Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5
|
|
- Clara Hudson
- 5 years ago
- Views:
Transcription
1 Dec 8, 2015 Sunghyen Lee 1, Youngmin Lee 2, Sungjoon Lee 3, Haejeung Lee 4, Hyun Lillehoj 5 1 Functional Food & Nutrition Division, National Institute of Agricultural Science, 2 Seoul Women s Univ, 3 Eulji Univ, 4 Korea Univ, Republic of Korea, ARS-USDA, USA 1
2 Contents Introduction 2/39 Objective - 12 Materials & Methods, Results * black rice extract (BRE), post-menopausal model in vitro 13/39 in vivo - 20 human study - 30 Summary 35/39 Discussion - 36 Conclusion 37/39 2
3 Introduction Rice (Oryza sativa L.) is widely consumed throughout the world and rice consumers have been paying attention to various values of rice. With growing concerns regarding health, black, purple, and red rice with unique flavor, nutritional and biological properties have been developed. 3
4 Introduction The supplementation of black rice and its anthocyanin pigment reduced atherosclerotic lesions in hypercholesterol-emic animal models. Dietary black rice supplementation alleviated hepatic steatosis by increasing fatty acid oxidation in the mice fed a high fat diet. Black rice is a kind of brown rice and is not well digested. So most of functional materials existing in aleurone layer of black rice are hard to be observed. Bio-functional effects of black rice have been tested with it s extracts and major compounds were known as polyphenols and flavonoids. 4
5 Introduction * Thus numerous in vitro and in vivo studies have shown us that black rice may be preventive against chronic diseases by reducing fat weight or its ratio in the body. 5
6 Introduction The average life span has been increasing. 6
7 Introduction Obesity % is higher in women than in men for over 60 years old peoples. Comparison of obesity percentage by age and gender 7
8 Introduction For post-menopausal women, body fat tends to shift to the abdomen and body composition changes with higher ratio of fat in the body. The women experience increased risk of metabolic syndrome and heart disease. 8
9 Introduction For post menopausal women, keeping good health is so important because their health condition continues to/decides the health condition of their old age. Exogenous estrogen has been shown to be protective against metabolic abnormalities. But longterm usage of hormone replacement therapy may increase the risk of breast cancer and cardiovascular diseases in postmenopausal women. 9
10 Introduction People have been interested in natural foods such as black rice to prevent and control obesity or body fat accumulation. Hypothesis 1. Extracts from aleurone layer of black rice (BRA) may effectively prevent obesity and reduce body fat accumulation in the menopausal women. 10
11 2. BRA is 8% of black rice. If we use BRA rather than whole black rice as brown rice for functional material extraction, we can save ethanol as extraction solvent and reduce its amount to 1/13. Oryza sativa L. Brown rice 8.0% aleurone layer (BRA) 92.0% milling rice yields Black rice extract (BRE) 11
12 Objective This study was conducted to evaluate suppressive effects of black rice aleurone layer extract (BRE) on body fat, serum lipid, and hormone levels in ovariectomized model. 12
13 Materials and Methods in vitro study 1 2 Preparation of extracts Oryza sativa L. Brown rice (BR) 3 8.0% aleurone layer (AL) 92.0% milling rice yields (white rice, WR) + 50, 70%%(v/v) EtOH 40 o C, 48 h
14 fold (X) Results - in vitro 개선 Black 전 rice 기술 ( 흑미현미 ) 개선 Black 후 rice 기술 aleurone ( 흑미호분층 : A layer + B + C + D) Cyanidin 3- glucoside Peonidin 3- glucoside 전체 Total anthocyanin Fig. Comparison of anthocyanin contents in black rice and Black rice aleurone layer 14
15 Experimental design - in vitro Comparing - part of rice: BR, AL, WR - ethanol concentration : 50%, 70% Cells: 3T3L1 Factors : cell differentiation, gene expression, lipid concentration 15
