Supplementary Figures

Size: px
Start display at page:

Download "Supplementary Figures"

Transcription

1 Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni, Tyler Brehm, Andrew Morin, Benjamin Jones, Taylor Splawn, Michael Criscitiello, Michael C. Golding, Fuller W. Bazer, Stephen Safe, Beiyan Zhou

2 HFD Gr1 LFD HFD CD19 LFD A WT mir-150ko CD3 B WT mir-150ko CD11b Supplementary Figure S1. Immune cell components in circulation of lean or obese mice. The population of CD19+ B cells (A), CD3+ T cells (A), neutrophils (B; Gr1+CD11b+), monocytes (B; Gr1-CD11b+F4/80+) in peripheral blood of wild type or mir-150ko mice with or without HFD. Data are presented as mean ± SEM. n=6.

3 HFD Gr1 LFD HFD HFD CD19 CD3 LFD LFD A B WT mir-150ko WT mir-150ko FSC FSC C WT mir-150ko CD11b Supplementary Figure S2. Immune cell components in spleen of lean or obese mice. The population of CD19+ B cells (A), CD3+ T cells (B), neutrophils (C; Gr1+CD11b+), monocytes (C; Gr1-CD11b+F4/80+) in spleen of wild type or mir-150ko mice with or without HFD. Data are presented as mean ± SEM. n=6-8.

4 A B C Supplementary Figure S3. Effects of mir-150 on growth performance of wild type (WT) or mir-150 null mice fed on low-fat diet (LFD) or high-fat diet (HFD). Body weight (A), food intake (B) and adiposity as measured by body fat percentage by weight (C) of mice were measured during 12-week feeding. Data are presented as mean ± SEM. n=10.

5 p A k t/ta k t (fo ld ) p A k t/ta k t (fo ld ) A Akt in Skeletal Muscle B Akt in Liver HFD-WT HFD-miR-150KO HFD-WT HFD-miR-150KO pakt pakt takt takt Tubulin Tubulin S k e le ta l M u s c le L iv e r * * W T m ir K O 0.0 W T m ir K O Supplementary Figure 4. mir-150ko mice demonstrate exacerbated insulin resistance. A and B, Activation of Akt signaling pathway in skeletal muscle and liver of obese WT and mir-150ko mice following portal vein insulin injection. Data are presented as mean ± SEM. n=4.

6 CD69, MFI CD69, MFI MHCII, MFI CD69, MFI A 0hr-WT 0hr-miR-150KO 48hr-WT 48hr-miR-150KO B CD4+ ATT CD19+ ATB WT mir-150ko * * MHCII Lean Obese CD69 Lean Obese C CD8+ ATT CD69 Lean Obese CD69 Lean Obese Supplementary Figure S5. Effects of mir-150 in adipose tissue immune cell activation. The expression of activation-related cell surface markers were measured in lean and obese WT and mir-150ko in VAT CD19+ B Cells (A), CD4+ T cells, and CD8+ T Cells (B and C). Data are presented as mean ± SEM. n=4.

7 HFD CD206 LEAN A WT % % % % mir-150ko 12.5% 11.2% 5.2% 6.2% B 26.7% % 33.9% % CD11c Supplementary Figure S6. ATMs from obese mir-150ko mice have an increased proinflammatory phenotype. Quantification of proinflammatory M1 and anti-inflammatory M2 macrophage cell proportions (A) and sorted ATM gene expression profiles (B) from lean and obese WT and mir-150ko mice. Data are presented as mean ± SEM. n=4.

8 IL1β, MFI TNFα, MFI CD69, MFI CD69, MFI IFNᵞ, MFI CD69, MFI IFNᵞ, MFI CD69, MFI IFNᵞ, MFI A Unstim.-WT Stim.-WT CD4+ T cell Unstim.-miR-150KO Stim-miR-150KO B CD8+ T cell C B220+ B cell CD69 IFN γ CD69 IFN γ CD69 IFN γ WT mir-150ko Unstim. Stim. Unstim. Stim. Unstim. Stim. Unstim. Stim. Unstim. Stim. Unstim. Stim. D Macrophages WT mir-150ko * IL1β Unstim. Stim. TNFα Unstim. Stim. CD69 Unstim. Stim. Supplementary Figure S7. Effects of mir-150 on acute immune cell activation. Splenic CD4+ (A) or CD8+ T cell (B), B220+ B cell (C), and macrophage (D) activation markers and cytokine production were measured after 5 hours of PMA/ionomycin stimulation. Data are presented as mean ± SEM. n=4.

