SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
|
|
- Laurel Kelly
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY DATA
2 Supplementary Figure 1 a b c PF %Change Body weight Lean mass Body fat Tissue weight (g) PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) PF phsl (Ser565) Hsl pacc (Ser79) Acc pampk alpha 1 (Thr172) Ampk alpha 1 pampk beta 1 (Ser18) Ampk beta 1 Cidea Actin phsl (Ser565)/Hsl (a.u.) week 2 week 3 pacc (Ser79)/Acc (a.u.) week 2 week 3 h i j MC38 Ampk alpha protein (a.u.) week 2 week 3 Ampk beta protein (a.u.) Cidea protein (a.u.) week 2 week 3 week 2 week 3 pacc (Ser79) Acc phsl (Ser565) Hsl pampk alpha 1 (Thr172) Ampk alpha 1 pampk beta 1 (Ser18) Ampk beta 1 phsl (Ser66) Hsl Atgl Plin ppka Targets Cidea Vcp Actin
3 Supplementary Figure 1: Cancer cachexia leads to the loss of Ampk expression in white adipose tissue. (a) Change of body weight, body fat and lean mass in control (), pair-fed (PF) and -induced cachectic () mice measured by ECHO-MRI body composition analysis (, PF n = 5, n = 8). (b) Average tissue weights of gastrocnemius skeletal muscle (GC), inguinal white (iwat), abdominal white (awat) and brown (BAT) adipose tissue depots of the same animals. (c) H&E staining of iwat of the same animals (representative images of n = 5). Scale bar µm. (d) Serum nonesterified fatty acid (NEFA) levels of the same animals. (e) Loss of iwat in - bearing mice over time (n = 8). (f) Immunoblot of the lipolysis, lipogenesis and Ampk signaling pathways in iwat from cachectic and control (ctrl) animals over time. Three representative animals per group are shown. (g) Quantification of phsl(ser565) and pacc(ser79) levels normalized to total protein levels as shown in (f) (n =3). (h) Quantification of Ampk alpha and beta as well as Cidea protein levels as shown in (f) (n = 3). (i) Immunoblot of the lipolysis, lipogenesis and Ampk signaling pathways in awat of non-cachectic MC38 cell injected animals (n = 3). (j) Immunoblot of the lipolysis signaling pathway in iwat of cachectic animals. Total Hsl blot is identical to that in Fig. 2a. All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. (a,b,d,e,g,h) 1-way ANOVA with Tukey s Multiple Comparison Posttest. P <.5, P <.1, P <.1
4 Supplementary Figure 2 a % Body weight change % Body fat change % Lean mass change b NEFA (mmol/l) NaCl OHDA NaCl 6-OHDA NaCl 6-OHDA NaCl 6-OHDA c d Tissue weight (g) NE (ng/mg tissue) NE (ng/mg tissue) NE (ng/mg tissue) NaCl 6-OHDA NaCl 6-OHDA NaCl 6-OHDA NaCl 6-OHDA e f.15 Relative Ucp1 mrna levels NEFA (mmol/l).1.5 NaCl NaCl 6-OHDA. DMSO H89 22 C 4 C
5 Supplementary Figure 2: Blockade of sympathetic signaling does not ameliorate the cachectic phenotype in WAT. (a) Change of body weight, body fat and lean mass in and Colon 26 () mice injected with 6-OHDA or NaCl, measured by ECHO-MRI body composition analysis ( n = 4, n = 8). (b) Serum NEFA levels, (c) iwat weight, (d) iwat, awat and BAT norepinephrine (NE) levels of the same animals. (e) Ucp1 mrna levels in iwat of male BALB/c mice injected with NaCl or 6-OHDA into the inguinal fat pads and housed at 22 C or 4 C for 24 h (n = 5). (f) NEFA levels in supernatants of cachectic 3T3-L1 adipocytes treated with vehicle (DMSO) or 5 µm H89 for 3 h (n = 4). All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. (a-d,f) 2-way ANOVA with Bonferroni s Multiple Comparison Posttest. (e) 1-way ANOVA with Tukey s Multiple Comparison Posttest. P <.5, P <.1, P <.1.
