Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5

Size: px
Start display at page:

Download "Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5"

Transcription

1 Dec 8, 2015 Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5 1 Functional Food & Nutrition Division, National Institute of Agricultural Science, 2 Seoul Women s Univ, 3 Eulji Univ, 4 Korea Univ, Republic of Korea, ARS-USDA, USA 1

2 Contents Introduction 2/39 Objective - 12 Materials & Methods, Results * black rice extract (BRE), post-menopausal model in vitro 13/39 in vivo - 20 human study - 30 Summary 35/39 Discussion - 36 Conclusion 37/39 2

3 Introduction Rice (Oryza sativa L.) is widely consumed throughout the world and rice consumers have been paying attention to various values of rice. With growing concerns regarding health, black, purple, and red rice with unique flavor, nutritional and biological properties have been developed. 3

4 Introduction The supplementation of black rice and its anthocyanin pigment reduced atherosclerotic lesions in hypercholesterol-emic animal models. Dietary black rice supplementation alleviated hepatic steatosis by increasing fatty acid oxidation in the mice fed a high fat diet. Black rice is a kind of brown rice and is not well digested. So most of functional materials existing in aleurone layer of black rice are hard to be observed. Bio-functional effects of black rice have been tested with it s extracts and major compounds were known as polyphenols and flavonoids. 4

5 Introduction * Thus numerous in vitro and in vivo studies have shown us that black rice may be preventive against chronic diseases by reducing fat weight or its ratio in the body. 5

6 Introduction The average life span has been increasing. 6

7 Introduction Obesity % is higher in women than in men for over 60 years old peoples. Comparison of obesity percentage by age and gender 7

8 Introduction For post-menopausal women, body fat tends to shift to the abdomen and body composition changes with higher ratio of fat in the body. The women experience increased risk of metabolic syndrome and heart disease. 8

9 Introduction For post menopausal women, keeping good health is so important because their health condition continues to/decides the health condition of their old age. Exogenous estrogen has been shown to be protective against metabolic abnormalities. But longterm usage of hormone replacement therapy may increase the risk of breast cancer and cardiovascular diseases in postmenopausal women. 9

10 Introduction People have been interested in natural foods such as black rice to prevent and control obesity or body fat accumulation. Hypothesis 1. Extracts from aleurone layer of black rice (BRA) may effectively prevent obesity and reduce body fat accumulation in the menopausal women. 10

11 2. BRA is 8% of black rice. If we use BRA rather than whole black rice as brown rice for functional material extraction, we can save ethanol as extraction solvent and reduce its amount to 1/13. Oryza sativa L. Brown rice 8.0% aleurone layer (BRA) 92.0% milling rice yields Black rice extract (BRE) 11

12 Objective This study was conducted to evaluate suppressive effects of black rice aleurone layer extract (BRE) on body fat, serum lipid, and hormone levels in ovariectomized model. 12

13 Materials and Methods in vitro study 1 2 Preparation of extracts Oryza sativa L. Brown rice (BR) 3 8.0% aleurone layer (AL) 92.0% milling rice yields (white rice, WR) + 50, 70%%(v/v) EtOH 40 o C, 48 h

14 fold (X) Results - in vitro 개선 Black 전 rice 기술 ( 흑미현미 ) 개선 Black 후 rice 기술 aleurone ( 흑미호분층 : A layer + B + C + D) Cyanidin 3- glucoside Peonidin 3- glucoside 전체 Total anthocyanin Fig. Comparison of anthocyanin contents in black rice and Black rice aleurone layer 14

15 Experimental design - in vitro Comparing - part of rice: BR, AL, WR - ethanol concentration : 50%, 70% Cells: 3T3L1 Factors : cell differentiation, gene expression, lipid concentration 15

16 Results - in vitro Control BR AL Control BR AL Fig. Comparison of BR and AL effect on adipocyte differentiation in 3T3L1 cells 16 Fig. Effects of BRE-AL on adipocyte differentiation in 3T3L1 cells

17 Results - in vitro Fig. Effects of BRE-AL on adipocyte differentiationrelated gene expression in 3T3L1 cells 17

18 Results - in vitro Cell differentiation - Oil Red O Fat oxidation and synthesis Fig. Effects of BRE-AL on adipocyte differentiation, fatty acid oxidation, and its synthesis in 3T3L1 cells 18

19 Results - in vitro Fig. Effects of BRE-AL on lipid accumulation-related gene expression in 3T3L1 cells at 9 th day 19 19

20 Chosen material for in vivo and human studies 1 2 Preparation of BRE Oryza sativa L % aleurone layer (BRE, BRE-AL) 92.0% milling rice yields + 50%(v/v) EtOH 40 o C, 48 h Brown rice Black rice extract (BRE) 20