9 A 0hr-WT 0hr-miR-150KO 48hr-WT 48hr-miR-150KO IL4 B LPS CD69 CD86 CD80 CD69 CD86 CD80 C D Supplementary Figure S8. Effects of mir-150 on macrophage activation. The expression of activationrelated cell surface markers (A and B) and key genes (C and D) were measured after 48 hours either LPS or IL4 stimulation. Data are presented as mean ± SEM. n=3.

10 CD4+ T cell IFNγ, MFI CD8+ T cell IFNγ, MFI A 0hr-WT 48hr-WT 0hr-miR-150KO 48hr-miR-150KO CD4+ T cell B CD8+ T cell CD69 CD86 CD80 CD69 CD86 CD80 C D IFNγ IFNγ Supplementary Figure S9. Effects of mir-150 on activation of CD4+ or CD8+ T cell. The expression of activation-related cell surface markers (A and B) and key genes (C and D) were measured after 48 hours anti- CD3/CD28 stimulation. Data are presented as mean ± SEM. n=3.

11 0hr-WT 0hr-miR-150KO Stimulated WT Stimulated mir-150ko 2 hr 24 hr 48 hr 72 hr 2 hr 24 hr 48 hr 72 hr CD69 2 hr 24 hr 48 hr 72 hr CD80 CD86 Supplementary Figure S10. Effect of mir-150 on the expression of activation-related cell surface markers of B cell activation. The expression of activation-related cell surface markers, CD69, CD80, and CD86, were monitored during IL4/CD40-stimulated B cell activation. Data are presented as mean ± SEM. n=6-8.

12 0hr-WT Stimulated WT 0hr-miR-150KO Stimulated mir-150ko 2 hr 24 hr 48 hr 72 hr 2 hr 24 hr 48 hr 72 hr CD69 2 hr 24 hr 48 hr 72 hr CD80 CD86 Supplementary Figure S11. Effect of mir-150 on the expression of activation-related cell surface markers on B cells. The expression of activation-related cell surface markers, CD69, CD80, and CD86, were monitored during LPS-stimulated B cell activation. Data are presented as mean ± SEM. n=6-8.

13 B220 WT mir-150ko 90% 92% FSC Supplementary Figure S12. Validation of B cell purity. B220+ B cells were isolated from HFD-fed mice spleens with anti-mouse B220 conjugated magnetic beads. The purity of B220+ cells were evaluated by flow cytometry analysis with antibody against B220.

14 PI B220+ cells, % of viable cells B null WT Viable B220+ cells Viable B220+ cells B220 Supplementary Figure S13. Mature B cell deficiency in B null mice. Viable CD19 + B cells in the spleen of C57BL/6 immunoglobulin μ heavy-chain knockout (B null ) mice or wild type (WT) mice were analyzed by flow cytometry with antibodies against B220; n=6. Data are presented as mean ± SEM.

15 Supplementary Figure S14. Body weight and adiposity of HFD-fed B null mice after received WT B cells or mir-150ko B cells. Data are presented as mean ± SEM. n=8.

16 In s u lin, n g /m L G lu c o s e, m g /d l A B * * H F D - B n u ll H F D - B n u ll - B W T H F D - B n u ll - B m ir K O F e d F a s te d C 2 0 * * H F D - B n u ll H F D - B n u ll - B W T H F D - B n u ll - B m ir K O * * 5 0 F e d F a s t e d Supplementary Figure S15. Glucose and insulin levels of B null mice after WT or mir-150 KO B cells infusion. Glucose tolerance test of B null or WT mice after 12 weeks LFD or HFD feeding (A). Fed and fasted glucose (B) or insulin (C) levels after WT or mir-150ko B cell infusion. Data are presented as mean ± SEM. n=5-8

17 Relative Abundance Relative Abundance Relative Abundance Relative Abundance Il6 in VAT * * HFD-B null HFD-B null -B WT HFD-B null -B mir-150ko Ccl2 in VAT * Tnfa in VAT * IL1b in VAT * * Supplementary Figure 16 Inflammatory gene expression in VAT of HFD-fed B null mice after receiving WT B cells or mir-150ko B cells. Data are presented as mean ± SEM. n=8.