16 Results - in vitro Control BR AL Control BR AL Fig. Comparison of BR and AL effect on adipocyte differentiation in 3T3L1 cells 16 Fig. Effects of BRE-AL on adipocyte differentiation in 3T3L1 cells
17 Results - in vitro Fig. Effects of BRE-AL on adipocyte differentiationrelated gene expression in 3T3L1 cells 17
18 Results - in vitro Cell differentiation - Oil Red O Fat oxidation and synthesis Fig. Effects of BRE-AL on adipocyte differentiation, fatty acid oxidation, and its synthesis in 3T3L1 cells 18
19 Results - in vitro Fig. Effects of BRE-AL on lipid accumulation-related gene expression in 3T3L1 cells at 9 th day 19 19
20 Chosen material for in vivo and human studies 1 2 Preparation of BRE Oryza sativa L % aleurone layer (BRE, BRE-AL) 92.0% milling rice yields + 50%(v/v) EtOH 40 o C, 48 h Brown rice Black rice extract (BRE) 20
21 Experimental design - in vivo Metabolic changes induced by estrogen depletion from ovariectomy share many similar characteristics with changes such as weight gain, increased adiposity, and the development of fatty liver in menopausal women. -3 week 0 week 12 week (Adaptation period) 5-week-old SD rats Operation Sham or Ovariectomy Diet: High fat diet (at calories 45%) Groups Sham OVX Control I.F 10mg/kg B.W BRE 30 or 90mg/kg B.W 21
22 Measuring factors - in vivo Body weight gain, fat pad weight Adipocyte size (adipocyte index) Serum triglyceride, total-, LDL-, HDL-cholesterol Serum leptin, adiponectin concentration Hepatic and fecal total lipids, triglyceride, total cholesterol Statistical analysis Windows SAS package program (ver. 9.2) One-way ANOVA ( =0.05) Duncan s multiple range test 22
23 Body weight gain (g/12 weeks) Results - in vivo a ab b b 150 c Sham OVX IF BRE-30 BRE-90 Fig. Treatment effects of BRE-AL on body weight gain of ovariectomized rats 23
24 Weight Results - in vivo Sham OVX IF BRE-30 BRE-90 a b b b c a b bc bc 10 5 ab a ab b b c 0 Perirenal fat Abdominal fat Total body fat Fig. Treatment effects of BRE-AL on body fat weight of ovariectomized rats 24
25 *Adiposity Index (%) Results- in vivo b a b b b Sham OVX IF BRE-30 BRE-90 Fig. Treatment effects of BRE-AL on adiposity index of ovariectomized rats, * fat weight/body weight 25
26 Concentration (mg/dl) Results- in vivo Sham OVX IF 160 BRE-30 BRE-90 NS ab a bc a c Triglyceride Total cholesterol Fig. Treatment effects of BRE-AL on serum lipid profiles of ovariectomized rats 26
27 Concentration (μg/ml) Results- in vivo b ab a a a Sham OVX IF BRE-30 BRE-90 b b c bc bc 2 0 Adiponectin Leptin Fig. Treatment effects of BRE-AL on serum adiponectin and leptin levels of ovariectomized rats 27
28 Concentration (mg/g) Results- in vivo a a a a Sham OVX IF BRE-30 BRE-90 b a a a a b NS Total lipids Triglyceride Total cholesterol Fig. Treatment effects of BRE-AL on hepatic lipid profiles of ovariectomized rats 28
29 Experimental design - human study Body weight and fat content Measure Food and nutrient intake factor BRE-AL Placebo Number Age (46 ~69) Body weight
30 Experimental design - human study Treat with BRE-AL: mg/capsule, 2 capsules/day, 12 weeks Factors: fat weight, - ratio -Bioelectrical impedance analysis (BIA), -Dual-energy x-ray absorptiometry (DEXA), -Computed tomography(ct) Statistical analysis: SASV(version 9.4) 30
31 Body fat ratio (%) Results Human study BIA Fat ratio BIA Body fat ratio P=0.044 P= wk 12wk 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on fat ratio of post menopausal women
32 Results Human study Abdominal fat weight (kg) DEXA Body fat weight P= P=0.000 P= wk 12wk 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on abdominal fat weight of post menopausal women
33 Results Human study Total fat weight (kg) DEXA- total fat weight P=0.002 P= wk 12wk P= 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on total fat weight of post menopausal women
34 Visceral fat area (cm2) CT visceral fat 10,450 10,250 10,182 P= ,050 9,850 0wk 12wk 9,650 9,450 9,250 9,629 9,481 9,293 9,050 8,850 8,650 흑미 BRE-AL 플라시보 Placebo Fig. Treatment effects of BRE-AL on visceral fat area of post menopausal women