21 Experimental design - in vivo Metabolic changes induced by estrogen depletion from ovariectomy share many similar characteristics with changes such as weight gain, increased adiposity, and the development of fatty liver in menopausal women. -3 week 0 week 12 week (Adaptation period) 5-week-old SD rats Operation Sham or Ovariectomy Diet: High fat diet (at calories 45%) Groups Sham OVX Control I.F 10mg/kg B.W BRE 30 or 90mg/kg B.W 21

22 Measuring factors - in vivo Body weight gain, fat pad weight Adipocyte size (adipocyte index) Serum triglyceride, total-, LDL-, HDL-cholesterol Serum leptin, adiponectin concentration Hepatic and fecal total lipids, triglyceride, total cholesterol Statistical analysis Windows SAS package program (ver. 9.2) One-way ANOVA ( =0.05) Duncan s multiple range test 22

23 Body weight gain (g/12 weeks) Results - in vivo a ab b b 150 c Sham OVX IF BRE-30 BRE-90 Fig. Treatment effects of BRE-AL on body weight gain of ovariectomized rats 23

24 Weight Results - in vivo Sham OVX IF BRE-30 BRE-90 a b b b c a b bc bc 10 5 ab a ab b b c 0 Perirenal fat Abdominal fat Total body fat Fig. Treatment effects of BRE-AL on body fat weight of ovariectomized rats 24

25 *Adiposity Index (%) Results- in vivo b a b b b Sham OVX IF BRE-30 BRE-90 Fig. Treatment effects of BRE-AL on adiposity index of ovariectomized rats, * fat weight/body weight 25

26 Concentration (mg/dl) Results- in vivo Sham OVX IF 160 BRE-30 BRE-90 NS ab a bc a c Triglyceride Total cholesterol Fig. Treatment effects of BRE-AL on serum lipid profiles of ovariectomized rats 26

27 Concentration (μg/ml) Results- in vivo b ab a a a Sham OVX IF BRE-30 BRE-90 b b c bc bc 2 0 Adiponectin Leptin Fig. Treatment effects of BRE-AL on serum adiponectin and leptin levels of ovariectomized rats 27

28 Concentration (mg/g) Results- in vivo a a a a Sham OVX IF BRE-30 BRE-90 b a a a a b NS Total lipids Triglyceride Total cholesterol Fig. Treatment effects of BRE-AL on hepatic lipid profiles of ovariectomized rats 28

29 Experimental design - human study Body weight and fat content Measure Food and nutrient intake factor BRE-AL Placebo Number Age (46 ~69) Body weight

30 Experimental design - human study Treat with BRE-AL: mg/capsule, 2 capsules/day, 12 weeks Factors: fat weight, - ratio -Bioelectrical impedance analysis (BIA), -Dual-energy x-ray absorptiometry (DEXA), -Computed tomography(ct) Statistical analysis: SASV(version 9.4) 30

31 Body fat ratio (%) Results Human study BIA Fat ratio BIA Body fat ratio P=0.044 P= wk 12wk 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on fat ratio of post menopausal women

32 Results Human study Abdominal fat weight (kg) DEXA Body fat weight P= P=0.000 P= wk 12wk 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on abdominal fat weight of post menopausal women

33 Results Human study Total fat weight (kg) DEXA- total fat weight P=0.002 P= wk 12wk P= 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on total fat weight of post menopausal women

34 Visceral fat area (cm2) CT visceral fat 10,450 10,250 10,182 P= ,050 9,850 0wk 12wk 9,650 9,450 9,250 9,629 9,481 9,293 9,050 8,850 8,650 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on visceral fat area of post menopausal women

35 Summary < in vitro> BRE-AL treatment significantly decrease adipocyte differentiation and lipid accumulation. < in vivo> Body weight gain, body fat weight, and adiposity index increased in the OVX group, but they significantly decreased in the groups supplemented with IF or BRE-AL. Serum triacylglyceride and leptin levels decreased in BRE-AL groups while serum adiponectin level significantly increased compared to that of the OVX group. The reduced fat weight may be explained by the changed gene expression or hormone levels. < human study> Body fat in the BRE treated group was significantly lower than placebo group. 35

36 Discussion BRE-AL effectively reduced body fat weight in post menopausal model at 30 or 90 mg/kg BW though whole black rice extract showed possibility of fat weight reducing at 200 mg/kg BW (Jang et al., 2015). BRE-AL can be used in people who have been interested in natural foods to control obesity or body fat accumulation. Using BRE-AL can reduce extracting solvent volume, prevent environment, and make white rice as foods. The team has been working to register the extract(bre-al) as a healthy food. 36

37 Conclusion The results suggest that black rice aleurone layer may be a useful food source to decrease obesity and its related diseases by modulating lipid metabolism in estrogen-deficiency model. 37