6 Supplementary Figure 3 a Body weight (g) b Tissue weight (g) Apc +/+ Apc 58/+ c NEFA (mmol/l) 1..5 d Body weight (g) Apc +/+ Apc 58/+ SW48. GC iwat awat BAT Body weight (g) SW48. +/+ Apc 58/+ Apc f Relative mrna levels SW Time (d) Time (d) 2 1 Murf1 Atrogin1 Bnip3 e g Tissue weight (g).3 SW Tissue weight (g).15 SW48.1 n.s.5 SW48 pacc (Ser79) Acc phsl (Ser565) Hsl pampk alpha 1 (Thr172) Ampk alpha 1. GC iwat awat BAT. GC iwat awat BAT pampk beta 1 (Ser18) Ampk beta 1 Actin
7 Supplementary Figure 3: Loss of Ampk expression is a common feature of various colon cancer mouse models. (a) Body weight, (b) tissue weights and (c) serum NEFA levels of control (Apc +/+ ) and Apc 58/+ cachectic animals (Apc +/+ n = 8, Apc 58/+ n = 4). (d) Body weight of control () and SW48 tumor cell injected cachectic animals. Left panel, SCID Fox Chase background; Right panel, Nude BALB/c background (n = 6). (e) Tissue weights of the same animals. (f) Relative mrna level of the E3 ligases Murf1 and Atrogin-1 as well as autophagy marker Bnip3 in the gastrocnemius (GC) muscle of the same mice (n = 5). (g) Immunoblot of the lipolysis, lipogenesis and Ampk signaling pathways in iwat of Fox Chase SCID mice injected with human SW48 cachexiainducing tumor cells (n = 3). All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. n.s., non-significant. (a-c,e,f) Student s t-test. (d) 2-way ANOVA with Bonferroni s Multiple Comparison Posttest. P <.5, P <.1, P <.1.
8 Supplementary Figure 4 a b 26 c 8 Relative Cidea mrna levels Relative Cidea mrna levels Body weight (g) Pair-fed control Time (d before sacrifice) RMR (ml/h) Pair-fed control Time (d before sacrifice) d 11 e 1 f 8 VO2 (ml/h) Pair-fed control Time (d before sacrifice) VCO2 (ml/h) Pair-fed control Time (d before sacrifice) BW normalized RMR (ml/h) 6 4 PF g h 8 8 Food intake (g/mouse/day) Pair-fed control Time (d before sacrifice) Activity (counts/h) 6 4 Pair-fed control Time (d before sacrifice) i RER Pair-fed control Time (d before sacrifice)
9 Supplementary Figure 4: Cancer cachexia leads to reduced energy expenditure. (a) Cidea mrna levels in iwat (left) and BAT (right) of control and Colon-26 () cachectic animals ( n = 4, n = 8). (b-i) Indirect calorimetry measurements of -injected cachectic animals and pair-fed PBS injected control animals that received the same maximum amount of food as the animals with 1 h time delay. Measurements were performed using the TSE PhenoMaster system. Body weight (b), resting metabolic rate (RMR) (c), VO2 (d), VCO2 (e), food intake (g), arbitrary movements (h), and respiratory exchange ratio (RER) (i) of and pair-fed control animals. Animals were sacrificed when they had lost > 1% of body weight. Data are shown in time before sacrifice to assure that the degree of cachexia was similar in all mice at any given time point. All values were measured every 12 min and mean values were calculated for 24 h, synchronized to the day of sacrifice. Average hourly values are shown in (c-g) (n = 6). (f) RMR adjusted to body weight at the day of sacrifice, ANCOVA adjusted at g body weight (n = 6). All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. (a,f) Student s t-test. (b-e,g-i) Repeated measures ANOVA with Bonferroni s Multiple Comparison Posttest. P <.5, P <.1, P <.1.
