Supplementary Fig. 1

Size: px
Start display at page:

Download "Supplementary Fig. 1"

Transcription

1 PDK1-dependent quenching of TACE shedding activity in prion and Alzheimer s diseases Mathéa Pietri, Caroline Dakowski, Samia Hannaoui, Aurélie Alleaume-Butaux, Julia Hernandez-Rapp, Audrey Ragagnin, Sophie Mouillet-Richard, Stéphane Haik, Yannick Bailly, Jean-Michel Peyrin, Jean-Marie Launay, Odile Kellermann, and Benoit Schneider Supplementary Fig. 1 Supplementary Figure 1: Accumulation of PrP Sc in primary cerebellar granule neurons and in the brain of mice infected by the 22L strain. (a) Western blotting to show kinetics of PrP Sc accumulation in primary cerebellar granule neurons (CGNs) exposed to brain homogenate of terminally ill 22L-infected mice (22L-CGN) up to 28 days after infection (d). As a control, CGNs were exposed to brain homogenate of healthy mice (CGN). (b) Western blotting to reveal PrP Sc in brain extracts of 22L-infected mice (22L) as compared to Sham-inoculated mice (Sham).

2 To discriminate between PrP C and PrP Sc, CGNs or brain extracts were treated with proteinase K (PK) and immunoblotted with SAF83 PrP antibody for PrP res detection. Shown are representative Western blots of three independent experiments.

3 Supplementary Fig. 2 1C11 50 ng ml 1 stnf-! " +! + +! BX912! +! +! Fk-1C11! 22L-1C11! + +! +! 15 kda! Actin! Active caspase 3! 37 kda! 10 ng ml 1 stnf-! " BX912! 15 kda! 37 kda! 1C11 5-HT Fk-1C11 5-HT! 22L-1C11 5-HT! +! + +! + +! +! +! +! Active caspase 3! Actin! 50 ng ml 1 TNF-! induced! caspase-3 activation! 6! 4! 2! 0! 1C11!!"!"!!"!!" +! +! Ctrl! Fk! 22L! 10 ng ml 1 TNF-! induced! caspase-3 activation! BX912! (1 µm)! 1C11 5-HT!"!!!"!"!!" +! +! Ctrl! Fk! 22L! Supplementary Figure 2: Prion infection exacerbates stnf-!-induced caspase-3 activation, which is counteracted upon PDK1 inhibition. Western blotting to show activation of TNFR1-coupled caspase-3 in Fk- or 22L-infected 1C11 and 1C11 5-HT cells exposed to stnf-! for 120 min vs. non-infected cells (Ctrl). PDK1 inhibition with BX912 (1 µm, 3 h) in infected cells restores pre-infectious cell sensitivity to stnf-!. Quantitative data are shown as the mean ± SEM from three experiments performed in triplicate. # P < vs. non-infected cells exposed to stnf-! (Ctrl); ## P < 0.01 vs. Fk- or 22L-infected cells treated with stnf-!.

4 Supplementary Fig. 3 Supplementary Figure 3: Prion infection causes brain TNFR1 accumulation. Immunostainings of TNFR1 (a) or PrP Sc (b) in the cerebellar cortex (CBCX) and deep cerebellar nuclei (DCN) of 6PB1- and 22L-infected mice at 90 days after infection with 6PB1 strain and 130 days after infection with 22L strain vs. Sham-inoculated mice. Note that TNFR1 and PrP Sc stainings of CBCX molecular layer of 22L-infected mice exhibit a banded patterning (arrows), suggesting that the increased amount of TNFR1 topographically correlates with PrP Sc deposits. All experiments were performed with n = 3 mice for each condition. Images of one representative experiment are shown. Scale bar = 100!m.