38 References Yang DS, Lee KS, Jeong OY, Kim KJ, Kays SJ. Characterization of volatile aroma compounds in cooked black rice. J Agric Food Chem. 2008;56: Chiang AN, Wu HL, Yeh HI, Chu CS, Lin HC, Lee WC. Antioxidant effects of black rice extract through the induction of superoxide dismutase and catalase activities. Lipids 2006;41: Min SW, Ryu SN, Kim DH. Anti-inflammatory effects of black rice, cyanidin-3-o-beta-d-glycoside, and its metabolites, cyanidin and protocatechuic acid. Int Immunopharmacol 2010;10: Kim HW, LEE AY, Yeo SK, Chung H, Lee JH, Hoang MH, Kim YS. Metabolic profiling and biological mechanisms of body fat reduction in mice fed the ethanolic extract of black-colored rice. Food Res Int 2013;53(1) Seo SJ, Choi YM, Lee SM, Kong SH, Lee JS. Antioxidant Activities and Antioxidant Compounds of Some Specialty Rices. J Korean Soc Food SciNutr 2008;37(2): Jang HH, Park MY, Kim HW, Lee YM, Hwang KA, Park JH, Park DS, Kwon O. Black rice (Oryza sativa L.) extract attenuates hepatic steatosis in C57BL/6J mice fed a high-fat diet via fatty acid oxidation. Nutrition & Metabolism 2012;9:27-38 Davis SR, Castelo-Branco C, Chedraui P, Lumsden MA, Nappi RE, Shah D, Villaseca P. Understanding weight gain at menopause. Climacteric. 2012;15(5): Kaaja RJ. Metabolic syndrome and the menopause. Menopause Int. 2008;14(1):21-5 Rossouw JE, Anderson GL, Prentice RL et al., Risks and benefits of estrogen plus progestin in healthy postmenopa usal women: principal results From the Women's Health Initiative randomized controlled trial. JAMA. 2002;288( 3):

39 Thank you for your attention! 39

Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study

Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study Title of Study: Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study Principal Investigator: Dr. Edralin A. Lucas Nutritional Sciences

More information

Montri Punyatong 1, Puntipa Pongpiachan 2 *, Petai Pongpiachan 2 Dumnern Karladee 3 and Samlee Mankhetkorn 4 ABSTRACT

Montri Punyatong 1, Puntipa Pongpiachan 2 *, Petai Pongpiachan 2 Dumnern Karladee 3 and Samlee Mankhetkorn 4 ABSTRACT Kasetsart J. (Nat. Sci.) 42 : 676-681 (2008) Cytotoxicity of Crude Proanthocyanidin Extract from Purple Glutinous Rice Bran (Oryza sativa L.) (Kum Doi Saket) Compared with Cyanidin 3-Glucoside on X63 Myeloma

More information

Weight control and satiety effects of flaxseed A Review. Kelley Fitzpatrick, M.Sc. NutriScience Solutions Flaxresearch.com

Weight control and satiety effects of flaxseed A Review. Kelley Fitzpatrick, M.Sc. NutriScience Solutions Flaxresearch.com Weight control and satiety effects of flaxseed A Review Kelley Fitzpatrick, M.Sc. NutriScience Solutions Flaxresearch.com Global Childhood Obesity 2000 2010 2013 2025 Number and proportion estimated to

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

Studies of Egg-Shell Calcium (II) A Study on Absorption Rate of Egg-Shell Calcium in Rat

Studies of Egg-Shell Calcium (II) A Study on Absorption Rate of Egg-Shell Calcium in Rat J. Fd Hyg. Safety 18(2), 73 78 (2003) ùƒe w (II) ùƒe w Á½ k w tœw Studies of Egg-Shell Calcium (II) A Study on Absorption Rate of Egg-Shell Calcium in Rat Sook Kyung Lee and Youn Tae Kim %FQBSUNFOUPG'PPE&OHJOFFSJOH%BOLPPL6OJWFSTJUZ$IPOBO,PSFB

More information

: Ajou University College of Medicine, Suwon, Korea; Ajou University College of Medicine, Graduate

: Ajou University College of Medicine, Suwon, Korea; Ajou University College of Medicine, Graduate CURRICULUM VITAE NAME Hyun Woo Lee, M.D. EDUCATION 1991.3.-2001.2 : Ajou University College of Medicine, Suwon, Korea; Doctor of Medicine 2004.3-2006.2 Ajou University College of Medicine, Graduate School,

More information

Experience of Korea Acute Myocardial Infarction Registry (KAMIR)

Experience of Korea Acute Myocardial Infarction Registry (KAMIR) Japan-Korea Joint AMI Symposium Korean Society of Myocardial Infarction Apr 18-19 2014 Experience of Korea Acute Myocardial Infarction Registry (KAMIR) Myung Ho Jeong, MD, PhD, FACC, FAHA, FESC, FSCAI,

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Dietary behaviors and body image recognition of college students according to the self-rated health condition

