New Drug Development for Hepatic Insulin Resistance

Size: px
Start display at page:

Download "New Drug Development for Hepatic Insulin Resistance"

Transcription

1 New Drug Development for Hepatic Insulin Resistance Innovative Drug Research Center for Metabolic and Inflammatory Disease College of Pharmacy Sang Geon Kim

2 AMPK as an energy sensor, (A novel drug target for metabolic disease) [AMP] /[ATP] Upstream kinase AMPK Energy demand e.g.switch off fatty acid synthesis Energy supply e.g.switch on fatty acid oxidation Fatty acid synthesis Cholesterol synthesis Energy expenditure Energy intake Liver

3 Upstream signals of AMPK activation PKCζ SIRT1 TAK1 Ca ++ LKB1 CaMKK [AMP]:[ATP] Stress (ROS) AMPK Activation

4 LKB1-independent AMPK activation

5 LKB1-independent AMPK activation A Oltipraz B [AMP]:[ATP] LKB1 AMPK distinct pathway CaMKK Stress (ROS) Bae et al., Hepatology, 2007 Oltipraz activates AMPK through a distinct pathway independent of LKB1 or CaMKK. Not a direct AMPK activator.

6 AMPK activation by oltipraz leads to S6K1 inhibition. A) B) AMPK S6K C) Insulin Resistance (Bae et al., Hepatology, 2006)

7 Inhibition of S6K1 by Oltipraz A) B) (Bae et al., Hepatology, 2006)

8 Inhibition of insulin signaling by S6K1 (Um et al., Nature., 2004)

9 S6K1 inhibition by oltipraz enhances insulin signaling. A) B) (Bae et al., Hepatology, 2006)

10 Inhibition of IRS Ser-307 phosphorylation by oltipraz (Bae et al., Hepatology, 2006)

11 Inhibition of LXRα-SREBP-1c Pathway by AMPK-activating Candidates? Bae et al., Hepatology (2007) Oltipraz DTTs AMPK S6K1 Insulin Resistance closely linked Hepatic lipogenesis through LXRα-SREBP-1c pathway FATTY LIVER

12 LXR-dependent Lipogenic Gene Induction T Insulin Lipogenic gene transactivation (FAS, ACC, SCD-1) Cytosol Endogenous LXR ligand Nuclear translocation LXR RXR Target gene transactivation SREBP-1c expression (tethered in ER membrane) LXRE (e.g. SREBP-1c) Nucleus

13 Opposite Regulation of LXRα Activity by AMPK and S6K1 AMPK S6K1 LXRα SREBP-1c pathway

14 Inhibition of SREBP-1c Expression and Activation by Oltipraz (Hwahng et al., Hepatology, 2009)

15 Attenuation of SREBP-1c Target Gene Expression by Oltipraz SRE-containing FAS promoter SREBP-1c target gene FAS, ACC, SCD-1 (Hwahng et al., Hepatology, 2009)

16 Oltipraz AMPK S6K1 SREBP-1c Lipogenic Enzymes FAS ACC SCD-1

17 Repression of SREBP-1c by S6K1 Inhibition (Hwahng et al., Hepatology, 2009)

18 Role of AMPK in Inhibition of T090-stimulated SREBP-1c Induction (Hwahng et al., Hepatology, 2009)

19 Oltipraz? AMPK S6K1 LXRα SREBP-1c Lipogenic Enzymes FAS ACC SCD-1

20 Suppression of LXRα Activity by Oltipraz LXRE-containing reporter gene (Hwahng et al., Hepatology, 2009)

21 Direct Phosphorylations of LXRα by S6K1 and AMPK (Hwahng et al., Hepatology, 2009)

22 The Opposing Action of S6K1 and AMPK on LXRα Activity (Hwahng et al., Hepatology, 2009)

23 In case of LXR activation AMPK Inactive Thr p TSC2 LXR activity S6K1 Active Ser p

24 In case of LXR inhibition AMPK Inactive Thr p TSC2 LXR activity S6K1 Active Ser p

25 A summary on the LXRα SREBP-1c regulation Oltipraz DTTs AMPK Inactive Thr p TSC2 LXR activation Binding to LXRE SREBP-1c S6K1 Active Ser p FAS ACC SCD-1 Hepatic lipogenesis

26 In vivo Anti-steatotic Effect C57BL/6 mice (Hwahng et al., Hepatology, 2009)

27 Dithiolethiones C/EBPβ P RSK Drug Targets HIF-1α Degradation Insulin IR C/EBPβ TSC1/2 mtor- RAPTOR AMPK IRS1 PI3K Akt insulin resistance p70s6k1 Activating Phosphorylation Inhibitory Phosphorylation Nucleus ps pt LXR LXRE RXR SREBP-1c FAS, ACC, SCD-1 S6K1: insulin resistance, lipogenesis AMPK: insulin resistance, lipogenesis

28 IX. OVERALL SCHEME OF OLIPRAZ DEVELOPMENT Process development for large-scale production Set up specification & test method (raw material) Stability study (raw material) Preliminary Clinical Clinical marker setup Clinical trial protocol preparation Synthesis Mechanism study Prof. S.G. Kim Seoul National Univ. Efficacy Ph Phas Phas Toxicity Study IND ase e e I II III NDA PK Formulation Launch Preformulation study Formulation study PK study Prof. M.G. Lee Seoul National Univ. National Cancer Center (J.W. Park, M.D.) Samsung Medical Center (G.C. Koh, M.D.) Korea Cancer Center Hospital (C.J. Han, M.D.) Set up specification & test method (finished product) Stability study (finished product) 1st Year 2 nd Year 3 rd Year 4 th Year Launching ( 02) ( 03) ( 04) ( 05) ( 06)