35 Summary < in vitro> BRE-AL treatment significantly decrease adipocyte differentiation and lipid accumulation. < in vivo> Body weight gain, body fat weight, and adiposity index increased in the OVX group, but they significantly decreased in the groups supplemented with IF or BRE-AL. Serum triacylglyceride and leptin levels decreased in BRE-AL groups while serum adiponectin level significantly increased compared to that of the OVX group. The reduced fat weight may be explained by the changed gene expression or hormone levels. < human study> Body fat in the BRE treated group was significantly lower than placebo group. 35
36 Discussion BRE-AL effectively reduced body fat weight in post menopausal model at 30 or 90 mg/kg BW though whole black rice extract showed possibility of fat weight reducing at 200 mg/kg BW (Jang et al., 2015). BRE-AL can be used in people who have been interested in natural foods to control obesity or body fat accumulation. Using BRE-AL can reduce extracting solvent volume, prevent environment, and make white rice as foods. The team has been working to register the extract(bre-al) as a healthy food. 36
37 Conclusion The results suggest that black rice aleurone layer may be a useful food source to decrease obesity and its related diseases by modulating lipid metabolism in estrogen-deficiency model. 37
38 References Yang DS, Lee KS, Jeong OY, Kim KJ, Kays SJ. Characterization of volatile aroma compounds in cooked black rice. J Agric Food Chem. 2008;56: Chiang AN, Wu HL, Yeh HI, Chu CS, Lin HC, Lee WC. Antioxidant effects of black rice extract through the induction of superoxide dismutase and catalase activities. Lipids 2006;41: Min SW, Ryu SN, Kim DH. Anti-inflammatory effects of black rice, cyanidin-3-o-beta-d-glycoside, and its metabolites, cyanidin and protocatechuic acid. Int Immunopharmacol 2010;10: Kim HW, LEE AY, Yeo SK, Chung H, Lee JH, Hoang MH, Kim YS. Metabolic profiling and biological mechanisms of body fat reduction in mice fed the ethanolic extract of black-colored rice. Food Res Int 2013;53(1) Seo SJ, Choi YM, Lee SM, Kong SH, Lee JS. Antioxidant Activities and Antioxidant Compounds of Some Specialty Rices. J Korean Soc Food SciNutr 2008;37(2): Jang HH, Park MY, Kim HW, Lee YM, Hwang KA, Park JH, Park DS, Kwon O. Black rice (Oryza sativa L.) extract attenuates hepatic steatosis in C57BL/6J mice fed a high-fat diet via fatty acid oxidation. Nutrition & Metabolism 2012;9:27-38 Davis SR, Castelo-Branco C, Chedraui P, Lumsden MA, Nappi RE, Shah D, Villaseca P. Understanding weight gain at menopause. Climacteric. 2012;15(5): Kaaja RJ. Metabolic syndrome and the menopause. Menopause Int. 2008;14(1):21-5 Rossouw JE, Anderson GL, Prentice RL et al., Risks and benefits of estrogen plus progestin in healthy postmenopa usal women: principal results From the Women's Health Initiative randomized controlled trial. JAMA. 2002;288( 3):
39 Thank you for your attention! 39
Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study
Title of Study: Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study Principal Investigator: Dr. Edralin A. Lucas Nutritional Sciences
More informationMontri Punyatong 1, Puntipa Pongpiachan 2 *, Petai Pongpiachan 2 Dumnern Karladee 3 and Samlee Mankhetkorn 4 ABSTRACT
Kasetsart J. (Nat. Sci.) 42 : 676-681 (2008) Cytotoxicity of Crude Proanthocyanidin Extract from Purple Glutinous Rice Bran (Oryza sativa L.) (Kum Doi Saket) Compared with Cyanidin 3-Glucoside on X63 Myeloma
More informationWeight control and satiety effects of flaxseed A Review. Kelley Fitzpatrick, M.Sc. NutriScience Solutions Flaxresearch.com
Weight control and satiety effects of flaxseed A Review Kelley Fitzpatrick, M.Sc. NutriScience Solutions Flaxresearch.com Global Childhood Obesity 2000 2010 2013 2025 Number and proportion estimated to
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationStudies of Egg-Shell Calcium (II) A Study on Absorption Rate of Egg-Shell Calcium in Rat