Dietary behaviors and body image recognition of college students according to the self-rated health condition Nutrition Research and Practice (2008), 2(2), 107-113 c2007 The Korean Nutrition Society and the Korean Society of Community Nutrition Dietary behaviors and body image recognition of college students according

More information

ASSOCIATION BETWEEN DIETARY CALCIUM INTAKES AND WEIGHT LOSS

ASSOCIATION BETWEEN DIETARY CALCIUM INTAKES AND WEIGHT LOSS ASSOCIATION BETWEEN DIETARY CALCIUM INTAKES AND WEIGHT LOSS Presented By: Prof. Mohamed S. Ismail Institution Current: Dept. Clin. Nutr. Univ. Of Dammam, KSA Permanent: Nutr. Food Sci. Menoufia Univ. Egypt

More information

DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link

DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link Mona Hegazy Professor of Internal Medicine Hepatology Department Cairo University Egypt Agenda Congugated lionleic fatty acid NAFLD

More information

Biologist s and Investigator Perspective. Has Sloppy Communication Slowed Progress??

Biologist s and Investigator Perspective. Has Sloppy Communication Slowed Progress?? Biologist s and Investigator Perspective Has Sloppy Communication Slowed Progress?? Thomas B. Clarkson, D.V.M. Comparative Medicine Clinical Research Center Wake Forest University School of Medicine Winston-Salem,

More information

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies

More information

Understanding & Interpreting Body Composition Measures

Understanding & Interpreting Body Composition Measures BODY COMPOSITION Understanding & Interpreting Body Composition Measures Body composition = component of health-related fitness & = component of metabolic fitness Unlike other health-related fitness Not

More information

Standardized Thyroid Cancer Mortality in Korea between 1985 and 2010

Standardized Thyroid Cancer Mortality in Korea between 1985 and 2010 Original Article Endocrinol Metab 2014;29:530-535 http://dx.doi.org/10.3803/enm.2014.29.4.530 pissn 2093-596X eissn 2093-5978 Standardized Thyroid Cancer Mortality in Korea between 1985 and 2010 Yun Mi

More information

NASH Bench to Bedside

NASH Bench to Bedside NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent

More information

A comparison of statistical methods for adjusting the treatment effects in genetic association studies of quantitative traits

A comparison of statistical methods for adjusting the treatment effects in genetic association studies of quantitative traits 34 1 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 1, 2009, pp. 53 62 53 한경화 1), 임길섭 2), 박성하 3), 장양수 4), 송기준 2) 1), 2), 3), 4) A comparison of statistical

More information

Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome

Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome Thomas et al. Nutrition Journal (2015) 14:99 DOI 10.1186/s12937-015-0092-2 RESEARCH Open Access Acute effect of a supplemented

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining

Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining Original Article Healthc Inform Res. 2010 June;16(2):77-81. pissn 2093-3681 eissn 2093-369X Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining A Mi Shin, RN, MS 1,

More information

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only

More information

Overall Energy metabolism: Integration and Regulation

Overall Energy metabolism: Integration and Regulation Overall Energy metabolism: Integration and Regulation We have discussed various fuels which are oxidized via different catabolic pathways to generate ATP, or reducing equivalents required to carry out

More information

Martin/Hopkins Estimation, Friedewald and Beta- Quantification of LDL-C in Patients in FOURIER

Martin/Hopkins Estimation, Friedewald and Beta- Quantification of LDL-C in Patients in FOURIER TAP TO GO BACK TO KIOSK MENU Seth S. Martin, M.D., M.H.S., Robert P. Giugliano, M.D., S.M., 2 Sabina A. Murphy, M.P.H., 2 Scott M. Wasserman, M.D., 3 Peter S. Background Evolocumab, a fully human monoclonal

More information

Research Paper. Academia Journal of Medicinal Plants 4(8): , July 2016 DOI: /ajmp ISSN: Academia Publishing

Research Paper. Academia Journal of Medicinal Plants 4(8): , July 2016 DOI: /ajmp ISSN: Academia Publishing Academia Journal of Medicinal Plants 4(8): 023-029, July 2016 DOI: 10.15413/ajmp.2016.0107 ISSN: 2315-7720 2016 Academia Publishing Research Paper Protective Effects of the Anthocyanin-Rich Fraction of

More information

Effect of dietary energy and protein on the performance, egg quality, blood properties and yolk fatty acid composition of laying hens

Effect of dietary energy and protein on the performance, egg quality, blood properties and yolk fatty acid composition of laying hens Effect of dietary energy and protein on the performance, egg quality, blood properties and yolk fatty acid composition of laying hens M. R. HASSAN 1, H. S. CHOE 2 AND K. S. RYU 1* 1 Department of Animal

More information

Obesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea

Obesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea https://doi.org/10.7180/kmj.2016.31.2.157 KMJ Original Article Obesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea Ju Won Lee, Nam Kyu Kim, Hyun Joon Park,