29 Pharmacokinetic profiles of oltipraz in cirrhotic patients (Patients safety verified) 경구투여 (Parent) 경구투여 (Metabolite) Kim YM et al., Clin Pharmacol Ther. (2010)

30 LKB1-dependent AMPK activation

31 Sauchinone (Sau) A lignan in Saururus chinensis - frequently used medicinal plants - treat fever, jaundice, and inflammation. Anti-inflammation: Inhibits inos, COX-2 and TNF-α induction in macrophages. Br J Pharmacol, Lee et al., 2003 삼백초 ( 三白草 ) Liver protection: Attenuates liver toxicity in primary hepatocytes. Biol Pharm Bull, Sung et al., 2000 Sauchinone

32 AMPK activation by Sau Kim YW et al., FRBM (2009)

33 LKB1-dependent AMPK activation by Sau Kim YW et al., FRBM (2009)

34 Improvement of insulin sensitivity Kim YW et al., FRBM (2010)

35 Inhibition of LXRα activity by Sau Kim YW et al., FRBM (2010)

36 SREBP-1c repression by Sau Kim YW et al., FRBM (2010)

37 Inhibition of SREBP-1c target gene Kim YW et al., FRBM (2010)

38 Inhibition of lipogenesis in mice fed HFD Kim YW et al., FRBM (2010)

39 Sau treats LXRα-dependent lipogenesis by activating AMPK. Sau LKB1 AMPK S6K1 FATTY LIVER Hepatic lipogenesis through LXRα-SREBP-1c pathway

40 LKB1-dependent AMPK activation by resveratrol Resveratrol PAR LKB1 p-ampk Drug action Shin SM et al., Mol Pharm (2009)

41 Pharmacological modulations of AMPK activity AMPK Kim SG et al., Handbook of Type I DM (2009)

42 Cytoprotective, antioxidant, & mitochondrial protective effects of AMPK-activators

43 Inhibition of HFD-induced liver injury Kim YW et al., FRBM (2010)

44 Inhibition of HFD-induced oxidative stress Kim YW et al., FRBM (2010)

45 Mitochondrial permeability transition pore OMM VDAC Oxidative stress OMM VDAC IMM IMS Matrix PTP CypD ANT IMM IMS Matrix PTP CypD ANT (Miura and Miki, Circ J., 2009) Non-selective large conductance channel in the mitochondrial inner membrane ANT, CypD and VDAC regulatory factors Opening of mptp causes MMP transition and cytochrome c release apoptosis.

46 1) Mitochondrial protective; 2) H 2 O 2 scavenging effect A) B)

47 Mitochondrial protective and H 2 O 2 scavenging effects of Sau

48 Mitochondrial protective and H 2 O 2 scavenging effects of Res A) B)

49 Mitochondrial protective and H 2 O 2 scavenging effects of ILQ

50 AMPK and GSK3β AMPK GSK3β P AMPK activators p-gsk3β Mitochondrial protection

51 Increase in GSK3β phosphorylation by ILQ

52 Effect of GSK3β inhibition on mitochondrial protection GSK3β GSK3β P VDAC P ANT-CypD binding mptp opening Mitochondrial Membrane Permeability

53 AMPK activation alone by metformin is not sufficient to protect cells from severe oxidative stress!!! Kim YW et al., FRBM (2010) (Unpublished data) B) DCFH-DA No H 2 O 2 scavenging effect (Unpublished data)

54 Down-stream functions of AMPK AMPK Kim SG et al., Handbook of Type I DM (2009)

55 Clinical & Instestigational AMPK activators Kim SG et al., Handbook of Type I DM (2009)

56 Clinical & Instestigational AMPK activators (continued) Kim SG et al., Handbook of Type I DM (2009)

57 Collaborations Prof. Myung Gull Lee, Ph. D. (Seoul National Univ.) Prof. Chang Ho Lee, Ph.D. (Hanyang Univ.) Prof. Keon Wook Kang, Ph.D. (Chosun Unvi.) Prof. Min Kyung Cho, Ph. D. (Dongguk Univ.) Prof. Yoon Gyoon Kim, Ph. D. (DanKook Univ.) Prof. Seung Jin Lee, Ph. D. (Asan Hosp.) Prof. Soo Kyung Bae, Ph. D. (Inje Univ.) Prof. Il Je Cho, Ph. D. (Daegu Haany Univ.) Acknowledgements Ph.D. Students Won Dong Kim Young Woo Kim Young Mi Kim Woo Hyung Lee Yoon-Mee Yang Chang Yup Han Tae Hyun Kim Hee Yeon Kay M.S. Students Chan Gyu Lee Kyoung Noh Seul Ki Kang Jung Min Lee Hong Min Wu So Yeon Seo A-young Kim Ja Hyun Koo Jeong Sik Eom Ju Yeon Cho