J. Fd Hyg. Safety 18(2), 73 78 (2003) ùƒe w (II) ùƒe w Á½ k w tœw Studies of Egg-Shell Calcium (II) A Study on Absorption Rate of Egg-Shell Calcium in Rat Sook Kyung Lee and Youn Tae Kim %FQBSUNFOUPG'PPE&OHJOFFSJOH%BOLPPL6OJWFSTJUZ$IPOBO,PSFB
More information: Ajou University College of Medicine, Suwon, Korea; Ajou University College of Medicine, Graduate
CURRICULUM VITAE NAME Hyun Woo Lee, M.D. EDUCATION 1991.3.-2001.2 : Ajou University College of Medicine, Suwon, Korea; Doctor of Medicine 2004.3-2006.2 Ajou University College of Medicine, Graduate School,
More informationExperience of Korea Acute Myocardial Infarction Registry (KAMIR)
Japan-Korea Joint AMI Symposium Korean Society of Myocardial Infarction Apr 18-19 2014 Experience of Korea Acute Myocardial Infarction Registry (KAMIR) Myung Ho Jeong, MD, PhD, FACC, FAHA, FESC, FSCAI,
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationDietary behaviors and body image recognition of college students according to the self-rated health condition
Nutrition Research and Practice (2008), 2(2), 107-113 c2007 The Korean Nutrition Society and the Korean Society of Community Nutrition Dietary behaviors and body image recognition of college students according
More informationASSOCIATION BETWEEN DIETARY CALCIUM INTAKES AND WEIGHT LOSS
ASSOCIATION BETWEEN DIETARY CALCIUM INTAKES AND WEIGHT LOSS Presented By: Prof. Mohamed S. Ismail Institution Current: Dept. Clin. Nutr. Univ. Of Dammam, KSA Permanent: Nutr. Food Sci. Menoufia Univ. Egypt
More informationDM, NAFLD, and conjugated linoleic acid (omega 6); what is the link
DM, NAFLD, and conjugated linoleic acid (omega 6); what is the link Mona Hegazy Professor of Internal Medicine Hepatology Department Cairo University Egypt Agenda Congugated lionleic fatty acid NAFLD
More informationBiologist s and Investigator Perspective. Has Sloppy Communication Slowed Progress??
Biologist s and Investigator Perspective Has Sloppy Communication Slowed Progress?? Thomas B. Clarkson, D.V.M. Comparative Medicine Clinical Research Center Wake Forest University School of Medicine Winston-Salem,
More informationFructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희
Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies
More informationUnderstanding & Interpreting Body Composition Measures
BODY COMPOSITION Understanding & Interpreting Body Composition Measures Body composition = component of health-related fitness & = component of metabolic fitness Unlike other health-related fitness Not
More informationStandardized Thyroid Cancer Mortality in Korea between 1985 and 2010
Original Article Endocrinol Metab 2014;29:530-535 http://dx.doi.org/10.3803/enm.2014.29.4.530 pissn 2093-596X eissn 2093-5978 Standardized Thyroid Cancer Mortality in Korea between 1985 and 2010 Yun Mi
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationA comparison of statistical methods for adjusting the treatment effects in genetic association studies of quantitative traits
34 1 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 1, 2009, pp. 53 62 53 한경화 1), 임길섭 2), 박성하 3), 장양수 4), 송기준 2) 1), 2), 3), 4) A comparison of statistical
More informationBone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome
Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome Thomas et al. Nutrition Journal (2015) 14:99 DOI 10.1186/s12937-015-0092-2 RESEARCH Open Access Acute effect of a supplemented
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationDiagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining
Original Article Healthc Inform Res. 2010 June;16(2):77-81. pissn 2093-3681 eissn 2093-369X Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining A Mi Shin, RN, MS 1,
More information1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)
I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only
More informationOverall Energy metabolism: Integration and Regulation
Overall Energy metabolism: Integration and Regulation We have discussed various fuels which are oxidized via different catabolic pathways to generate ATP, or reducing equivalents required to carry out