More information

Effective Anti-aging Strategies in an Era of Super-aging

Effective Anti-aging Strategies in an Era of Super-aging pissn: 2288-6478, eissn: 2288-6761 Review Article Effective Anti-aging Strategies in an Era of Super-aging Saerom Park 1, Min-Ji Yang 1, So-Nyeong Ha 1, Jeong-Sang Lee 1,2,3 1 Department of Health and

More information

Effects of Hormone Therapy on Serum Lipid Levels in Postmenopausal Korean Women

Effects of Hormone Therapy on Serum Lipid Levels in Postmenopausal Korean Women J MM pissn: 2288-6478, eissn: 2288-6761 Journal of Menopausal Medicine 2015;21:104-111 Original Article Effects of Hormone Therapy on Serum Lipid Levels in Postmenopausal Korean Women Jee-Yeon Lee, Hye

More information

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019 Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,

More information

Anti-Hyperglycemic Effect of a Kudzu (Pueraria lobata) Vine Extract in Ovariectomized Mice

Anti-Hyperglycemic Effect of a Kudzu (Pueraria lobata) Vine Extract in Ovariectomized Mice J Nutr Sci Vitaminol, 62, 341 349, 2016 Anti-Hyperglycemic Effect of a Kudzu (Pueraria lobata) Vine Extract in Ovariectomized Mice Teruyoshi Tanaka, Yukihiro Yokota, Hanjun Tang, Nobuhiro Zaima, Tatsuya

More information

NAFLD AND TYPE 2 DIABETES

NAFLD AND TYPE 2 DIABETES NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213

More information

Effects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver

Effects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Animal Industry Report AS 661 ASL R3006 2015 Effects of Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Sun Jin Hur Iowa State University

More information

Dr. Jerry Shurson Department of Animal Science

Dr. Jerry Shurson Department of Animal Science Dr. Jerry Shurson Department of Animal Science University of Minnesota Pigs are what they eat Diet fatty acid (FA) composition affects FA profile in pork fat FA composition varies among adipose tissue

More information

Conjugated Linoleic Acid Technical Document Feb Conjugated Linoleic Acid

Conjugated Linoleic Acid Technical Document Feb Conjugated Linoleic Acid Conjugated Linoleic Acid Technical Document Developed by INDI/SNIG for the Irish Sports Council 2014 Conjugated Linoleic Acid (CLA) Pubmed (Medline), SPORTDiscus and the Cochrane Library were searched

More information

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119 Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk

More information

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu

More information

Effects of the Transition from Premenopause to Postmenopause on Lipids and Lipoproteins: Quantification and Related Parameters

Effects of the Transition from Premenopause to Postmenopause on Lipids and Lipoproteins: Quantification and Related Parameters ORIGINAL ARTICLE DOI: 10.3904/kjim.2011.26.1.47 Effects of the Transition from Premenopause to Postmenopause on Lipids and Lipoproteins: Quantification and Related Parameters Eun Jeung Cho 1, Yun Joo Min

More information

Characteristics of Body Composition and Muscle Strength of North Korean Refugees during South Korean Stay

Characteristics of Body Composition and Muscle Strength of North Korean Refugees during South Korean Stay Original Article Endocrinol Metab 2015;30:551-556 http://dx.doi.org/10.3803/enm.2015.30.4.551 pissn 2093-596X eissn 2093-5978 Characteristics of Body Composition and Muscle Strength of North Korean Refugees

More information

What is Pandoradiet TM? Standardization of Pandoradiet TM. Safety of Pandoradiet TM. Efficacies of Pandoradiet TM

What is Pandoradiet TM? Standardization of Pandoradiet TM. Safety of Pandoradiet TM. Efficacies of Pandoradiet TM What is andoradiet TM? andoradiet TM is a proprietary extract powder of Boesenbergia pandurata, an edible plant with efficacies related to weight management and anti-skin aging. These effects have been

More information

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol

More information

Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA

Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA Division of Agriscience and Bioscience, Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology, Fuchu 183-8509 ABSTRACT

More information

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses 18 June 2015 Doris Jacobs Unilever R&D Vlaardingen Background Elevated low-density lipoprotein-cholesterol

More information

Relationship between Abdominal Fat Area Measured by Screening Abdominal Fat CT and Metabolic Syndrome

Relationship between Abdominal Fat Area Measured by Screening Abdominal Fat CT and Metabolic Syndrome Original Article pissn 1738-2637 / eissn 2288-2928 https://doi.org/10.3348/jksr.2017.77.1.1 Relationship between Abdominal Fat Area Measured by Screening Abdominal Fat CT and Metabolic Syndrome in Asymptomatic

More information

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

More information

Curriculum Vitae. Pusan National University Yangsan Hospital. Education: Premedicine Pusan National University