10 Supplementary Figure 5 a Relative Ucp1 mrna level Relative Prdm16 mrna level 1..5 Relative Dio2 mrna level 1..5 Relative Cox7a1 mrna level week 2. week 3. week. 1. week 2. week 3. week. 1. week 2. week 3. week. 1. week 2. week 3. week b Relative Ucp1 mrna level WT PBS WT LLC KO LLC n.d. Relative Prdm16 mrna level WT PBS WT LLC KO LLC Relative Dio2 mrna level WT PBS WT LLC KO LLC Relative Cox7a1 mrna level WT PBS WT LLC KO LLC c Body weight (g) LLC Body fat (g) LLC Lean mass (g) LLC Time (d) Time (d) Time (d) d LLC Ampk alpha 1 e 1 Ampk beta 1 Cidea Actin VO2 (ml/h) 1 8 WTPBS WT LLC KO LLC Time (d before sacrifice)
11 Supplementary Figure 5: Cancer cachexia does not induce browning marker genes in WAT. (a) Relative mrna levels of different browning markers in iwat of control () and Colon-26 () cachectic animals. Experiment was performed for three weeks. Weekly, a cohort of six and ten -bearing mice was sacrificed. (b) Relative mrna levels of different browning markers in Ucp1 knockout (KO) and wildtype (wt) mice injected with LLC tumor cells or PBS, sacrificed 14 d after tumor cell injection. (c) Body weight, body fat and lean mass of control () and LLC injected mice (n = 6). (d) Immunoblot of Ampk alpha 1 and beta 1 and Cidea in iwat of the same mice as shown in (c) (representative of n = 6). (e) VO2 of Ucp1 KO and wt mice injected with LLC or PBS, respectively. Measurements were performed using the TSE PhenoMaster system. Same mice as shown in (b). All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. n.d., not detectable. (b) 1-way ANOVA with Tukey s Multiple Comparison Posttest. (c) 2-way ANOVA with Bonferroni s Multiple Comparison Posttest. P <.5, P <.1.
12 Supplementary Figure 6 a 2. CP CP b Relative protein levels 1..5 ACIP ACIP Relative Cidea mrna level Time of CHX treatment (h). sinc sicidea c Final body weight (g) 3 25 GC weight (mg) 35 3 iwat weight (mg) 4 awat weight (mg) WT KO 25 WT KO WT KO WT KO d Relative NEFA levels Relative NEFA levels e NEFA (mmol/l) WT KO. WT KO. DMSO AICAR
13 Supplementary Figure 6: Cidea partly controls the lipolytic response to cancer cachexia in adipocytes. (a) Ampk beta 1 protein levels by immunoblot relative to Ponceau staining from cachectic 3T3-L1 cells transfected with control peptide (CP) or ACIP and treated with 1 mm cycloheximide (CHX) for, 1, 2, 4, 8 and 12 h (n = 3). (b) Relative Cidea mrna level of 3T3-L1 adipocytes treated with a non-specific control sirna (sinc) or a sirna specific for Cidea (n = 4). (c) Body weight and tissue weights of Cidea KO animals and wt littermates, injected with LLC tumor cells, sacrificed on day 21 (wt n = 5, KO n = 7). (d) Relative NEFA levels in supernatants of iwat and awat explants from wild-type (wt) and Cidea KO animals treated with control or mouse serum (n = 3). (e) NEFA levels in supernatants of cachectic 3T3-L1 cells treated with vehicle (DMSO) or 1 µm AICAR for 3 h (n = 4). All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. (b,d) Student s test. (e) 2- way ANOVA with Bonferroni s Multiple Comparison Posttest. P <.1, P <.1.