5 Supplementary Fig. 4 a! b! c! 1C11! B! saponin 0.05%!! + Fk-1C11! FAK! Cav-1! TACE! saponin! 120! Intensity of TACE! signal (% of 1C11)! 100! 80! 60! 40! 20! 0!! +! + 1C11! Fk-1C11! Fraction! 1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 125 kda! 21 kda! 100 kda! 100 kda! 100 kda! 100 kda! Cell surface biotinylation! IP: TACE! WB: streptavidin! 100 kda! #! * 1C11 5-HT! 1C11 5-HT! 1C11 5-HT! CGN! d! Fk-1C11 5-HT! Fk-1C11 5-HT! +BX912! Fk-1C11 5-HT! +anti-cav-1! 1C11 5-HT! kda! 100! 100! 100! 100! 100! 100! 100! 100! 100! 22L-CGN! 6! 5! Intensity of TACE! signal (% of ctrl)! ph! 120! 100! 80! 60! 40! 20! 0! 1C11! Fk-1C11! Fk-1C11+BX912! 1C11 5-HT! Ctrl! Fk-1C11 5-HT! Fk-1C11 5-HT +BX912! CGN! 22L-CGN! CGN! #! 22L! 22L-CGN+BX912! Fk-1C11 5-HT! 100 kda! Fk-1C11 5-HT! +BX912, 37 C! 100 kda! Fk-1C11 5-HT! TACE! pi 5.8! p~tace! 4.9 < pi < 5.1! 100 kda! +BX912, 4 C! e! Non-infected! 1C11 5-HT! Fk-1C11 5-HT! + PP2! + Wortmannin! + BX912! + PD98059! Supplementary Figure 4: PDK1 overactivity promotes TACE phosphorylation and internalization in prion-infected cells.

6 (a) Immunofluorescent labeling to assess TACE presence at the surface of non-infected 1C11 cells and primary CGNs, and their infected counterparts (Fk-1C11; 22L-CGN). Cell permeabilization with saponin reveals that TACE is internalized in Fk-infected 1C11 cells. Note that the intensity of TACE signal measured in permeabilized infected cells is comparable to that measured at the surface of non-infected cells. (b) Immunoblot analysis of sucrose gradient fractions of 1C11 5-HT cell membranes to reveal that (i) in non-infected cells TACE co-segregates with FAK, thus indicating that TACE is present at the plasma membrane; (ii) in Fk-infected cells, TACE shifts into caveolin-1 (Cav- 1)-enriched fractions; (iii) treatment with a PDK1 inhibitor (BX912, 1!M for 1 h) or immunosequestration of Cav-1 (anti-cav-1) in Fk-infected cells relocate almost all TACE molecules at the plasma membrane. (c) Sucrose gradient fractionation after cell surface protein biotinylation to reveal that (i) in non-infected 1C11 5-HT cells, TACE is present at the plasma membrane; (ii) in Fk-1C11 5-HT cells, TACE is not present at the plasma membrane; (iii) treatment with a PDK1 inhibitor (BX912, 1!M for 1 h) at 37 C relocates TACE molecules to the plasma membrane. Temperature block at 4 C counteracts the BX912-induced relocation of TACE to the plasma membrane. (d) 2D-gel electrophoresis to assess TACE phosphorylation in Fk-infected 1C11, 1C11 5-HT cells and 22L-infected CGNs treated or not with BX912 (1!M for 1 h) vs. non-infected cells. In non-infected cells, TACE displays an apparent molecular mass of ~100 kda and a pi close to 5.8, corresponding to weakly phosphorylated TACE ( Upon infection, part of TACE spots shifted to a more acidic ph (pi of 5.1 to 4.9) without any measurable change of the apparent molecular mass (arrows). Exposure of infected cells to BX912 cancels prion-induced TACE phosphorylation.

7 (e) Immunofluorescent labeling to show TACE presence at the surface of Fk-1C11 5-HT cells treated or not with inhibitors of Src kinases (PP2, 1!M), PI3K (Wortmannin, 1!M), PDK1 (BX912, 1!M) or the MEK-ERK1/2 module (PD98059, 5!M) for 1 h vs. non-infected cells. All experiments were performed three times in triplicate. * P < vs. non-permeabilized infected cells; # P < vs. non-infected cells (Ctrl); Scale bar = 50!m.