18 HFD-WT purified IgG HFD-miR-150KO purified IgG Marker HFD-WT plasma protein before purification HFD-miR-150KO plasma protein before purification Supplementary Figure S17. Validation of immunoglobulin purification. Immunoglobulin proteins were purified from plasma of HFD-fed WT mice or HFD-fed mir-150ko mice.

19 Supplementary Figure S18. Glucose tolerance test of HFD-fed B null mice after received purified immunoglobulins. HFD-B null -IgG mir-150ko, HFD-fed B null mice with immunoglobulin (Ig) purified from HFD-fed mir-150ko mice, HFD-B null -IgG WT : HFD-fed WT mice. Data are presented as mean ± SEM. n=6

20 A B C Tnfa Il1b Il6 Supplementary Figure S19. Effect of mir-150 on the interaction between B cell and adipocytes. The expression of proinflammatory cytokines Tnfa (A), Il1b (B), and Il6 (C) by adipocytes (Adi) after 48 hours cocultured with either activated wild type B cells (B WT ) or mir-150ko B cells (B mir-150ko ). Data are presented as mean ± SEM. n=4-6.

21 Supplementary Figure S20. Knockdown of mir-150 target gene expression in mir-150ko B cells by short hairpin RNA (shrna) assay. Data are presented as mean ± SEM. n=3.

22 F4/80 CD4 CD8 A 99% B C 91% 88% CD11b FSC FSC Supplementary Figure S21. Cell isolation. Bone marrow-derived macrophages (a), purified splenic CD4+ T cells (b), and purified splenic CD8+ T cells (c), were analyzed by flow cytometry with antibodies against F4/80, CD11b, CD4, and CD8, respectively.

23 Primer Forward Reverse TNFa 5'-TTGTCTACTCCCAGGTTCTCT-3' 5'-GAGGTTGACTTTCTCCTGGTATG-3' IL1b 5'-TGGACCTTCCAGGATGAGGACA-3' 5'-GTTCATCTCGGAGCCTGTAGTG-3' Btk 5'-GTCAGAGACTCCAGCAAAGCTG-3' 5'-CCAGGTAATACTGGCTCTGTGG-3' Blnk 5'-AGATGGACCGTTCCACAGCTTC-3' 5'-CTCTTCAGCAGACTTGCGGTCA-3' Mcp1 5'-ATGCAGGTCTCTGTCACG-3' 5'-AGTATGACAGAGAACTAG-3' Myb 5'-TGAGAAGCTGAAGAAGCTGGTGGA-3' 5 -TGACTTTCCAGTCGTCTGTTCCGT-3' Arg1 5'-CTCCAAGCCAAAGTCCTTAGAG-3' 5'-AGGAGCTGTCATTAGGGACATC-3' Elk1 5'-AAGAATTGGAAGCTGCAAGGGCTG-3' 5'-ACACCTGGGCTGTGTTCTCTGTTA-3' Etf1 5'-ATTTGGGAGCCCTCTGTGCCATTA-3' 5'-TAGCACAGAAGCCCATCATGTCCA-3' Lyn 5'-TCCTCAAGAGTGATGAAGGTGGC-3' 5'-ACGGTGGATGATGTTCTTCCGC-3' Il6 5'-CAAGAGACTTCCAGCCAGTTGC-3' 5'-TTGCCGAGTAGACCTCATAGTGACC-3' IL10 5'-CGGGAAGACAATAACTGCACCC-3' 5'-CGGTTAGCAGTATGTTGTCCAGC-3' Src 5'-GTTGCTTCGGAGAGGTGTGGAT-3' 5'-CACCAGTTTCTCGTGCCTCAGT-3' Syk 5'-GAGAGCACTGTGTCCTTCAACC-3' 5'-CAGCATAAGGGCTCTGCTACAC-3' B-Actin 5 -GCCACCGATCCACACAGACT-3 5 -GCTCTGGCTCCTAGCACCAT-3 Supplementary Figure S22. List of primers and sequences used for qrt-pcr