Curriculum Vitae. Pusan National University Yangsan Hospital. Education: Premedicine Pusan National University Curriculum Vitae Date: Dec. 2013 Sung-Gon Kim, M.D., Ph.D. Home Address: Samick-beach Apt. 202-1207 100, Gwanganhaebyeon-ro, Suyeong-gu Pusan 613-751 Korea Office Address: Department of Psychiatry Pusan

More information

Dietary patterns of children and adolescents analyzed from 2001 Korea National Health and Nutrition Survey

Dietary patterns of children and adolescents analyzed from 2001 Korea National Health and Nutrition Survey Nutrition Research and Practice (2007), 2, 84-88 c2007 The Korean Nutrition Society and the Korean Society of Community Nutrition Dietary patterns of children and adolescents analyzed from 2001 Korea National

More information

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction: Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',

More information

Nutrition Basics. Chapter McGraw-Hill Higher Education. All rights reserved.

Nutrition Basics. Chapter McGraw-Hill Higher Education. All rights reserved. Nutrition Basics Chapter 12 1 The Body s Nutritional Requirements Essential nutrients The Six Essential Nutrients: Proteins, Fats, Carbohydrates, Vitamins, Minerals, Water Defined as : Nutrients one must

More information

Metabolic changes in menopausal transition

Metabolic changes in menopausal transition Metabolic changes in menopausal transition Terhi T. Piltonen M.D., Associate Professor Consultant, Clinical Researcher for the Finnish Medical Foundation Department of Obstetrics and Gynecology PEDEGO

More information

New Zealand Blackcurrant: A New Ergogenic Aid in Sport?

New Zealand Blackcurrant: A New Ergogenic Aid in Sport? New Zealand Blackcurrant: A New Ergogenic Aid in Sport? Mark Willems Professor in Exercise Physiology United Kingdom Blackcurrant The Stress Hero Sponsored by Vilnius - June 10-12, 2015 Take home prediction

More information

What should I drink? Monica Esquivel ECHO Diabetes Learning Group December 6, 2017

What should I drink? Monica Esquivel ECHO Diabetes Learning Group December 6, 2017 What should I drink? Monica Esquivel ECHO Diabetes Learning Group December 6, 2017 Learning Objectives Describe relationship between added sugar and sugar sweetened beverages intake and health Differentiate

More information

Obesity the global epidemic

Obesity the global epidemic Obesity the global epidemic Obesity the global epidemic 35% 35% 35% 34% 34% 33% 33% 33% 32% 43% Top 10 obese countries Smoking Obesity Alcohol Inf. Diseases Toxins Vehicle Collisions Firearms Death Sexual

More information

The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences

The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences What should we be promoting? Define health benefits in terms

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

FAT. Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology

FAT. Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology FAT Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology OBJECTIVES LECTURE By the end of this lecture, student can: Define what is lipid/fat

More information

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids: CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation

More information

Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat

Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Julia Bolsinger, Andrzej Pronczuk, Ravigadevi Sambanthamurthi, KC Hayes Hayes Laboratory and MPOB 5/21/213 The Nile grass rat (Arvicanthis niloticus)

More information

Forebyggelse af metabolisk syndrom vha. mejeriprodukter

Forebyggelse af metabolisk syndrom vha. mejeriprodukter Forebyggelse af metabolisk syndrom vha. mejeriprodukter Kjeld Hermansen Medicinsk Endokrinologisk afd. MEA, Aarhus Universitetshospital Mejeriforskningens Dag 2. marts 2017, Hotel Legoland Metabolic Syndrome

More information

Sun-Young Kang, Gyeong Eun Lim, Yang Keun Kim, Hye Won Kim, Kayoung Lee, Tae-Jin Park, Jinseung Kim

Sun-Young Kang, Gyeong Eun Lim, Yang Keun Kim, Hye Won Kim, Kayoung Lee, Tae-Jin Park, Jinseung Kim J Bone Metab 2017;24:9-14 https://doi.org/10.11005/jbm.2017.24.1.9 pissn 2287-6375 eissn 2287-7029 Original Article Association between Sarcopenic Obesity and Metabolic Syndrome in Postmenopausal Women:

More information

NutriSonic web expert system for meal management and nutrition counseling with nutrient time-series analysis, e-food exchange and easy data transition

NutriSonic web expert system for meal management and nutrition counseling with nutrient time-series analysis, e-food exchange and easy data transition Nutrition Research and Practice (2008), 2(2), 121-129 c2008 The Korean Nutrition Society and the Korean Society of Community Nutrition NutriSonic web expert system for meal management and nutrition counseling

More information

Lipids. PBHL 211 Darine Hachem, MS, LD

Lipids. PBHL 211 Darine Hachem, MS, LD Lipids PBHL 211 Darine Hachem, MS, LD Outline Functions of lipids in our body Types of lipids Sources of lipids Recommendation of fat intake Fat association with heart diseases Provide energy (9Kcal/g