8 Supplementary Fig. 5 a! b! stnfr1 (pg ml 1 )! PrP Sc amount! (ng per mg protein)! 60! 50! 40! 30! 20! 10! 0! 12! 10! 8! 6! 4! 2! 0! 1C11 5-HT! #! #! * * + + +! Anti-Cav-1! Ctrl! Fk! 22L! 1C11 5-HT! #! #! + +! Anti-Cav-1! Fk! 22L! Supplementary Figure 5: Caveolin-1 blockade rescues TNFR1 shedding and reduces PrP Sc accumulation in prion-infected neurons. (a) ELISA stnfr1 quantifications in the culture medium of Fk- and 22L-infected 1C11 5-HT cells vs. non-infected 1C11 5-HT cells (Ctrl) to assess the impact of Cav-1 immunosequestration (anti-cav-1) on TNFR1 shedding. (b) ELISA PrP res quantifications to assess the impact of Cav-1 blockade (anti-cav-1) on PrP Sc level in Fk- and 22L-infected 1C11 5-HT cells.

9 All experiments were performed three times in triplicate. * P < 0.01 vs. non-infected cells (Ctrl); # P < 0.01 vs. untreated Fk- or 22L-infected cells.

10 Supplementary Fig. 6 a! Cell surface TNFR1! level (fold increase)! 2.5! 1.5! 0.5! TgA! neg! TgA! pos! 0! 2! 1! #! TgA! neg! TgA! pos! b! Cell culture medium stnfr1 level (ng ml 1 )! #! * c! 0 BX912! +! +! TgA! neg! TgA! pos! Fraction! 1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 100 kda! TgA! neg! TACE! 100 kda! 100 kda! 100 kda! TgA! pos! TgA! pos! +BX912! TgA! pos! +PD98059! Cav-1 positive fractions! FAK positive fractions! Supplementary Figure 6: TNFR1 under-shedding in hippocampal AD neurons originates from PDK1-dependent dysregulation of TACE sheddase activity. (a) Immunofluorescent labeling to show TNFR1 presence at the surface of TgA! pos neurons vs. TgA! neg neurons. Scale bar = 50!m. For each group n = 4. # P < 0.05 vs. TgA! neg neurons. (b) ELISA stnfr1 quantifications in the culture medium of TgA! pos vs. TgA! neg neurons treated or not with BX912 (1!M for 1 h). For each group, individual values and median (bar) are shown. # P < 0.05 vs. TgA! neg neurons; * P < 0.05 vs. untreated TgA! pos neurons.

11 (c) Immunoblot analysis of sucrose gradient fractions of Tg2576-derived hippocampal neuron membranes to reveal that (i) in TgA! neg neurons TACE co-segregates with FAK, indicating that TACE is present at the plasma membrane prior to A! plaque deposition; (ii) in TgA! pos neurons, TACE shifts into caveolin-1 (Cav-1)-enriched fractions; (iii) treatment of TgA! pos neurons with BX912 (1!M for 1 h) relocates most of TACE molecules to the plasma membrane; (iv) inhibition of the MEK-ERK1/2 module with PD98059 (5!M for 1 h) in TgA! pos neurons fails to target TACE back to the plasma membrane. For each group n = 4.

12 Supplementary Fig. 7 Supplementary Figure 7: PDK1 inhibition durably reduces A! plaque burden in the hippocampus and cortex of Tg2576 mice. Intraperitoneal infusion of BX912 (5 mg kg!1 per day; 0.25 "l per h) to 200 days-old Tg2576 mice reduces the number of animals that accumulate A! (BX912-treated TgA! pos mice) to 10/100 vs. 23/100 at 300 days and to 12/100 vs. 34/100 at 330 days as compared to untreated mice. As observed at 275 days (Fig. 6a), each of these BX912-treated TgA! pos animals displays a ~2-fold reduced number (a) and surface (b) of amyloid plaques in both the hippocampus (Hp) and cortex (Cx) as compared to untreated TgA! pos animals at 300 and 330 days. # P < vs. untreated TgA! pos animals.