More informationMartin/Hopkins Estimation, Friedewald and Beta- Quantification of LDL-C in Patients in FOURIER
TAP TO GO BACK TO KIOSK MENU Seth S. Martin, M.D., M.H.S., Robert P. Giugliano, M.D., S.M., 2 Sabina A. Murphy, M.P.H., 2 Scott M. Wasserman, M.D., 3 Peter S. Background Evolocumab, a fully human monoclonal
More informationResearch Paper. Academia Journal of Medicinal Plants 4(8): , July 2016 DOI: /ajmp ISSN: Academia Publishing
Academia Journal of Medicinal Plants 4(8): 023-029, July 2016 DOI: 10.15413/ajmp.2016.0107 ISSN: 2315-7720 2016 Academia Publishing Research Paper Protective Effects of the Anthocyanin-Rich Fraction of
More informationEffect of dietary energy and protein on the performance, egg quality, blood properties and yolk fatty acid composition of laying hens
Effect of dietary energy and protein on the performance, egg quality, blood properties and yolk fatty acid composition of laying hens M. R. HASSAN 1, H. S. CHOE 2 AND K. S. RYU 1* 1 Department of Animal
More informationObesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea
https://doi.org/10.7180/kmj.2016.31.2.157 KMJ Original Article Obesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea Ju Won Lee, Nam Kyu Kim, Hyun Joon Park,
More informationEffective Anti-aging Strategies in an Era of Super-aging
pissn: 2288-6478, eissn: 2288-6761 Review Article Effective Anti-aging Strategies in an Era of Super-aging Saerom Park 1, Min-Ji Yang 1, So-Nyeong Ha 1, Jeong-Sang Lee 1,2,3 1 Department of Health and
More informationEffects of Hormone Therapy on Serum Lipid Levels in Postmenopausal Korean Women
J MM pissn: 2288-6478, eissn: 2288-6761 Journal of Menopausal Medicine 2015;21:104-111 Original Article Effects of Hormone Therapy on Serum Lipid Levels in Postmenopausal Korean Women Jee-Yeon Lee, Hye
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationAnti-Hyperglycemic Effect of a Kudzu (Pueraria lobata) Vine Extract in Ovariectomized Mice
J Nutr Sci Vitaminol, 62, 341 349, 2016 Anti-Hyperglycemic Effect of a Kudzu (Pueraria lobata) Vine Extract in Ovariectomized Mice Teruyoshi Tanaka, Yukihiro Yokota, Hanjun Tang, Nobuhiro Zaima, Tatsuya
More informationNAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
More informationEffects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver
Animal Industry Report AS 661 ASL R3006 2015 Effects of Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Sun Jin Hur Iowa State University
More informationDr. Jerry Shurson Department of Animal Science
Dr. Jerry Shurson Department of Animal Science University of Minnesota Pigs are what they eat Diet fatty acid (FA) composition affects FA profile in pork fat FA composition varies among adipose tissue
More informationConjugated Linoleic Acid Technical Document Feb Conjugated Linoleic Acid
Conjugated Linoleic Acid Technical Document Developed by INDI/SNIG for the Irish Sports Council 2014 Conjugated Linoleic Acid (CLA) Pubmed (Medline), SPORTDiscus and the Cochrane Library were searched
More informationSubject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119
Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationEffects of the Transition from Premenopause to Postmenopause on Lipids and Lipoproteins: Quantification and Related Parameters
ORIGINAL ARTICLE DOI: 10.3904/kjim.2011.26.1.47 Effects of the Transition from Premenopause to Postmenopause on Lipids and Lipoproteins: Quantification and Related Parameters Eun Jeung Cho 1, Yun Joo Min
More informationCharacteristics of Body Composition and Muscle Strength of North Korean Refugees during South Korean Stay
Original Article Endocrinol Metab 2015;30:551-556 http://dx.doi.org/10.3803/enm.2015.30.4.551 pissn 2093-596X eissn 2093-5978 Characteristics of Body Composition and Muscle Strength of North Korean Refugees
More informationWhat is Pandoradiet TM? Standardization of Pandoradiet TM. Safety of Pandoradiet TM. Efficacies of Pandoradiet TM