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

SERUM CYSTATIN C CONCENTRATION IS A POWERFUL PROGNOSTIC INDICATOR IN PATIENTS WITH CIRRHOTIC ASCITES

SERUM CYSTATIN C CONCENTRATION IS A POWERFUL PROGNOSTIC INDICATOR IN PATIENTS WITH CIRRHOTIC ASCITES SERUM CYSTATIN C CONCENTRATION IS A POWERFUL PROGNOSTIC INDICATOR IN PATIENTS WITH CIRRHOTIC ASCITES YEON SEOK SEO, 1 SOO YOUNG PARK, 2 MOON YOUNG KIM, 3 SANG GYUNE KIM, 4 JUN YONG PARK, 5 HYUNG JOON YIM,

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging

In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging Won Kim, Jung-Hwan Yoon*, Gi Jeong Cheon, Tae Sup Lee, Chung Yong Kim Department

More information

Incidence and Predictors of Stent Thrombosis after Percutaneous Coronary Intervention in Acute Myocardial Infarction

Incidence and Predictors of Stent Thrombosis after Percutaneous Coronary Intervention in Acute Myocardial Infarction Incidence and Predictors of Stent Thrombosis after Percutaneous Coronary Intervention in Acute Myocardial Infarction Sungmin Lim, Yoon Seok Koh, Hee Yeol Kim, Ik Jun Choi, Eun Ho Choo, Jin Jin Kim, Mineok

More information

Curriculum Vitae. Dissertation Title M.S. Thesis: Regulation of Notch1 signaling by Runx2 during osteoblast differentiation.

Curriculum Vitae. Dissertation Title M.S. Thesis: Regulation of Notch1 signaling by Runx2 during osteoblast differentiation. Curriculum Vitae Name: Eun-Jung Ann Education Mar.2009 : Ph.D. in Graduate School of Biological Sciences and Technology, Chonnam National University Mar.2007 Feb. 2009: M.S. in Graduate School of Biological

More information

Curriculum Vitae (Last updated: ) Jin-Gu Lee, PhD

Curriculum Vitae (Last updated: ) Jin-Gu Lee, PhD Curriculum Vitae (Last updated: 2016-06-22) Jin-Gu Lee, PhD Laboratory of Molecular Biology NIDDK, National Institutes of Health Building 5, Rm 433 5 Memorial Drive Bethesda, MD 20892 EDUCATION 2004. 3.

More information

2017 Obesity Fact Sheet

2017 Obesity Fact Sheet 2017 Fact Sheet Welcome message 2017 Fact Sheet Dear Colleagues, It is my great honor and pleasure to publish the 2017 Fact Sheet of the Korean Society for the Study of (KSSO). The 2017 Fact Sheet is the

More information

Reperfusion Injury: How Can We Reduce It?

Reperfusion Injury: How Can We Reduce It? MI/CAD: Practical Question in Management of AMI Patients Reperfusion Injury: How Can We Reduce It? Hyun-Jai Cho, M.D., Ph.D Cardiovascular Center & Department of Internal Medicine Seoul National University

More information

Optimal Duration of Clopidogrel Therapy with DES to Reduce Late Coronary Arterial Thrombotic Event. The DES LATE Trial

Optimal Duration of Clopidogrel Therapy with DES to Reduce Late Coronary Arterial Thrombotic Event. The DES LATE Trial Optimal Duration of Clopidogrel Therapy with DES to Reduce Late Coronary Arterial Thrombotic Event The DES LATE Trial Cheol Whan Lee, MD, Seung-Jung Park, MD, PhD, On Behalf of the DES LATE Investigators

More information

Insulin resistance and altered insulin metabolism are involved

Insulin resistance and altered insulin metabolism are involved Identification of a Novel Class of Dithiolethiones That Prevent Hepatic Insulin Resistance via the Adenosine Monophosphate Activated Protein Kinase p70 Ribosomal S6 Kinase-1 Pathway Eun Ju Bae, 1 Yoon

More information

Korean Multicenter Cohort Study of Acute-on- Chronic Liver Failure : Korean Acute-on-Chronic Liver Failure Study (KACLiF)

Korean Multicenter Cohort Study of Acute-on- Chronic Liver Failure : Korean Acute-on-Chronic Liver Failure Study (KACLiF) 2015 KASL Single Topic Symposium Korean Multicenter Cohort Study of Acute-on- Chronic Liver Failure : Korean Acute-on-Chronic Liver Failure Study (KACLiF) Do Seon Song Department of Internal Medicine,

More information

Hepatitis C Virus and Cytokine Responses

Hepatitis C Virus and Cytokine Responses Hepatitis C Virus and Cytokine Responses Eui-Cheol Shin, M.D., Ph.D. Laboratory of Immunology & Infectious Diseases (LIID), Graduate School of Medical Science & Engineering (GSMSE), KAIST Daejeon, Korea

More information

AMPK. Tomáš Kučera.

AMPK. Tomáš Kučera. AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol

More information

AOSpine Principles Symposium Daegu

AOSpine Principles Symposium Daegu KOREA Course program AOSpine Principles Symposium Daegu March 5, 2016 Daegu, South Korea AOSpine the leading global academic community for innovative education and research in spine care, inspiring lifelong

More information

Quality of life (QoL) in metastatic breast cancer patients with. maintenance paclitaxel plus gemcitabine (PG) chemotherapy:

Quality of life (QoL) in metastatic breast cancer patients with. maintenance paclitaxel plus gemcitabine (PG) chemotherapy: Quality of life (QoL) in metastatic breast cancer patients with maintenance paclitaxel plus gemcitabine (PG) chemotherapy: results from phase III, multicenter, randomized trial of maintenance chemotherapy