More information

Understanding Cholesterol and Triglycerides

Understanding Cholesterol and Triglycerides MINTO PREVENTION & REHABILITATION CENTRE CENTRE DE PREVENTION ET DE READAPTATION MINTO Understanding Cholesterol and Triglycerides About This Kit Along with cigarette smoking, high blood pressure, physical

More information

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D. The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

The effect of salt usage behavior on sodium intake and excretion among Korean women

The effect of salt usage behavior on sodium intake and excretion among Korean women Nutrition Research and Practice (Nutr Res Pract) 2012;6(3):232-237 http://dx.doi.org/10.4162/nrp.2012.6.3.232 pissn 1976-1457 eissn 2005-6168 The effect of salt usage behavior on sodium intake and excretion

More information

The WorkCare Group, Inc. Content used with permission. StayWell is a registered trademark of The StayWell Company. All rights reserved.

The WorkCare Group, Inc. Content used with permission. StayWell is a registered trademark of The StayWell Company. All rights reserved. Know Your Cholesterol Numbers Checklist for Lowering Your Cholesterol Cholesterol Questions to Ask Your Doctor Misconceptions about Cholesterol LDL and HDL Lowering Your Cholesterol CHECKLIST Cut down

More information

METABOLISM of ADIPOSE TISSUE

METABOLISM of ADIPOSE TISSUE METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation

More information

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State

More information

The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies. By Logan Jenney & Lindsey Poynter

The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies. By Logan Jenney & Lindsey Poynter The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies By Logan Jenney & Lindsey Poynter Abstract: Chocolate chip cookies are a popular baked good loved by consumers for several years

More information

Sunflower vs Canola oil modulation of metabolic traits and tumor development in the South African rat dietary model of Breast Cancer.

Sunflower vs Canola oil modulation of metabolic traits and tumor development in the South African rat dietary model of Breast Cancer. Sunflower vs Canola oil modulation of metabolic traits and tumor development in the South African rat dietary model of Breast Cancer. Dr Annadie Krygsman and Dr Anneke Brand Background After cervical cancer,

More information

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,

More information

Heart Disease Genesis

Heart Disease Genesis Heart Disease Genesis The Ultimate Lecture on CAD origins Petr Polasek MD FRCPC FACC Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored,

More information

Optimization of a green method for the recovery of polyphenols from onion solid wastes

Optimization of a green method for the recovery of polyphenols from onion solid wastes Department of Food Science and Technology, Faculty of Agriculture, Aristotle University of Thessaloniki, Greece 5th International Conference on Sustainable Solid Waste Management, Athens, 21 24 June 2017

More information

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT Naohito AOKI, Erina ARAKAWA and Miyuki ITO Department of Life Science, Graduate School of Bioresources, Mie University Tsu 514-857 ABSTRACT C57BL/6J mice (male, 4wk old) were fed low fat diet (LF), high

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information

The effect of stair-ascent activity exercise on body fat and muscle mass in university students.

The effect of stair-ascent activity exercise on body fat and muscle mass in university students. Biomedical Research 2018; 29 (18): 3492-3496 ISSN 0970-938X www.biomedres.info The effect of stair-ascent activity exercise on body fat and muscle mass in university students. Myung-Nam Lee, Min-Kyung

More information

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health

More information

A study on nutrition knowledge and dietary behavior of elementary school children in Seoul

A study on nutrition knowledge and dietary behavior of elementary school children in Seoul Nutrition Research and Practice (2008), 2(4), 308-316 c2008 The Korean Nutrition Society and the Korean Society of Community Nutrition A study on nutrition knowledge and dietary behavior of elementary

More information

Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus Patients

Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus Patients Review Article Endocrinol Metab 2016;31:354-360 http://dx.doi.org/10.3803/enm.2016.31.3.354 pissn 2093-596X eissn 2093-5978 Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus

More information

Yiying Zhang, PhD Research Scientist. Research Summary:

Yiying Zhang, PhD Research Scientist. Research Summary: Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,

More information

Free Fatty Acid Assay Kit

Free Fatty Acid Assay Kit Free Fatty Acid Assay Kit Catalog Number KA1667 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

COMBAT SYNDROME X, Y, AND Z, THE UNIFYING DISEASE CONCEPT OF THE METABOLIC SYNDROME AND THEIR MANAGEMENT

COMBAT SYNDROME X, Y, AND Z, THE UNIFYING DISEASE CONCEPT OF THE METABOLIC SYNDROME AND THEIR MANAGEMENT COMBAT SYNDROME X, Y, AND Z, THE UNIFYING DISEASE CONCEPT OF THE METABOLIC SYNDROME AND THEIR MANAGEMENT Stephen Holt M.D., LLD(Hon), MRCP(UK), FRCP(C), FACG, FACP, FACN, FACAM SUPER-SIZING AMERICA Americans

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

Hypocholesterolemic Effect of Ginkgo Biloba Seeds Extract from High Fat Diet Mice