What is andoradiet TM? andoradiet TM is a proprietary extract powder of Boesenbergia pandurata, an edible plant with efficacies related to weight management and anti-skin aging. These effects have been
More informationANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease
ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol
More informationKazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA
Kazumi YAGASAKI, Masato NAGAOKA and Yutaka MIURA Division of Agriscience and Bioscience, Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology, Fuchu 183-8509 ABSTRACT
More informationThe effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses
The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses 18 June 2015 Doris Jacobs Unilever R&D Vlaardingen Background Elevated low-density lipoprotein-cholesterol
More informationRelationship between Abdominal Fat Area Measured by Screening Abdominal Fat CT and Metabolic Syndrome
Original Article pissn 1738-2637 / eissn 2288-2928 https://doi.org/10.3348/jksr.2017.77.1.1 Relationship between Abdominal Fat Area Measured by Screening Abdominal Fat CT and Metabolic Syndrome in Asymptomatic
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationCurriculum Vitae. Pusan National University Yangsan Hospital. Education: Premedicine Pusan National University
Curriculum Vitae Date: Dec. 2013 Sung-Gon Kim, M.D., Ph.D. Home Address: Samick-beach Apt. 202-1207 100, Gwanganhaebyeon-ro, Suyeong-gu Pusan 613-751 Korea Office Address: Department of Psychiatry Pusan
More informationDietary patterns of children and adolescents analyzed from 2001 Korea National Health and Nutrition Survey
Nutrition Research and Practice (2007), 2, 84-88 c2007 The Korean Nutrition Society and the Korean Society of Community Nutrition Dietary patterns of children and adolescents analyzed from 2001 Korea National
More informationNicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:
Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',
More informationNutrition Basics. Chapter McGraw-Hill Higher Education. All rights reserved.
Nutrition Basics Chapter 12 1 The Body s Nutritional Requirements Essential nutrients The Six Essential Nutrients: Proteins, Fats, Carbohydrates, Vitamins, Minerals, Water Defined as : Nutrients one must
More informationMetabolic changes in menopausal transition
Metabolic changes in menopausal transition Terhi T. Piltonen M.D., Associate Professor Consultant, Clinical Researcher for the Finnish Medical Foundation Department of Obstetrics and Gynecology PEDEGO
More informationNew Zealand Blackcurrant: A New Ergogenic Aid in Sport?
New Zealand Blackcurrant: A New Ergogenic Aid in Sport? Mark Willems Professor in Exercise Physiology United Kingdom Blackcurrant The Stress Hero Sponsored by Vilnius - June 10-12, 2015 Take home prediction
More informationWhat should I drink? Monica Esquivel ECHO Diabetes Learning Group December 6, 2017
What should I drink? Monica Esquivel ECHO Diabetes Learning Group December 6, 2017 Learning Objectives Describe relationship between added sugar and sugar sweetened beverages intake and health Differentiate
More informationObesity the global epidemic
Obesity the global epidemic Obesity the global epidemic 35% 35% 35% 34% 34% 33% 33% 33% 32% 43% Top 10 obese countries Smoking Obesity Alcohol Inf. Diseases Toxins Vehicle Collisions Firearms Death Sexual
More informationThe health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences
The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences What should we be promoting? Define health benefits in terms
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationFAT. Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology
FAT Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology OBJECTIVES LECTURE By the end of this lecture, student can: Define what is lipid/fat
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationOil Palm Phenolics and Diabetes: Lessons from the Nile Rat
Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Julia Bolsinger, Andrzej Pronczuk, Ravigadevi Sambanthamurthi, KC Hayes Hayes Laboratory and MPOB 5/21/213 The Nile grass rat (Arvicanthis niloticus)