More information

The 12 th Japan-Korea Diabetic Nephropathy Seminar

The 12 th Japan-Korea Diabetic Nephropathy Seminar FINAL REPORT For Japan-Korea Joint Seminar AREA 1. Humanities and Social Sciences 2. Science/Engineering(Excluding Biology and Medicine) 3. Biology/Medicine 4. Interdisciplinary Study 1. Title of Seminar:

More information

The metabolic syndrome is defined as a constellation

The metabolic syndrome is defined as a constellation Role of Adenosine Monophosphate-Activated Protein Kinase p70 Ribosomal S6 Kinase-1 Pathway in Repression of Liver X Receptor-Alpha Dependent Lipogenic Gene Induction and Hepatic Steatosis by a Novel Class

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

AOTrauma Symposium Foot and Ankle

AOTrauma Symposium Foot and Ankle Course program AOTrauma Symposium Foot and Ankle Mar 31-Apr 1, 2017, Gwangju, Korea Home to Trauma & Orthopedics Value statement AOTrauma is committed to improve patient care outcomes through the highest

More information

Changes in the seroprevalence of IgG anti-hepatitis A virus between 2001 and 2013: experience at a single center in Korea

Changes in the seroprevalence of IgG anti-hepatitis A virus between 2001 and 2013: experience at a single center in Korea pissn 2287-2728 eissn 2287-285X Original Article Clinical and Molecular Hepatology 214;2:162-167 Changes in the seroprevalence of IgG anti-hepatitis A virus between 21 and 213: experience at a single center

More information

Result of screening and surveillance colonoscopy in young Korean adults < 50 years

Result of screening and surveillance colonoscopy in young Korean adults < 50 years SEP 25, 2017 Result of screening and surveillance colonoscopy in young Korean adults < 50 years Jae Myung Cha, MD. PhD. Department of Internal Medicine, Kyung Hee University Hospital at Gang Dong, Kyung

More information

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia

More information

Seung-Woon Rha, MD, PhD FACC, FAHA, FESC, FSCAI, FAPSIC. Cardiovascular Center, Korea University Guro Hospital, Seoul, Korea.

Seung-Woon Rha, MD, PhD FACC, FAHA, FESC, FSCAI, FAPSIC. Cardiovascular Center, Korea University Guro Hospital, Seoul, Korea. Controversies in Acute Myocardial Infarction - Is Early Statin Therapy is Beneficial in all Patients?- : Insights from Korea Acute Myocardial Infarction Registry (KAMIR) Seung-Woon Rha, MD, PhD FACC, FAHA,

More information

Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging

Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging Dr. S. Buchwald-Werner 6. May 2015 Vitafoods Europe Conference Healthy Aging Session Consumer demand for healthy-aging

More information

CURRICULUM VITAE PERSONAL INFORMATION EDUCATION AND TRAINING. Degree Field of Study Institution Years

CURRICULUM VITAE PERSONAL INFORMATION EDUCATION AND TRAINING. Degree Field of Study Institution Years CURRICULUM VITAE PERSONAL INFORMATION Name: Jung Sun Lee Business Address: University of Ulsan College of Medicine Asan Medical Center 388-1 Pungnap-dong, Songpa-gu Seoul, Republic of Korea Zip code: 138-736

More information

Hyun Kee Kim, M.S. Curriculum Vitae

Hyun Kee Kim, M.S. Curriculum Vitae Hyun Kee Kim, M.S. Curriculum Vitae August, 2012 Ⅰ. Personal Information Address - Office. Researcher Molecular Genetic Laboratory, Research Institute of Medical Science, College of Medicine, The Catholic

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic

More information

EGIS BILIARY STENT. 1. Features & Benefits 2. Ordering information 3. References

EGIS BILIARY STENT. 1. Features & Benefits 2. Ordering information 3. References EGIS BILIARY STENT 1. Features & Benefits 2. Ordering information 3. References 1. Features & Benefits (1) Features Superior flexibility & conformability 4 Types Single bare, Single cover, Double bare,

More information

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment Supplementary Data for Kang et al. (Title) Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells by Regulating the Interaction of Tumor with its Immune Microenvironment Tae-Wook Kang 1,3,,

More information

Nam Cheol Park Sae Woong Kim Du Geon Moon Editors. Penile Augmentation

Nam Cheol Park Sae Woong Kim Du Geon Moon Editors. Penile Augmentation Penile Augmentation Nam Cheol Park Sae Woong Kim Du Geon Moon Editors Penile Augmentation Editors Nam Cheol Park Pusan National University Hospital Busan South Korea Du Geon Moon Korea University Guro

More information

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards

More information

Antithrombotic Therapy in Patients with Atrial Fibrillation

Antithrombotic Therapy in Patients with Atrial Fibrillation Antithrombotic Therapy in Patients with Atrial Fibrillation June Soo Kim, M.D., Ph.D. Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine

More information

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride

More information

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Trial of Everolimus-Eluting Stents or Bypass Surgery for Coronary Disease (BEST Trial)

Trial of Everolimus-Eluting Stents or Bypass Surgery for Coronary Disease (BEST Trial) Trial of Everolimus-Eluting Stents or Bypass Surgery for Coronary Disease (BEST Trial) Seung-Jung Park, MD, PhD On behalf of the BEST investigators Professor of Medicine, University of Ulsan College of

