 70 days. 2 Data analyzed from day 70 forwards.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationSupplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationSupplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationMitosis. Single Nano Micro Milli Macro. Primary. PCNA expression
a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationSupplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationFigure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationNature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationFigure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
More informationSupplementary Information
Supplementary Information Lymphatic endothelial cells support tumor growth in breast cancer Esak Lee a, Niranjan B. Pandey a, and Aleksander S. Popel a,b a Department of Biomedical Engineering, Johns Hopkins
More informationCombined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer
Supplementary Information Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer Gi-Hoon Nam, Eun-Jung Lee, Yoon Kyoung Kim, Yeonsun Hong, Yoonjeong Choi,
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationSupplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationExpanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationLung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More information(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationSantulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More informationGFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationReal-time imaging reveals the single steps of brain metastasis fo mation r
Real-time imaging reveals the single steps of brain metastasis fo mation r Yvonne Kienast, Louisa von Baumgarten, Martin Fuhrmann, Wolfgang E.F. Klinkert, Roland Goldbrunner, Jochen Herms and Frank Winkler
More informationa 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationSupplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells
Cell Chemical Biology, Volume 24 Supplemental Information Inhibition of the Proteasome b2 Site Sensitizes Triple-Negative Breast Cancer Cells to b5 Inhibitors and Suppresses Nrf1 Activation Emily S. Weyburne,
More informationgenome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More information