More informationForebyggelse af metabolisk syndrom vha. mejeriprodukter
Forebyggelse af metabolisk syndrom vha. mejeriprodukter Kjeld Hermansen Medicinsk Endokrinologisk afd. MEA, Aarhus Universitetshospital Mejeriforskningens Dag 2. marts 2017, Hotel Legoland Metabolic Syndrome
More informationSun-Young Kang, Gyeong Eun Lim, Yang Keun Kim, Hye Won Kim, Kayoung Lee, Tae-Jin Park, Jinseung Kim
J Bone Metab 2017;24:9-14 https://doi.org/10.11005/jbm.2017.24.1.9 pissn 2287-6375 eissn 2287-7029 Original Article Association between Sarcopenic Obesity and Metabolic Syndrome in Postmenopausal Women:
More informationNutriSonic web expert system for meal management and nutrition counseling with nutrient time-series analysis, e-food exchange and easy data transition
Nutrition Research and Practice (2008), 2(2), 121-129 c2008 The Korean Nutrition Society and the Korean Society of Community Nutrition NutriSonic web expert system for meal management and nutrition counseling
More informationLipids. PBHL 211 Darine Hachem, MS, LD
Lipids PBHL 211 Darine Hachem, MS, LD Outline Functions of lipids in our body Types of lipids Sources of lipids Recommendation of fat intake Fat association with heart diseases Provide energy (9Kcal/g
More informationUnderstanding Cholesterol and Triglycerides
MINTO PREVENTION & REHABILITATION CENTRE CENTRE DE PREVENTION ET DE READAPTATION MINTO Understanding Cholesterol and Triglycerides About This Kit Along with cigarette smoking, high blood pressure, physical
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationThe effect of salt usage behavior on sodium intake and excretion among Korean women
Nutrition Research and Practice (Nutr Res Pract) 2012;6(3):232-237 http://dx.doi.org/10.4162/nrp.2012.6.3.232 pissn 1976-1457 eissn 2005-6168 The effect of salt usage behavior on sodium intake and excretion
More informationThe WorkCare Group, Inc. Content used with permission. StayWell is a registered trademark of The StayWell Company. All rights reserved.
Know Your Cholesterol Numbers Checklist for Lowering Your Cholesterol Cholesterol Questions to Ask Your Doctor Misconceptions about Cholesterol LDL and HDL Lowering Your Cholesterol CHECKLIST Cut down
More informationMETABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationThe Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies. By Logan Jenney & Lindsey Poynter
The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies By Logan Jenney & Lindsey Poynter Abstract: Chocolate chip cookies are a popular baked good loved by consumers for several years
More informationSunflower vs Canola oil modulation of metabolic traits and tumor development in the South African rat dietary model of Breast Cancer.
Sunflower vs Canola oil modulation of metabolic traits and tumor development in the South African rat dietary model of Breast Cancer. Dr Annadie Krygsman and Dr Anneke Brand Background After cervical cancer,
More informationTable S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
More informationHeart Disease Genesis
Heart Disease Genesis The Ultimate Lecture on CAD origins Petr Polasek MD FRCPC FACC Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored,
More informationOptimization of a green method for the recovery of polyphenols from onion solid wastes
Department of Food Science and Technology, Faculty of Agriculture, Aristotle University of Thessaloniki, Greece 5th International Conference on Sustainable Solid Waste Management, Athens, 21 24 June 2017
More informationNaohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT
Naohito AOKI, Erina ARAKAWA and Miyuki ITO Department of Life Science, Graduate School of Bioresources, Mie University Tsu 514-857 ABSTRACT C57BL/6J mice (male, 4wk old) were fed low fat diet (LF), high
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More informationThe effect of stair-ascent activity exercise on body fat and muscle mass in university students.