13 Supplementary Fig. 8 Supplementary Figure 8: PDK1 silencing in Tg2576 mice rescues cognition and memory. Contextual fear conditioning test with 275 days-old TgA! pos mice to assess the impact of sirna-mediated PDK1 silencing (sipdk1) starting at day 265 on cognition and memory vs. non-treated TgA! pos and TgA! neg mice. A scramble sirna (siscr) is used as control. For each group, individual values and median (bar) are shown. * P < 0.01 vs. TgA! neg mice; ## P < 0.05 vs. siscr-treated TgA! pos mice.

14 Supplementary Fig. 9 Supplementary Figure 9: PDK1 inhibition in Tg2576 mice improves hippocampal functions.

15 Morris water maze test to assess the impact of PDK1 inhibition in TgA! pos mice on hippocampal functions. BX912 treatment improves the latency to reach the platform during the trial period (a), the number of crossing (the mice crossed the position where the platform was placed during trial sessions) (b), the percent time spent in NW quadrant (in which the platform was during the trial period) as compared to other quadrants (c). Note that the swimming speed keeps constant around 20 cm per s for all tested animals (n = 8 for each group). Values are means ± SEM. * P < 0.01 vs. TgA! neg mice; ## P < 0.01 vs. untreated TgA! pos mice.

16 Supplementary Fig. 10 Supplementary Figure 10: PDK1 inhibition in 3Tg mice alleviates Alzheimer s disease.

17 (a) Impact of intraperitoneal injection of BX912 (5 mg kg!1 per day; 0.25 "l per h) in 300 days-old 3TgA! pos mice for 75 days on APP processing by measuring CSF concentrations of sapp", sapp!, A!40 and A!42 vs. untreated 3TgA! pos and 3TgA! neg mice. For each group, individual values and median (bar) are shown. * P < 0.05 vs. 3TgA! neg mice; ## P < 0.05 vs. untreated 3TgA! pos mice. (b-d) Contextual fear conditioning task (b), Morris water maze test (c) and nest construction (d) to assess the impact of PDK1 inhibition on memory and cognition deficits in 3TgA! pos mice vs. untreated 3TgA! pos and 3TgA! neg mice. For each group, individual values and median (bar) are shown. * P < 0.01 vs. 3TgA! neg mice; ## P < 0.01 vs. untreated 3TgA! pos mice.

18 Supplementary Fig. 11 Supplementary Figure 11: PDK1 inhibition in 5Tg mice alleviates Alzheimer s disease.

19 (a) Impact of intraperitoneal injection of BX912 (5 mg kg!1 per day; 0.25 "l per h) in 140 days-old 5TgA! pos mice for 75 days on APP processing by measuring CSF concentrations of sapp", sapp!, A!40 and A!42 vs. untreated 5TgA! pos and 5TgA! neg mice. For each group, individual values and median (bar) are shown. * P < 0.05 vs. 5TgA! neg mice; ## P < 0.05 vs. untreated 5TgA! pos mice. (b-d) Contextual fear conditioning task (b), Morris water maze test (c) and nest construction (d) to assess the impact of PDK1 inhibition on memory and cognition deficits in 5TgA! pos mice vs. untreated 5TgA! pos and 5TgA! neg mice. For each group, individual values and median (bar) are shown. * P < 0.01 vs. 5TgA! neg mice; ## P < 0.01 vs. untreated 5TgA! pos mice.

20 Supplementary Fig. 12 Supplementary Figure 12: Schematic representation of TACE dysregulation caused by PDK1 overactivity in prion-infected or AD neurons and the beneficial effects of PDK1 inhibition against prion or Alzheimer s diseases. Prion infection or the accumulation of A! peptides causes the overstimulation of the Src kinases/pi3k/pdk1 signaling pathway. Overactivated PDK1 promotes the phosphorylation and internalization of TACE metalloproteinase, which diverts the processing of PrP C, APP and TNFR1 away from the TACE "-secretase action. Defect of TACE sheddase activity at the plasma membrane of prion-infected or AD neurons contributes to the conversion of PrP C into PrP Sc or the production of pathogenic A! peptides, and the overexposure of TNFR1, which renders prion-infected or AD neurons highly sensitive to TNF-" toxicity. PDK1 inhibition with BX912 or sirna permits TACE to dephosphorylate and to relocate to the plasma membrane, where it recovers its "-cleavage activity towards PrP C, APP and TNFR1.