More information

임시형심박조율기없이시행한경피적우관동맥중재술의 안전성 : 전향적연구

임시형심박조율기없이시행한경피적우관동맥중재술의 안전성 : 전향적연구 Original Articles Korean Circulation J 1999;2911:1182-1187 임시형심박조율기없이시행한경피적우관동맥중재술의 안전성 : 전향적연구 이성윤 권현철 김현중 정진옥 안경주 이상철 조욱현 박승우김준수 김덕경 이상훈 홍경표 박정의 서정돈 이원로 Safety of Percutaneous Right Coronary Intervention

More information

KAHBPS-O-PL-01 KAHBPS-O-PL-02

KAHBPS-O-PL-01 KAHBPS-O-PL-02 KAHBPS-O-PL-01 Proposal of future remnant liver-indocyanine green clearance rate for risk assessment of major hepatectomy - What is its cutoff? Department of Surgery, Asan Medical Center, University of

More information

KHUPO 9 TH ANNUAL INTERNATIONAL PROTEOMICS CONFERENCE

KHUPO 9 TH ANNUAL INTERNATIONAL PROTEOMICS CONFERENCE FIRST CIRCULAR, JAN 14 TH 2009 KHUPO 9 TH ANNUAL INTERNATIONAL PROTEOMICS CONFERENCE MAR 25-27 TH, 2009 UNIVERSITY CULTURAL CENTER, SEOUL NATIONAL UNIVERSITY, SEOUL, KOREA THEME: PROTEOMICS: FROM DISCOVERY

More information

A Study on Reducing Stress through Deep Breathing

A Study on Reducing Stress through Deep Breathing A Study on Reducing Stress through Deep Breathing Bong-Young Kim 1 1 Information and Telecommunication of Department, Soongsil University, Seoul, Korea. 369, Sangdo-ro Dongjak-gu, Seou Myung-Jin Bae *2

More information

CURRICULUM VITAE. March February 1994: B.S. degree, Dept. of Genetic Engineering, Kyungpook National University, Daegu, Korea

CURRICULUM VITAE. March February 1994: B.S. degree, Dept. of Genetic Engineering, Kyungpook National University, Daegu, Korea CURRICULUM VITAE PERSONAL DATA: NAME: ADDRESS: Tae Woo Kim Lab. Of Infection and Immunology, Graduate School of medicine, Korea University, 516 Gojan-1 Dong, Ansan-Si, Gyeonggi-Do 425-707, South Korea.

More information

Differences in Clinical Outcomes Between Patients With ST-Elevation Versus Non-ST-Elevation Acute Myocardial Infarction in Korea

Differences in Clinical Outcomes Between Patients With ST-Elevation Versus Non-ST-Elevation Acute Myocardial Infarction in Korea REVIEW DOI 10.4070 / kcj.2009.39.8.297 Print ISSN 1738-5520 / On-line ISSN 1738-5555 Copyright c 2009 The Korean Society of Cardiology Differences in Clinical Outcomes Between Patients With ST-Elevation

More information

Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis

Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Supplementary Material Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Kwangwoo Kim 1,, So-Young Bang 1,, Katsunori Ikari 2,3, Dae

More information

Global Breast Cancer Conference 2019 (GBCC 2019) with Annual Meeting of Korean Breast Cancer Society (KBCS)

Global Breast Cancer Conference 2019 (GBCC 2019) with Annual Meeting of Korean Breast Cancer Society (KBCS) It is our great honor to invite you to the Global Breast Cancer Conference 2019 (GBCC 2019), which will be held at Songdo ConvensiA in Incheon, Korea, from April 25 (Thu) to 27 (Sat), 2019. Hosted by the

More information

Seung Hyeok Han, MD, PhD Department of Internal Medicine Yonsei University College of Medicine

Seung Hyeok Han, MD, PhD Department of Internal Medicine Yonsei University College of Medicine Seung Hyeok Han, MD, PhD Department of Internal Medicine Yonsei University College of Medicine The Scope of Optimal BP BP Reduction CV outcomes & mortality CKD progression - Albuminuria - egfr decline

More information

Cross-regulation of host STATs for the survival of Toxoplasma gondii

Cross-regulation of host STATs for the survival of Toxoplasma gondii JITMM2010&IMC2010, 1-3 December 2010 Cross-regulation of host STATs for the survival of Toxoplasma gondii Ho-Woo Nam 1, Dong-Soo Kim 2, Sung-Jong Hong 3 Department of arasitology, College of Medicine,

More information

Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors

Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The

More information

Clinical Role of Inflammation in Metabolic Diseases

Clinical Role of Inflammation in Metabolic Diseases Clinical Role of Inflammation in Metabolic Diseases Won-Young Lee Department of Endocrinology and Metabolism Kangbuk Samsung Hospital Sungkyunkwan University Medical School, Seoul, Korea (2009-Nov-19)

More information

Ph.D. in Electrical Engineering (Academic Advisor: Yang-Kyu Choi) Mar Feb. 2020

Ph.D. in Electrical Engineering (Academic Advisor: Yang-Kyu Choi) Mar Feb. 2020 박준영 (Jun-Young Park) National NanoFab Center 524, 291 Daehak-ro, Yuseong-Gu, Daejeon, Korea 34141 TEL: +82-42-350-5477 Mobile: +82-10-6242-6314 E-mail: jypark@nobelab.kaist.ac.kr EDUCATION B.S. in Electrical

More information

Mountain Ginseng Pharmacopuncture Treatment on Three Amyotrophic Lateral Sclerosis Patients -Case Report-