Biomedical Research 2018; 29 (18): 3492-3496 ISSN 0970-938X www.biomedres.info The effect of stair-ascent activity exercise on body fat and muscle mass in university students. Myung-Nam Lee, Min-Kyung
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationA study on nutrition knowledge and dietary behavior of elementary school children in Seoul
Nutrition Research and Practice (2008), 2(4), 308-316 c2008 The Korean Nutrition Society and the Korean Society of Community Nutrition A study on nutrition knowledge and dietary behavior of elementary
More informationInsulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus Patients
Review Article Endocrinol Metab 2016;31:354-360 http://dx.doi.org/10.3803/enm.2016.31.3.354 pissn 2093-596X eissn 2093-5978 Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More informationFree Fatty Acid Assay Kit
Free Fatty Acid Assay Kit Catalog Number KA1667 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationCOMBAT SYNDROME X, Y, AND Z, THE UNIFYING DISEASE CONCEPT OF THE METABOLIC SYNDROME AND THEIR MANAGEMENT
COMBAT SYNDROME X, Y, AND Z, THE UNIFYING DISEASE CONCEPT OF THE METABOLIC SYNDROME AND THEIR MANAGEMENT Stephen Holt M.D., LLD(Hon), MRCP(UK), FRCP(C), FACG, FACP, FACN, FACAM SUPER-SIZING AMERICA Americans
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationHypocholesterolemic Effect of Ginkgo Biloba Seeds Extract from High Fat Diet Mice
Biomedical Science Letters 2017, 23(2): 138~143 http://dx.doi.org/10.15616/bsl.2017.23.2.138 eissn : 2288-7415 Brief Communication Hypocholesterolemic Effect of Ginkgo Biloba Seeds Extract from High Fat
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationReplacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationMaintain Cholesterol
Maintain Cholesterol What is Cholesterol? Cholesterol is a Lipid Molecule that has a waxy appearance and is found in every cell of the body and has some important natural functions. It is manufactured
More informationKathryn M. Rexrode, MD, MPH. Assistant Professor. Division of Preventive Medicine Brigham and Women s s Hospital Harvard Medical School
Update: Hormones and Cardiovascular Disease in Women Kathryn M. Rexrode, MD, MPH Assistant Professor Division of Preventive Medicine Brigham and Women s s Hospital Harvard Medical School Overview Review
More informationEstimated dietary isoflavone intake among Korean adults*
Nutrition Research and Practice (2007), 1(3), 206-211 c2007 The Korean Nutrition Society and the Korean Society of Community Nutrition Estimated dietary isoflavone among Korean adults* Min-June Lee 1 and
More informationTHE SAME EFFECT WAS NOT FOUND WITH SPIRITS 3-5 DRINKS OF SPIRITS PER DAY WAS ASSOCIATED WITH INCREASED MORTALITY
ALCOHOL NEGATIVE CORRELATION BETWEEN 1-2 DRINKS PER DAY AND THE INCIDENCE OF CARDIOVASCULAR DISEASE SOME HAVE SHOWN THAT EVEN 3-4 DRINKS PER DAY CAN BE BENEFICIAL - WHILE OTHERS HAVE FOUND IT TO BE HARMFUL
More informationThe Effects of Raspberry Ketone Supplementation on Body Composition. Angelo Pagani and Dr. John Thistlethwaite.
The Effects of Raspberry Ketone Supplementation on Body Composition Angelo Pagani and Dr. John Thistlethwaite. Ohio Dominican University, Columbus, OH. Abstract Raspberry ketones have recently been linked
More informationEffects of corn gluten hydrolyzates, branched chain amino acids, and leucine on body weight reduction in obese rats induced by a high fat diet
Nutrition Research and Practice (Nutr Res Pract) 2010;4(2):106-113 DOI: 10.4162/nrp.2010.4.2.106 Effects of corn gluten hydrolyzates, branched chain amino acids, and leucine on body weight reduction in
More information결핵성경부림프절염의항결핵제치료기간에관한연구 : 6 개월과 12 개월요법의무작위임상대조연구
KISEP Head and Neck Korean J Otolaryngol 2004;47:258-62 결핵성경부림프절염의항결핵제치료기간에관한연구 : 6 개월과 12 개월요법의무작위임상대조연구 고려대학교의과대학이비인후 - 두경부외과학교실, 1 내과학교실, 2 예방의학교실 3 임기정 1 권윤환 1 백승국 1 우정수 1 권순영 1 정광윤 1 박대원 2 손장욱 2 김민자
More informationMisperceptions still exist that cardiovascular disease is not a real problem for women.
Management of Cardiovascular Risk Factors in the Cynthia A., MD University of California, San Diego ARHP 9/19/08 Disclosures Research support Wyeth, Lilly, Organon, Novo Nordisk, Pfizer Consultant fees
More informationDietary fat supplies essential body tissue needs, both as an energy fuel and a structural material.
Chapter 3 Fats Chapter 3 Lesson 3.1 Key Concepts Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Foods from animal and plant sources supply distinct
More informationOriginal Article Association of obesity with serum estrogen level in postmenopausal women
Bangladesh Med J. 216 May; 45 (2) Original Article Association of obesity with serum estrogen level in Yeasmin N 1, Hossain MJ 2, Hossain I 3, Akhter QS 4 Abstract: Incidence of obesity among is increasing
More information