21 Rescue of TACE activity at the plasma membrane upon PDK1 inhibition (i) desensitizes pathological neurons from TNF-" toxicity upon TNFR1 shedding and the release of stnfr1, (ii) limits the conversion of PrP C into pathogenic PrP Sc in prion-infected neurons upon "- cleavage of PrP C and (iii) counteracts the production of neurotoxic A! peptides in AD neurons upon "-cleavage of APP. Therefore, PDK1 emerges as a novel therapeutic target for prion and Alzheimer s diseases.

22 Supplementary Table 1 stnf-! LD 50 (ng ml!1 ) Non-infected Fk-infected 22L-infected 1C11 70 ± ± ± 1.0 1C11 5-HT 8.1 ± ± ± 0.2 CGN 100 ± ± ± 1.4 Supplementary Table 1: Impact of prion infection on cell sensitivity to stnf-! in 1C11 precursor cells, their 1C11 5-HT neural derivative and primary CGNs. stnf-! LD 50 values correspond to the concentration of stnf-! inducing a 50% cell death in 1C11 and 1C11 5-HT cells or inducing dendritic fragmentation for 50% of neuronal cells in CGNs. Data are the mean ± SEM of three independent experiments performed in triplicate.

23 Supplementary Table 2 Sample ID Age Gender PMI Braak AD1 78 F 5 6 AD2 85 F 9 5 AD3 82 M 6 6 AD4 69 F 9 5 AD5 87 M 5 5 AD6 92 M 8 6 C1 75 F 6 1 C2 87 F 5 1 C3 80 M 9 1 C4 70 F 6 2 C5 84 M 8 2 C6 87 M 8 1 Supplementary Table 2: Selected patients. Patients were divided in two groups according to neuropathological and clinical criteria: AD patients (AD) and non-ad patients (C). Sample identification (ID); Age at death; female (F); male (M); post-mortem interval in hours (PMI); Braak stage.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05772 SUPPLEMENTARY INFORMATION Supplemental figure 1. Enrichment facilitates learning. a. Images showing a home cage and a cage used for environmental enrichment (EE). For EE up to

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Institute of Molecular and Cellular Biology FACULTY OF BIOLOGICAL SCIENCES. Lipid rafts in neurodegenerative diseases. Nigel M.

Institute of Molecular and Cellular Biology FACULTY OF BIOLOGICAL SCIENCES. Lipid rafts in neurodegenerative diseases. Nigel M. Institute of Molecular and Cellular Biology FACULTY OF BIOLOGICAL SCIENCES Lipid rafts in neurodegenerative diseases Nigel M. Hooper Institute of Molecular and Cellular Biology FACULTY OF BIOLOGICAL SCIENCES

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain. Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

Supplemental Table I

Supplemental Table I Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Suppl. Information Supplementary Figure 1. Strategy/latency analysis of individual mice during maze learning. a,

Suppl. Information Supplementary Figure 1. Strategy/latency analysis of individual mice during maze learning. a, Goal-oriented searching mediated by ventral hippocampus early in trial-and-error learning Ruediger, S, Spirig, D., Donato, F., Caroni, P. Suppl. Information Supplementary Figure 1. Strategy/latency analysis

More information

Targeting the endogenous proteolytic processing of PrP C as a therapeutic strategy against prion diseases

Targeting the endogenous proteolytic processing of PrP C as a therapeutic strategy against prion diseases CJD Foundation Family Conference Targeting the endogenous proteolytic processing of PrP C as a therapeutic strategy against prion diseases Hermann Clemens Altmeppen Institute of Neuropathology University