14 Supplementary Figure 7 a b iwat Relative mrna levels 3 No virus anti-flag AAV ACIP AAV ACIP AAV 1 c c phsl (Ser565)/Actin (a.u.) C ACIP pacc (Ser79)/Actin (a.u.) C ACIP iwat awat Liver AAV d 6 AAV ACIP AAV e n.s. Relative mrna levels 4 n.s. Tumor weight (g) 1..5 iwat awat BAT GC. ACIP
15 Supplementary Figure 7: ACIP ameliorates the cachectic phenotype in vivo. (a) Flag- ACIP mrna expression in iwat, awat and liver of mice injected with 31 9 ifu AAV (; C) into the left inguinal fat pad and 31 9 ifu Flag-ACIP AAV (ACIP) into the right inguinal fat pad of the same animal (No virus n = 6, and ACIP AAV n = 1). (b) Flag-ACIP peptide expression in iwat of the same animals, shown by immunohistochemistry using anti-flag antibody (representative images of n = 3). (c) Quantitation of phsl(ser565) and pacc(ser79) over Actin in iwat from same animals as in (a). (d) Flag-ACIP mrna levels in iwat, awat, BAT and gastrocnemius muscle (GC) of mice injected with ifu ACIP or AAV, and cells two weeks later. Animals were sacrificed upon 1-15% weight loss or at the latest 21 d after tumor cell injection ( n = 12, ACIP n = 15). (e) Tumor weights of the same animals. All data in the figure are shown as the mean ± s.e.m. n numbers refer to biological replicates. n.s., non-significant. (c) 2-way ANOVA with Bonferroni s Multiple Comparison Posttest. (d) Student s t-test. P <.5. P <.1.
16 Supplementary Table 1: Patient characteristics from human bariatric surgery intervention and cachexia study Parameter Cachexia Weight stability n (Women/Men) 33 (19/14) 3 (16/14) Cancer type (n): Rectal Sigma Colon Gastric Cholecystic Bladder Age (years) 62 ± ± 18 BMI (kg/m 2 ).1 ± 2.6 ± 1.8 Creatinine (µmol/l) 74 ± 31 9 ± 75 C-reactive protein (mg/l) 21 ± ± 27 Chemotherapy none none
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationSupplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationSupplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationSupplementary Information Titles
Journal: Nature Medicine Supplementary Information Titles Article Title: Corresponding Author: Authors: An inhibitor of the protein kinases /ε improves obesity- related metabolic dysfunctions Alan Saltiel
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationDeficiency in mtorc1-controlled C/EBPβ-mRNA translation improves metabolic health in mice
Manuscript EMBOR-2014-39837 Deficiency in mtorc1-controlled C/EBPβ-mRNA translation improves metabolic health in mice Laura M. Zidek, Tobias Ackermann, Götz Hartleben, Sabrina Eichwald, Gertrud Kortman,
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More informationReviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationTissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationProtein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationSHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p.
Title mediates adaptive thermogenesis by promoting intracellular activation of thyroid hormones in brown adipocytes Author(s) SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong,
More informationAn introduction to the COCVD Metabolic Phenotyping Core
An introduction to the COCVD Metabolic Phenotyping Core Capabilities and procedures Manager: Wendy S. Katz, Ph.D. University of Kentucky Medical Center Department of Pharmacology 577 Charles T. Wethington
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSupplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,
a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationThe Regulation of Skeletal Muscle Protein Turnover During the Progression of Cancer Cachexia in the Apc Min/+ Mouse
University of South Carolina Scholar Commons Faculty Publications Chemistry and Biochemistry, Department of 9-19-2011 The Regulation of Skeletal Muscle Protein Turnover During the Progression of Cancer
More informationExpanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
More informationAdipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated
Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated thermogenesis Qingzhang Zhu,, James C. Barrow, Anutosh Chakraborty J Clin Invest. 2016;126(11):4273-4288. https://doi.org/10.1172/jci85510.
More informationLack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationControl 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
More informationUp-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationFSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
More informationMobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin
Obesity Research Laboratory Institut Universitaire de France Franco-Czech Laboratory for Clinical Research on Obesity Mobilisation des lipides du tissu adipeux et insulinorésistance Dominique Langin Séminaire
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationThe AMPK agonist 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR), but not metformin, prevents inflammation-associated cachectic muscle wasting
Research Article The AMPK agonist 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR), but not metformin, prevents inflammation-associated cachectic muscle wasting Derek T Hall 1,2, Takla Griss 2,3,
More informationSupplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More information