Mountain Ginseng Pharmacopuncture Treatment on Three Amyotrophic Lateral Sclerosis Patients -Case Report- 3 119 DOI : 10.3831/KPI.2010.13.4.119 3 Received : 10. 11. 06 Revised : 10. 11. 18 Accepted : 10. 11. 26 Key Words: Mountain Ginseng Pharmacopuncture(MG P), Amyotrophic Lateral Sclerosis(ALS), Amyotrophic

More information

CURRICULUM VITAE. Bong Sook Jhun, Ph.D. DEGREE/YR/SUBJECT

CURRICULUM VITAE. Bong Sook Jhun, Ph.D. DEGREE/YR/SUBJECT CURRICULUM VITAE Bong Sook Jhun, Ph.D. EDUCATION AND TRAINING UNDERGRADUATE SCHOOL DATES MONTH/YEAR DEGREE/YR/SUBJECT Kyung Hee University 03/1995 02/1999 BS, 1999, Chemistry GRADUATE SCHOOL Kyung Hee

More information

Chapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance

Chapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance Chapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance Mengwei Zang Abstract Humans with obesity and type 2 diabetes exhibit the classic triad of hyperinsulinemia, hyperglycemia,

More information

The Research of Early Child Scientific Activity according to the Strength Intelligence

The Research of Early Child Scientific Activity according to the Strength Intelligence , pp.162-166 http://dx.doi.org/10.14257/astl.2016. The Research of Early Child Scientific Activity according to the Strength Intelligence Eun-gyung Yun 1, Sang-hee Park 2 1 Dept. of Early Child Education,

More information

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux

More information

Reactive oxygen species: Importance for ischemia/reperfusion (injury)

Reactive oxygen species: Importance for ischemia/reperfusion (injury) Physiologisches Institut Reactive oxygen species: Importance for ischemia/reperfusion (injury) Prof. Dr. Rainer Schulz Reactive oxygen species (ROS) in ischemia/reperfusion injury (IRI) ROS GOOD: Endogenous

More information

Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining

Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining Original Article Healthc Inform Res. 2010 June;16(2):77-81. pissn 2093-3681 eissn 2093-369X Diagnostic Analysis of Patients with Essential Hypertension Using Association Rule Mining A Mi Shin, RN, MS 1,

More information

면역유전자치료법개발 : 면역결핍환자들에서발병하는바이러스질환과종양의치료를위해 CTLs를이용한세포성면역치료법과수지상세포를이용한종양백신의개발하고, 면역치료의연구자임상을수행하고있음.

면역유전자치료법개발 : 면역결핍환자들에서발병하는바이러스질환과종양의치료를위해 CTLs를이용한세포성면역치료법과수지상세포를이용한종양백신의개발하고, 면역치료의연구자임상을수행하고있음. 약력 1. 인적사항 작성 : 2010 년 4 월 성명김태규 ( 金泰圭, Tai-Gyu Kim ) 주민등록번호 581009-1052919 소속기관가톨릭대학교의과대학미생물학교실직위교수 전화 02-590-1216 이동통신 010-9816-1216 연락처 팩스 02-594-7355 전자메일 kimtg@catholic.ac.kr 직장주소서울특별시서초구반포동 505 (

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-18-095 Title: Insulin Receptor Substrate 2:A Bridge between Hippo and AKT Pathways Article Type: Perspective (Invited Only) Keywords:

More information

Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative

Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative Supplementary Information Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative in a preclinical model of bladder pain syndrome Aram Kim 1,11,, Hwan Yeul Yu 1,2,, Jisun

More information

NEW SUBTRACTION ALGORITHMS FOR EVALUATION OF BREAST LESIONS ON DYNAMIC CONTRAST ENHANCED MR MAMMOGRAPHY

NEW SUBTRACTION ALGORITHMS FOR EVALUATION OF BREAST LESIONS ON DYNAMIC CONTRAST ENHANCED MR MAMMOGRAPHY A-056 NEW SUBTRACTION ALGORITHMS FOR EVALUATION OF BREAST LESIONS ON DYNAMIC CONTRAST ENHANCED MR MAMMOGRAPHY So Hee Cho, M.D., Byung Gil Choi, M.D., Hak Hee Kim, M.D., Euy Neyng Kim, M.D., Bum-soo Kim,

More information

Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin. Phosphorylation

Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin. Phosphorylation Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin Phosphorylation Choon-Soo Lee, PhD, 1,2,4 * Yun Gi Kim, MD, 3 * Hyun-Jai Cho, MD, 1,2,3 Jonghanne Park, MD, 1,2,3

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

NASH Bench to Bedside

NASH Bench to Bedside NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent

More information

Child-Pugh Score Is an Independent Risk Factor for Immediate Bleeding after Colonoscopic Polypectomy in Patients with Liver Cirrhosis

Child-Pugh Score Is an Independent Risk Factor for Immediate Bleeding after Colonoscopic Polypectomy in Patients with Liver Cirrhosis LGI-1 Child-Pugh Score Is an Independent Risk Factor for Immediate Bleeding after Colonoscopic Polypectomy in Patients with Liver Cirrhosis Sangheun Lee, Soo Jung Park, Jae Hee cheon, Tae Il Kim, Won Ho

More information

Heat-killed Lactobacillus casei

Heat-killed Lactobacillus casei Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection Yu-Jin Jung, Young-Tae Lee,