More information

Human Neurology 3-Plex A

Human Neurology 3-Plex A Human Neurology 3-Plex A SUMMARY AND EXPLANATION OF THE TEST The Human N3PA assay is a digital immunoassay for the quantitative determination of total Tau, Aβ42, and Aβ40 in human plasma and CSF. Determination

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary figure 1

Supplementary figure 1 Supplementary figure 1 (A) Quantitative analysis of F-actin signal intensity in NIH3T3 cells treated with PTD4-myc- RBD. NIH3T3 cells were treated with PTD4-myc-RBD as described. Please note the increase

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)

More information

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplementary Fig. 1: TBR2+ cells in different brain regions. Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Nigel Hooper. University of Manchester UK

Nigel Hooper. University of Manchester UK Prion protein as a therapeutic target in Alzheimer s disease Nigel Hooper University of Manchester UK Prion protein and Alzheimer s a connection? - causative agent of transmissible spongiform encephalopathies

More information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

SD-1 SD-1: Cathepsin B levels in TNF treated hch

SD-1 SD-1: Cathepsin B levels in TNF treated hch SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Fig. S1. High K+ increases intracellular calcium level.

Fig. S1. High K+ increases intracellular calcium level. Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis

More information

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has

More information

Project report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:

Project report October 2012 March 2013 CRF fellow: Principal Investigator: Project title: Project report October 2012 March 2013 CRF fellow: Gennaro Napolitano Principal Investigator: Sergio Daniel Catz Project title: Small molecule regulators of vesicular trafficking to enhance lysosomal exocytosis

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj

More information

Sharon Shacham, Ph.D. ICAD, July 29th, 2008 NASDAQ: EPIX

Sharon Shacham, Ph.D. ICAD, July 29th, 2008 NASDAQ: EPIX Stimulation of Serotonin Type 4 Receptors Leads to Increases in Alpha-Secreatase Activity and sappalpha: Potential for Disease Modification in Alzheimer's Disease Sharon Shacham, Ph.D. ICAD, July 29th,

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

Supplementary material. VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular

Supplementary material. VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular Supplementary material VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular Lat to the TCR activation sites. Paola Larghi, David J Williamson, Jean-Marie Carpier,

More information

Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)

Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g) Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) In four mice, cre-dependent expression of the hyperpolarizing opsin Arch in pyramidal cells

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

PKMζ maintains memories by regulating GluR2- dependent AMPA receptor trafficking

PKMζ maintains memories by regulating GluR2- dependent AMPA receptor trafficking Supplementary information PKMζ maintains memories by regulating GluR2- dependent AMPA receptor trafficking Paola Virginia Migues, Oliver Hardt, Dong Chuan Wu, Karine Gamache, Todd Charlton Sacktor, Yu

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

Silencing neurotransmission with membrane-tethered toxins

Silencing neurotransmission with membrane-tethered toxins nature methods Silencing neurotransmission with membrane-tethered toxins Sebastian Auer, Annika S Stürzebecher, René Jüttner, Julio Santos-Torres, Christina Hanack, Silke Frahm, Beate Liehl & Inés Ibañez-Tallon

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Supplementary Information. Staged decline of neuronal function in vivo in an animal model of Alzheimer s Disease. Supplementary Figures S1-10

Supplementary Information. Staged decline of neuronal function in vivo in an animal model of Alzheimer s Disease. Supplementary Figures S1-10 Supplementary Information Staged decline of neuronal function in vivo in an animal model of Alzheimer s Disease Christine Grienberger 1 *, Nathalie L. Rochefort 1 *, Helmuth Adelsberger 1, Horst A. Henning

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in Dynamic Interaction of Stress Granule, and Mediates Multiple Functions in Hepatitis C Virus Infection Véronique Pène, Qisheng Li#, Catherine Sodroski, Ching-Sheng Hsu, T. Jake Liang# Liver Diseases Branch,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells

6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative

More information

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices 45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing

More information