Hypocholesterolemic Effect of Ginkgo Biloba Seeds Extract from High Fat Diet Mice Biomedical Science Letters 2017, 23(2): 138~143 http://dx.doi.org/10.15616/bsl.2017.23.2.138 eissn : 2288-7415 Brief Communication Hypocholesterolemic Effect of Ginkgo Biloba Seeds Extract from High Fat

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

Maintain Cholesterol

Maintain Cholesterol Maintain Cholesterol What is Cholesterol? Cholesterol is a Lipid Molecule that has a waxy appearance and is found in every cell of the body and has some important natural functions. It is manufactured

More information

Kathryn M. Rexrode, MD, MPH. Assistant Professor. Division of Preventive Medicine Brigham and Women s s Hospital Harvard Medical School

Kathryn M. Rexrode, MD, MPH. Assistant Professor. Division of Preventive Medicine Brigham and Women s s Hospital Harvard Medical School Update: Hormones and Cardiovascular Disease in Women Kathryn M. Rexrode, MD, MPH Assistant Professor Division of Preventive Medicine Brigham and Women s s Hospital Harvard Medical School Overview Review

More information

Estimated dietary isoflavone intake among Korean adults*

Estimated dietary isoflavone intake among Korean adults* Nutrition Research and Practice (2007), 1(3), 206-211 c2007 The Korean Nutrition Society and the Korean Society of Community Nutrition Estimated dietary isoflavone among Korean adults* Min-June Lee 1 and

More information

THE SAME EFFECT WAS NOT FOUND WITH SPIRITS 3-5 DRINKS OF SPIRITS PER DAY WAS ASSOCIATED WITH INCREASED MORTALITY

THE SAME EFFECT WAS NOT FOUND WITH SPIRITS 3-5 DRINKS OF SPIRITS PER DAY WAS ASSOCIATED WITH INCREASED MORTALITY ALCOHOL NEGATIVE CORRELATION BETWEEN 1-2 DRINKS PER DAY AND THE INCIDENCE OF CARDIOVASCULAR DISEASE SOME HAVE SHOWN THAT EVEN 3-4 DRINKS PER DAY CAN BE BENEFICIAL - WHILE OTHERS HAVE FOUND IT TO BE HARMFUL

More information

The Effects of Raspberry Ketone Supplementation on Body Composition. Angelo Pagani and Dr. John Thistlethwaite.

The Effects of Raspberry Ketone Supplementation on Body Composition. Angelo Pagani and Dr. John Thistlethwaite. The Effects of Raspberry Ketone Supplementation on Body Composition Angelo Pagani and Dr. John Thistlethwaite. Ohio Dominican University, Columbus, OH. Abstract Raspberry ketones have recently been linked

More information

Effects of corn gluten hydrolyzates, branched chain amino acids, and leucine on body weight reduction in obese rats induced by a high fat diet

Effects of corn gluten hydrolyzates, branched chain amino acids, and leucine on body weight reduction in obese rats induced by a high fat diet Nutrition Research and Practice (Nutr Res Pract) 2010;4(2):106-113 DOI: 10.4162/nrp.2010.4.2.106 Effects of corn gluten hydrolyzates, branched chain amino acids, and leucine on body weight reduction in

More information

결핵성경부림프절염의항결핵제치료기간에관한연구 : 6 개월과 12 개월요법의무작위임상대조연구

결핵성경부림프절염의항결핵제치료기간에관한연구 : 6 개월과 12 개월요법의무작위임상대조연구 KISEP Head and Neck Korean J Otolaryngol 2004;47:258-62 결핵성경부림프절염의항결핵제치료기간에관한연구 : 6 개월과 12 개월요법의무작위임상대조연구 고려대학교의과대학이비인후 - 두경부외과학교실, 1 내과학교실, 2 예방의학교실 3 임기정 1 권윤환 1 백승국 1 우정수 1 권순영 1 정광윤 1 박대원 2 손장욱 2 김민자

More information

Misperceptions still exist that cardiovascular disease is not a real problem for women.

Misperceptions still exist that cardiovascular disease is not a real problem for women. Management of Cardiovascular Risk Factors in the Cynthia A., MD University of California, San Diego ARHP 9/19/08 Disclosures Research support Wyeth, Lilly, Organon, Novo Nordisk, Pfizer Consultant fees

More information

Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material.

Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Chapter 3 Fats Chapter 3 Lesson 3.1 Key Concepts Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Foods from animal and plant sources supply distinct

More information

Original Article Association of obesity with serum estrogen level in postmenopausal women

Original Article Association of obesity with serum estrogen level in postmenopausal women Bangladesh Med J. 216 May; 45 (2) Original Article Association of obesity with serum estrogen level in Yeasmin N 1, Hossain MJ 2, Hossain I 3, Akhter QS 4 Abstract: Incidence of obesity among is increasing

More information