More information

Alcoholic hepatitis is a drug-induced disorder

Alcoholic hepatitis is a drug-induced disorder Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute

More information

The Effects of Posture on Neck Flexion Angle While Using a Smartphone according to Duration

The Effects of Posture on Neck Flexion Angle While Using a Smartphone according to Duration J Korean Soc Phys Med, 2016; 11(3): 35-39 http://dx.doi.org/10.13066/kspm.2016.11.3.35 Online ISSN: 2287-7215 Print ISSN: 1975-311X Research Article Open Access The Effects of Posture on Neck Flexion Angle

More information

Supporting Information. Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells

Supporting Information. Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells Supporting Information Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells Neha Kaushik, 1 Su Jae Lee, 2 Tae Gyu Choi 3, Ku Youn Baik,

More information

Preceptorship at the Yonsei Cancer Center Gastric Cancer Team. Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea

Preceptorship at the Yonsei Cancer Center Gastric Cancer Team. Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea Preceptorship at the Yonsei Cancer Center Gastric Cancer Team Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea 1 I. Main Topics: - Gastric cancer II. Delegates: Medical oncologists, radiation

More information

CURRICULUM VITAE CHUL LEE, M.D., Ph.D

CURRICULUM VITAE CHUL LEE, M.D., Ph.D CURRICULUM VITAE CHUL LEE, M.D., Ph.D. --------------------------------- PRESENT TITLE: President, University of Ulsan (Since 3. 2011) Professor of Psychiatry, University of Ulsan College of Medicine (UUCM),

More information

A comparison of statistical methods for adjusting the treatment effects in genetic association studies of quantitative traits

A comparison of statistical methods for adjusting the treatment effects in genetic association studies of quantitative traits 34 1 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 1, 2009, pp. 53 62 53 한경화 1), 임길섭 2), 박성하 3), 장양수 4), 송기준 2) 1), 2), 3), 4) A comparison of statistical

More information

Nationwide Cancer Incidence in Korea,

Nationwide Cancer Incidence in Korea, Cancer Res Treat. 2009;41(3):122-131 DOI 10.4143/crt.2009.41.3.122 Special Article Nationwide Cancer Incidence in Korea, 2003 2005 Young-Joo Won, Ph.D. 1 Joohon Sung, M.D. 1,2 Kyu-Won Jung, M.S. 1 Hyun-Joo

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

Acute kidney injury and outcomes in acute decompensated heart failure in Korea

Acute kidney injury and outcomes in acute decompensated heart failure in Korea Acute kidney injury and outcomes in acute decompensated heart failure in Korea Mi-Seung Shin 1, Seong Woo Han 2, Dong-Ju Choi 3, Eun Seok Jeon 4, Jae-Joong Kim 5, Myeong-Chan Cho 6, Shung Chull Chae 7,

More information

Sessione Congiunta SIMDO - FADOI. Acido urico e diabete: quando e come correggere

Sessione Congiunta SIMDO - FADOI. Acido urico e diabete: quando e come correggere Sessione Congiunta SIMDO - FADOI Acido urico e diabete: quando e come correggere Giovanni Gulli ASL CN1 SC Medicina Interna Ospedale Maggiore SS. Annunziata Savigliano, CN Agenda uric acid (UA) metabolism

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Park S-J, Ahn J-M, Kim Y-H, et al. Trial of everolimus-eluting

More information

A Study of the Factors Affecting Life Satisfaction of Korean Youths

A Study of the Factors Affecting Life Satisfaction of Korean Youths , pp.50-55 http://dx.doi.org/10.14257/astl.2015. A Study of the Factors Affecting Life Satisfaction of Korean Youths Hye-Ryeon Yong *, Ha-Na Kang*, Hyun-Seok Hwang* Graduate School of Interaction Design,

More information

Impact of Lesion Length on Chronic Total Occlusion Intervention Outcomes

Impact of Lesion Length on Chronic Total Occlusion Intervention Outcomes Impact of Lesion Length on Chronic Total Occlusion Intervention Outcomes Seung-Woon Rha, Amro Elnagar, Byoung Geol Choi, Sung Il Im, Sun Won Kim, Jin Oh Na, Seong Woo Han, Cheol Ung Choi, Hong Euy Lim,

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

Early Surgery in Asymptomatic Severe Aortic Stenosis Pros and Cons

Early Surgery in Asymptomatic Severe Aortic Stenosis Pros and Cons Early Surgery in Asymptomatic Severe Aortic Stenosis Pros and Cons Duk-Hyun Kang, M.D. Division of Cardiology Asan Medical Center Seoul, Korea Background Dilemma of balancing the risks versus benefits

More information

The Change of Ginsenoside Composition in the Ginseng (Panax ginseng) Flower Buds by the Ultrasonication and Vinegar Process

The Change of Ginsenoside Composition in the Ginseng (Panax ginseng) Flower Buds by the Ultrasonication and Vinegar Process Natural Product Sciences 21(2) : 93-97 (2015) The Change of Ginsenoside Composition in the Ginseng (Panax ginseng) Flower Buds by the Ultrasonication and Vinegar Process Hyeon Hui Gwak 1, Jeong Tae Hong

More information

Radiology Illustrated

Radiology Illustrated Radiology Illustrated For further volumes: http://www.springer.com/series/11755 In-One Kim Editor Radiology Illustrated: Pediatric Radiology Editor In-One Kim, M.D. Department of Radiology Seoul National