mir-150 regulates obesityassociated controlling B cell functions

mir-150 regulates obesityassociated controlling B cell functions www.nature.com/scientificreports OPEN received: 25 June 2015 accepted: 23 December 2015 Published: 01 February 2016 mir-150 regulates obesityassociated insulin resistance by controlling B cell functions

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

MICRORNA-223 REGULATES MACROPHAGE POLARIZATION AND DIET- INDUCED INSULIN RESISTANCE. A Thesis CONG MENG

MICRORNA-223 REGULATES MACROPHAGE POLARIZATION AND DIET- INDUCED INSULIN RESISTANCE. A Thesis CONG MENG MICRORNA-223 REGULATES MACROPHAGE POLARIZATION AND DIET- INDUCED INSULIN RESISTANCE A Thesis by CONG MENG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol. Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative

More information

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice. competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

More information

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation ORIGINAL ARTICLE STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation Anca D. Dobrian, 1 Elena V. Galkina, 2 Qian Ma, 1 Margaret Hatcher, 1 Sabai Myo Aye, 1 Mathew

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Adipose tissue B2 cells promote insulin resistance through leukotriene LTB4/LTB4R1 signaling

Adipose tissue B2 cells promote insulin resistance through leukotriene LTB4/LTB4R1 signaling The Journal of Clinical Investigation RESEARCH ARTICLE Adipose tissue B2 cells promote insulin resistance through leukotriene LTB4/LTB4R1 signaling Wei Ying, 1,2 Joshua Wollam, 1 Jachelle M. Ofrecio, 1

More information

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong

More information

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )

More information

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity Data supplement Netrin- promotes adipose tissue macrophage accumulation and insulin resistance in obesity Bhama Ramkhelawon, Elizabeth J Hennessy, Mickaël Ménager 2, Tathagat D. Ray, Frederick J Sheedy,

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Introduction Dendritic Cells (DC)

Introduction Dendritic Cells (DC) mirna-181 Promotes Graft Prolongation by Plasmacytoid Dendritic Cells by increasing T Regulatory cells and Decreasing B cells as Revealed by Mass Cytometry (CyTOF) Audrey H. Lau, MD, PhD Fellow @ UCSF

More information

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan Supplementary Methods Animal models We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan or Jackson Laboratories. All mice were housed under a 12-h light-dark cycle and allowed

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance FEBS Letters 585 (2011) 2285 2290 journal homepage: www.febsletters.org HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance Ha-Jung Kim a, Hong-Min

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

Post- Selection Purity Spleen VAT Spleen <B576/26-A>: B220

Post- Selection Purity Spleen VAT Spleen <B576/26-A>: B220 B Cells Promote Insulin Resistance through Modulation of T Cells and Production of Pathogenic IgG Antibodies Daniel A. Winer*, Shawn Winer*, Lei Shen*, Persis P. Wadia, Jason Yantha, Geoffrey Paltser,

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

NK cells link obesity-induced adipose stress to inflammation and insulin resistance

NK cells link obesity-induced adipose stress to inflammation and insulin resistance NK cells link obesity-induced adipose stress to inflammation and insulin resistance Felix M Wensveen 1, Vedrana Jelenčić 1,, Sonja Valentić 1,, Marko Šestan 1,, Tamara Turk Wensveen, Sebastian Theurich

More information

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes

More information

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade

More information

NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation

NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation NK cells promote neutrophil recruitment in the brain during sepsisinduced neuroinflammation Hao He 1, Tingting Geng 1, Piyun Chen 1, Meixiang Wang 1, Jingxia Hu 1, Li Kang 1, Wengang Song 1, * & Hua Tang

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Supplementary Figure 1

Supplementary Figure 1 d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP

More information

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Relevant Disclosures

Relevant Disclosures 6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information