More information

CURRICULUM VITAE , St.Mary s Hospital, The Catholic University of Korea, Seoul, Korea National Boards of Medical Doctor #28022

CURRICULUM VITAE , St.Mary s Hospital, The Catholic University of Korea, Seoul, Korea National Boards of Medical Doctor #28022 CURRICULUM VITAE I. PERSONAL DATA A. Name: Soo-Heon Park, M.D. B. Birth Date: January 21, 1960 C. Birthplace: Weon Ju, Kwang Won Do, Korea D. Citizenship: Korea II. EDUCATION A. Medical Degree: 1978-1984,

More information

A study of the awareness of chronic liver diseases among Korean adults

A study of the awareness of chronic liver diseases among Korean adults The Korean Journal of Hepatology 2011;17:99-105 DOI: 10.3350/kjhep.2011.17.2.99 Original Article A study of the awareness of chronic liver diseases among Korean adults Dae Won Jun 1,6*, Yong Kyun Cho 2,6*,

More information

Date & Time Apr. 20 (Thu.), 11:10-12:10 Venue Halla Hall Moderators Prof. Sung-Bae Kim (ASAN Medical Center, Korea)

Date & Time Apr. 20 (Thu.), 11:10-12:10 Venue Halla Hall Moderators Prof. Sung-Bae Kim (ASAN Medical Center, Korea) Plenary Lecture 1: Past and Future Treatment of HER2-Positive Breast Cancer Date & Time Apr. 20 (Thu.), 11:10-12:10 Venue Halla Hall Prof. Sung-Bae Kim (ASAN Medical Center, Korea) Prof. Martine Piccart

More information

Caffeine attenuates lipid accumulation via activation of AMP-activated protein kinase signaling pathway in HepG2 cells

Caffeine attenuates lipid accumulation via activation of AMP-activated protein kinase signaling pathway in HepG2 cells BMB Reports Caffeine attenuates lipid accumulation via activation of AMP-activated protein kinase signaling pathway in HepG2 cells Hai Yan Quan, Do Yeon Kim & Sung Hyun Chung * Department of Pharmacology

More information

Prevalence of Latent Tuberculosis Infection among Health Care Workers in South Korea: A Multicenter Study

Prevalence of Latent Tuberculosis Infection among Health Care Workers in South Korea: A Multicenter Study ORIGINAL ARTICLE http://dx.doi.org/10.4046/trd.2013.75.1.18 ISSN: 1738-3536(Print)/2005-6184(Online) Tuberc Respir Dis 2013;75:18-24 Prevalence of Latent Tuberculosis Infection among Health Care Workers

More information

Cell Injury MECHANISMS OF CELL INJURY

Cell Injury MECHANISMS OF CELL INJURY Cell Injury MECHANISMS OF CELL INJURY The cellular response to injurious stimuli depends on the following factors: Type of injury, Its duration, and Its severity. Thus, low doses of toxins or a brief duration

More information

DIAMOND Study Investigators

DIAMOND Study Investigators Seung-Ho Hur, Wooyeong Jang, Jang-Whan Bae, Dong-Ju Choi, Young-Keun Ahn, Jong-Sun Park, Rak-Kyeong Choi, Dong-Hoon Choi, Joon-Hong Kim, Kyoo-Rok Han, Hun-Sik Park, So-Yeon Choi, Jung-Han Yoon, Hyeon-Cheol

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010 cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is

More information

Time / Venue Convention Hall A Convention Hall B. 10:15~10:45 Coffee Break 10:45~11:00 Opening Remarks Plenary Lecture 1 11:00~11:40

Time / Venue Convention Hall A Convention Hall B. 10:15~10:45 Coffee Break 10:45~11:00 Opening Remarks Plenary Lecture 1 11:00~11:40 September 13-14, 2013 ICLA 2013 IMEABLE September 13 (Fri), 2013 ime / Venue Convention Hall A Convention Hall B 08:15~10:15 Symposium I Basic Research Committee Workshop 10:15~10:45 Coffee Break 10:45~11:00

More information

shehab Moh Tarek ... ManarHajeer

shehab Moh Tarek ... ManarHajeer 3 shehab Moh Tarek... ManarHajeer In the previous lecture we discussed the accumulation of oxygen- derived free radicals as a mechanism of cell injury, we covered their production and their pathologic

More information

BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR

BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR The West London Medical Journal 2010 Vol 2 No 4 pp 29-35 BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR Sairah Akbar The topic of obesity is rarely out of the public eye with an increasingly

More information

Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus Patients

Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus Patients Review Article Endocrinol Metab 2016;31:354-360 http://dx.doi.org/10.3803/enm.2016.31.3.354 pissn 2093-596X eissn 2093-5978 Insulin Secretory Capacity and Insulin Resistance in Korean Type 2 Diabetes Mellitus

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

PROGRAM. Room A (English Session) (Convention 4F) 17 th (Sat) Nov. 08:00-08:25 Registration 08:25-08:30 Opening Remark

PROGRAM. Room A (English Session) (Convention 4F) 17 th (Sat) Nov. 08:00-08:25 Registration 08:25-08:30 Opening Remark Room A (English Session) (Convention 4F) 17 th (Sat) Nov. 08:00-08:25 Registration 08:25-08:30 Opening Remark Postoperative Pain YOUN-WOO LEE (Yonsei Univ., Korea) 08:30-08:55 Epidemiology & Risk Factor

More information